The REV1-Targeting Inhibitor JH-RE-06 Triggers Programmed Cell Death by Regulating NCOA4-Mediated Ferritinophagy and the KEAP1-NRF2-ARE Pathway in CRC Cells

doi:10.21203/rs.3.rs-5221446/v1

Download PDF

Article

The REV1-Targeting Inhibitor JH-RE-06 Triggers Programmed Cell Death by Regulating NCOA4-Mediated Ferritinophagy and the KEAP1-NRF2-ARE Pathway in CRC Cells

https://doi.org/10.21203/rs.3.rs-5221446/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Oncogenes accelerate DNA replication, triggering excessive replication origin activation. This leads to DNA replication stress and genomic instability in cancer cells, making replication stress a potential therapeutic target. Translesion synthesis (TLS) serves as a compensation mechanism for replication stress, enabling cancer cells to acquire a growth advantage. Cancer cells exploit translesion synthesis (TLS) to circumvent DNA adducts produced by platinum-based chemotherapeutics, leading to the emergence of resistance. Consequently, targeting TLS offers a dual advantage for oncological therapy. The application of the translesion synthesis polymerase REV1 inhibitor JH-RE-06 in the treatment of colorectal cancer (CRC) remains unexplored. The molecular mechanisms by which JH-RE-06 induces programmed cell death have also not been reported. Our findings revealed that JH-RE-06 could trigger programmed cell death in CRC cells.Specifically, JH-RE-06 enhances the level of cleaved caspase-3 and cleaved PARP1 in cancer cells, stimulates NCOA4-mediated ferritinophagy, which results in ferroptosis. Cells activate the KEAP1-NRF2 pathway in response to the oxidative stress caused by JH-RE-06. This programmed cell death (PCD) can be reversed by cysteine-synthesizing pharmaceuticals. While JH-RE-06 does not increase the sensitivity of CRC cells to oxaliplatin, it effectively suppresses clonal proliferation of oxaliplatin-resistant cell lines in vitro and inhibits oxaliplatin-resistant xenograft tumors growth in vivo. The data indicate that JH-RE-06 may serve as a viable second-line chemotherapeutic treatment for CRC in cases of chemoresistance.

JH-RE-06

Colorectal Cancer (CRC)

NCOA4

Ferroptosis

Chemoresistance

In 2020, there were more than 1.9 million new cases of colorectal cancer (CRC) worldwide annually, leading to almost 935,000 fatalities. This accounted for one-tenth of all cancer cases and deaths¹. While chemotherapy is the standard treatment for metastatic CRC, the median overall survival is only 20 months², and the five-year survival rate is a mere 12%³. It is now understood that chemotherapy resistance is caused by increased DNA repair signals, changes in metabolic pathways, and block in programmed cell death (PCD) pathways, leading to a poor prognosis⁴. Therefore, understanding the mechanisms of drug resistance and developing targeted therapies that induce novel forms of PCD is crucial. Albeit oncogene activation, a hallmark of tumor growth, provides cancer cells with significant benefits, it also induces replication stress (RS)⁵. Cells have evolved multiple mechanisms to manage RS, preventing excessive activation that could lead to genomic instability and DNA damage. One such mechanism is specialized translesion synthesis (TLS), which allows DNA replication to continue past damaged sites, avoiding replication fork failure⁶.

In cancer cells, the TLS core factor REV1 promotes chemotherapy resistance and growth advantage by dynamically recruiting Polζ in an "on the fly" or "gap-filling" process. The "on the fly" process involves the accurate enzyme Polδ temporarily switching to the mutagenic TLS protein REV1 when encountering DNA damage caused by platinum-based chemotherapies. REV1 then inserts a cytosine opposite a lesion or abasic sites, allowing Polζ to continue DNA synthesis before switching back to Polδ. This mechanism enables cancer cells to bypass the DNA damage and tolerate the toxicity of platinum-based therapies^7–10. During "gap-filling", single-stranded DNA (ssDNA) gaps briefly appear due to the intermittent process of lagging strand synthesis in continuous replication. Importantly, in cancer cells, active oncogenes and RS create numerous single-stranded DNA gaps that often require REV1-Polζ for repair, given the cells' fast growth rate^11,12. Therefore, targeting the REV1-Polζ complex appears crucial for two reasons. Firstly, it can mitigate the development of resistance to platinum-based chemotherapy. Secondly, inhibiting TLS without requiring additional chemotherapy drugs may facilitate the accumulation of ssDNA gaps. These gaps impede the ability of cancer cells to replicate and proliferate¹³, ultimately leading to their death.

Several studies have reported that the inactivation of DNA mismatch repair (MMR) or the loss of p53 in CRC cells results in a 10.3-fold upregulation of REV1 mRNA levels¹⁴. The rate of development of intestinal adenomas in mice is accelerated by transgenic expression of REV1, with the rate of development being directly proportional to the level of REV1 expression¹⁵. Low expression of REV1 has been associated with a more favorable prognosis for CRC in terms of disease-specific survival (DSS) and disease-free survival (DFS), according to the findings of a pan-cancer genomic analysis¹⁶. In comparison to adjacent normal tissues, REV1 exhibits higher expression in CRC tissues, according to our preliminary research. Furthermore, high REV1 expression correlates with a poor prognosis in various tumors, including CRC. Therefore, small molecule drugs that specifically target REV1 hold significant promise for CRC treatment.

