Subjects
The study was conducted in two parts. In the first part, total 37 children with immune associated DAH were included, in which 16 cases were classified as the exacerbation group with acute alveolar hemorrahge (DAH-A group), and 21 cases were classified as the remission group without acute alveolar hemorrahge (DAH-R group). And, 18 healthy children were included as the healthy control group (HC group). In the second part, total 24 children with immune associated DAH were included in this study (DAH group). And, 13 children with acute airway foreingn body or mild benign airway stenosis, but without infection were included as the control group (HC group). Acute airway foreingn body was defined as the time elapsed between aspiration event and foreign body removal within 24 hours. All the subjects with acute airway foreingn body included in the control group were absence of any previous health problems, and all the subjects with mild benign airway stenosis were absence of any other prvious health problems except the airway stenosis. The subjects with immune associated DAH, and those with acute airway foreingn body or mild benign airway stenosis were recruited from the pediatric department of the First Affiliated Hospital of Guangxi Medical University (Nanning, Guangxi, China). The healthy children were recruited from the preventive care department of the same hospotal. All the subjects were given informed consent prior to their inclusion in the study. The study was approved by the institutional ethics review board of the First Affiliated Hospital of Guangxi Medical University.
Diagnostic criteria for immune associated DAH and definition of the disease phase
Diagnosis of DAH was based on respiratory symptoms (including dyspnea, hemoptysis and cough), iron deficiency anemia, diffuse pulmonary infiltrates (ground-glass opacities or consolidations) on the chest CT and the presence of hemosiderinladenmacrophages in the BALF or lung tissue specimens[1, 3]. The cases satisfying the above DAH diagnostic criteria, and accompanying with at least one of the following conditions: immune disorders which could result in DAH definitely, pulmonary capillaritis, deposition of immune substances in the basement membranes of alveolar walls, a good response to immunosuppressive therapy (for the cases without a proven immunological origin, and having excluded the non-immune mediated DAH pathogenic factors) were identified as immune associated DAH[2-4, 6, 13-16]. A good response to immunosuppressive therapy was defined as relief of respiratory symptoms (dyspnea, hemoptysis), anemia and reduction of pulmonary infiltrates on the chest image within 4-8 weeks of glucocorticoid (prednisone 1-2mg/kg·d or equivalentdoseofmethylprednisolone) monotherapy or combined with immunosuppressive agents initiation[5, 17]. Exacerbation phase with acute alveolar hemorrahge was defined as presence of anemia and diffuse pulmonary infiltrates on the chest CT[15, 18-20]. Remission phase without acute alveolar hemorrahge was defined as absence of hemoptysis, anemia, or pulmonary infiltrates on the chest CT[15, 18-20].
Bronchoalveolar lavage (BAL) with bronchoscope and BALF processing
Via the bronchoscope, BAL was performed by instilling 10-20 ml of saline into the target segment, with a dwell time of 30 seconds, followed by aspiration. For the children with immune associated DAH, the choice of target segment preferentially selected the medial or lateral segment of the right middle lobe, or the left lingular segment, or the segment with the most obvious pulmonary infiltrates on the chest CT. For the controls, the choice of target segment selected the segment with normal appearance on the chest CT, and preferentially selected the medial or lateral segment oftherightmiddlelobe, or the left lingular segment. To reduce the pollution of bronchial secretions, the BALF from the first lavage was discarded. To obtained the qualified BALF, the BALF recovery rate with greater than 40% was required in this study. Then, the BALF was centrifuged at 2000rpm for 10 min. The supernatant was aspirated and stored at -80°C for soluble proteins assays and cell experiment in vitro.
Detection of the cytokines in the BALF using CBA method
Briefly, 50 μl of BALF supernatant was used to measure the levels of IL-1β, IL-2, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-13, IL-17A, MCP-1, RANTES, GM-CSF, VEGF, Granzyme B and TNF. Cytokines levels were measured using a CBA kit (BD Bioscience, CA, USA). All experimental procedures were conducted according to the manufacturer's guidelines.
Monocytes isolation and MDMs preparation
Based on the previous studies[21], peripheral blood was obtained from non-smoking healthy donors. Peripheral blood mononuclear cells (PBMCs) were isolated from EDTA anticoagulant whole blood by FicollPaque (STEMCELL) density gradient centrifugation. PBMCs were suspended in serum-free RPMI 1640 medium (Gibco) supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin (Solarbio), and were seeded in the 6-well (for qRT-PCR) or 12-well (for FCM) culture plate at a density of 1-1.5×107 cells per well for 1-1.5 hours in a humidified incubator containing 5% CO2 at 37℃ to allow monocyte adhesion. Non-adherent cells were removed. The adherent monocytes were further incubated in RPMI 1640 medium (Gibco) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin (Solarbio), and M-CSF (20ng/ml, Sigma-Aldrich) for 7 days with media replacement every 2-3 days to obtain MDMs.