Wojtaszek JL et al. developed a novel small molecule inhibitor, JH-RE-06, that specifically targets REV1. Combining JH-RE-06 with cisplatin has been documented to substantially arrest tumor growth and significantly prolong survival in mouse models¹⁷. This drug reduces cisplatin-induced mutations and enhances tumor cell sensitivity to cisplatin – all of which suggest potential clinical utility. However, further research is warranted to validate the therapeutic effectiveness of JH-RE-06 as a specific medication for CRC. Our investigation demonstrates that JH-RE-06 enhances the level of cleaved caspase-3 and cleaved PARP1 in cancer cells, stimulates NCOA4-mediated ferritinophagy, which results in increased levels of the labile iron pool (LIP), ultimately inducing ferroptosis. Cells activate the KEAP1-NRF2 pathway in response to the oxidative stress caused by JH-RE-06. This PCD can be reversed by cysteine-synthesizing pharmaceuticals such as NAC. While JH-RE-06 does not increase the sensitivity of CRC cells to oxaliplatin, it effectively suppresses clonal proliferation of oxaliplatin-resistant cell lines in vitro and inhibits oxaliplatin-resistant xenograft tumors growth in vivo, displaying favorable safety profiles. The data indicate that JH-RE-06 may serve as a viable second-line chemotherapeutic treatment for colorectal cancer in cases of chemoresistance.

Cell Culture

Human colon cancer cell lines HCT116 and SW620 were obtained from Wuhan Sibai Biotech Co., Ltd. and cultured in a 37°C incubator with 5% CO₂. The culture medium consisted of 90% DMEM (G4511, Servicebio, China) supplemented with 10% FBS (G8002, Servicebio, China) and 1% penicillin-streptomycin (G4003, Servicebio, China).

Inhibitors

JH-RE-06 (HY-12621, MCE, USA), Deferoxamine (HY-B1625, MCE), Ferrostatin-1 (HY-100579, MCE, USA), Erastin (HY-15763, MCE, USA), Z-VAD-FMK (HY-16658B, MCE, USA), Necrostatin-1 (HY-15760, MCE, USA), Chloroquine (HY-17589A, MCE, USA), Brefeldin A (HY-16592, MCE, USA), N-acetylcysteine (HY-B0215, MCE, USA), L-Penicillamine (196312, Sigma, USA), 2-Mercaptoethanol (M3148, Sigma, USA).

RNA interference

When the cells in the six-well plate reach 60% confluency, transfection is performed. Dilute 15 µL of Lipofectamine™ 3000 (Thermofisher. L3000001, USA) in 250 µL Opti-MEM™ Reduced Serum Medium (Thermofisher. 31985070, USA). Then, dilute 15 µL of ATG7 siRNA I (Cell Signaling Technology, #6604, USA) in the same volume of Opti-MEM™ Reduced Serum Medium. Gently mix the two diluted solutions and let them stand for 15 minutes. Then, add the mixture to the culture medium and detect after 48 hours. The sequences of the siRNAs were as follows:

Genes	Makers	Sequences
Genes	Makers	Sense(5’-3’)	Antisense(5’-3’)
NRF2 Knockdown	Nrf2-homo-1005	GGGAGGAGCUAUUAUCCAUTT	AUGGAUAAUAGCUCCUCCCTT
	Nrf2-homo-1346	CCUGCUACUUUAAGCCAUUTT	AAUGGCUUAAAGUAGCAGGTT
	Nrf2-homo-1439	CCUGAAAGCACAGCAGAAUTT	AUUCUGCUGUGCUUUCAGGTT
SLC7A11 Knockdown	SLC7A11-01	GGAGUUAUGCAGCUAAUUA	UAAUUAGCUGCAUAACUCC
	SLC7A11-02	CUACUUUACGACCAUUAAU	AUUAAUGGUCGUAAAGUAG
	SLC7A11-03	GAAUCUUCAUCUCUCCUAA	UUAGGAGAGAUGAAGAUUC
NCOA4 Knockdown	NCOA4-01	GACCUUAUUUAUCAGCUUA	UAAGCUGAUAAAUAAGGUC
	NCOA4-02	GGAGAACAGUCAGACUUCU	AGAAGUCUGACUGUUCUCC
	NCOA4-03	CCAGGAAGUAUUACUUAAU	AUUAAGUAAUACUUCCUGG