Stimulation of MDMs by BALF supernatant
After 7 days incubation, MDMs were obtained and the medium was replaced with RPMI 1640 medium (Gibco) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Gibco), 100 U/ml penicillin and 100 mg/ml streptomycin (Solarbio), but without M-CSF. Medium was supplemented with 10% (v/v) of subject’s BALF supernatant for macrophage stimulation.
RNA purification and qRT-PCR analysis
Twenty-four hours post-stimulation, total RNA of the MDMs was extracted using the AxyPrep Multisource Total RNA Miniprep Kit (Axygen) according to the manufacturer’s protocol. Up to 500ng of the total RNA was reverse transcribed using the PrimeScript™ RT reagent kit (Takara) according to the manufacturer’s instructions. qRT-PCR reactions were performed using the SYBR Premix Ex Taq II (Tli RNaseH Plus) kit (Takara) with specific primers and run using 7500 Real Time PCR System (Applied Biosystems). All primers were used in the synthesis (Sangon Biotech) and sequences are listed in Table 1. The amount of mRNA was quantified using the 2‑∆∆Ct method.
Table 1 PCR primer sequences in this study for the target genes
Gene
|
Forward
|
Reverse
|
IL-1β
|
GACCTGGACCTCTGCCCTCTG
|
GCCTGCCTGAAGCCCTTGC
|
TNF-α
|
CGTGGAGCTGGCCGAGGAG
|
GCAGGCAGAAGAGCGTGGTG
|
MRC1
|
GCCAGGGTGTGTTGCCATGAG
|
TCGGTGGGTGGGTTACTCCTTC
|
TGM2
|
TGAGGAGCAGAAGACGGTGGAG
|
TGTGGAGCGGCAGCAGGTC
|
CD163
|
ATCAACCCTGCATCTTTAGACA
|
CTTGTTGTCACATGTGATCCAG
|
IL-6
|
CACTGGTCTTTTGGAGTTTGAG
|
GGACTTTTGTACTCATCTGCAC
|
FCM for the peripheral blood monocytes subtype
EDTA anticoagulant blood sample was obtained. Then, 100ul of the EDTA anticoagulant blood was added to the flow tube. Fc receptors (FcR) were blocked using human BD Fc Block™ ( BD Biosciences). The cells were stained with PE Mouse Anti-Human CD14 (BD Biosciences) and PE-Cy™7 Mouse Anti-Human CD16(BD Biosciences) for 30 min at 4°C in the dark. Next, erythrocytes were lysed by BD Pharm Lyse™ Lysing Buffer (BD Biosciences). Sample was washed once in PBS before performing FCM.
FCM for the MDMs polarization
After 48h incubation, the supernatantwas removed, and the cells were washed three times with PBS. Then, the cells were incubated with 1ml 5 mM EDTA (Solarbio) on ice for 20 minutes. Next, the cells were detached by gentle scraping with cell scrapers. After detachment, the cells were washed 2 times with PBS, and were resuspended in 100ul PBS in the flow tube. Fc receptors (FcR) were blocked using human BD Fc Block™ ( BD Biosciences). The cells were stained with PE Mouse Anti-Human CD14 (BD Biosciences), PE-Cy™7 Mouse Anti-Human CD80 (BD Biosciences), FITC Mouse Anti-Human CD86 (BD Biosciences), Alexa Fluor® 647 Mouse Anti-Human CD163 (BD Biosciences) and BB700 Mouse Anti-Human CD206 (BD Biosciences) for 30 min at 4°C in the dark. Sample was washed once in PBS before performing FCM. Fluorescence was measured with the FACS Canto II (BD Biosciences). The proportion of cells and the mean fluorescence intensity (MFI) of the markers was determined using FlowJo 7.6 (TreeStar, Ashland, OR).
Statistical analysis
Statistical analysis was performed using SPSS 20.0 soft. Test for normality was performed using the one - sample kolmogorov - smirnov test. The homogeneity of variance test was performed using the Levene’s test. For two groups, two - sample t - test was used if the data met normal distribution and variance homogeneity; otherwise, Mann-Whitney U test was used. For multiple groups, one - way ANOVA test followed by post hoc test using the least significance differfence test was used if the data met normal distribution and variances homogeneity, if not, by Kruskall - Wallis H test. For the categorical variables, comparisons between groups were performed by the χ2 test or the Fisher exact test. A two-sided P value<0.05 was considered to be statistically significant.