Tandem Mass Tags (TMT) Proteomic Sequencing

HCT116 cells were treated with DMSO, 3µM JH-RE-06, 5µM Oxaliplatin, and JH-RE-06 & Oxaliplatin (OXA) for 24 hours, after which the supernatant was removed, and the cells were washed with PBS and collected. The samples were then frozen at -80°C. Subsequently, the samples were sent to Shanghai Luming Biological Technology Co., Ltd. for processing. After sonication on ice, the protein supernatant was collected and quantified using the BCA assay. After standardizing the concentration, the samples were enzymatically digested with trypsin at 37°C overnight, and the digested samples were freeze-dried and stored at -80°C. TMTpro reagents were used for peptide labeling, followed by reverse-phase chromatographic separation. The separated peptides were then subjected to mass spectrometry analysis with the following key parameters: For MS1 scans, the mass resolution was set to 60,000, the automatic gain control (AGC) value was set to 3 × 10⁶, and the maximum injection time was 50 ms. For MS2 scans, the mass resolution was set to 45,000, the AGC value was set to 2 × 10⁵, and the maximum injection time was 80 ms. Additionally, a dynamic exclusion time of 30 seconds was used. Following mass spectrometry, the data were analyzed using ProteomeDiscoverer 2.4.1.15 (ThermoFisher Scientific).

Western Blotting

Total cellular proteins extracted with RIPA protein lysis buffer (P0013B, Beyotime, China) were separated by SDS-PAGE and transferred onto PVDF membranes under a constant current of 200mA for 90 minutes. After transfer, the membranes were blocked with 5% skim milk powder at room temperature and then incubated with primary antibodies overnight at 4°C. The next day, the membranes were incubated with corresponding secondary antibodies at room temperature for 90 minutes, followed by signal detection using ECL luminescent solution. The primary antibodies used were as follows: Anti-Cleaved Caspase-3 (1:1000, ab214430, Abcam, UK), Cleaved PARP1 (Asp214) (1:1000, #9541, Cell Signaling Technology, USA), GPX4 (1:1000, #52455, Cell Signaling Technology, USA), NCOA4 (1:1000, #66849, Cell Signaling Technology, USA), KEAP1 (1:1000, #8047, Cell Signaling Technology, USA), NRF2 (1:1000, #8047, Cell Signaling Technology, USA), SLC3A2 (1:1000, #47213, Cell Signaling Technology, USA), FTH1 (1:1000, #4393, Cell Signaling Technology, USA), SLC7A11 (1:1000, #12691, Cell Signaling Technology, USA), SLC11A2 (1:1000, #15083, Cell Signaling Technology, USA).

Transmission Electron Microscopy

Cells treated with drugs or DMSO were collected and fixed overnight at 4°C using a fixation solution (G1102, Servicebio, China). This was followed by a 2-hour fixation at room temperature using 1% osmium tetroxide in PBS. After washing, samples underwent gradient dehydration using ethanol and acetone. Samples were embedded in 812 embedding agent (SPI, 90529-77-4) and acetone. Embedding was carried out overnight at 37°C, followed by polymerization at 60°C for 48 hours. Following sectioning, samples were double-stained with uranyl acetate and lead citrate (15 minutes each), dried, and observed under a transmission electron microscope (HT7700, Hitachi, Japan). Images were collected and analyzed.

Real-time qPCR

Total RNA from cells was extracted using the TRIzol reagent kit. cDNA was synthesized by reverse transcription using the TransScript® IV One-Step gDNA Removal and cDNA Synthesis SuperMix kit (AW311-02, TransScript, China) according to the manufacturer's protocol. qPCR amplification was performed using the RR820Q kit (Takara, Japan) according to the fluorescent quantitative PCR system configuration. Data analysis was conducted using the ΔΔCT method. The primer sequences used are as follows:

Genes	Sequences
Genes	Sense (5’-3’)	Antisense (5’-3’)
GAPDH	GGAAGCTTGTCATCAATGGAAATC	TGATGACCCTTTTGGCTCCC
MRPS15	GCAAACCCAGAGGACACCAG	CAGATAGCGTTTGTGGGCTT
MRPS5	CTGGTCCCTGTGGAGAAACAT	TTCCTGAAAGCATCCATCCGA
P62	GGAAGGTGAAACACGGACACTT	CTCTTCTCCTCTGTGCTGGAACT
Slc7a11	GGCAGTTGCTGGGCTGATTTA	GATGACGAAGCCAATCCCTGT
GCLM	GTGATGCCACCAGATTTGACTG	CACTCGTGCGCTTGAATGTC
GCLC	TGTTATGGCTTTGAGTGCTGC	AATGGCTCCAGTCCTCGCT
FTL	TGTGACTTCCTGGAGACTCACTTC	TGGAGGTTGGTCAGGTGGTC
FTH1	CATCAACCGCCAGATCAACCT	GCAAAGTTCTTCAAAGCCACATC
MRPS12	GGCCTCAACACGTCCCTAAC	AGTTGGGCTTCTTCGGCTTG
HMOX1	GTCAGGCAGAGGGTGATAGAAGAG	AGTGTAAGGACCCATCGGAGAAG

Immunofluorescence assay

Cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes. This was followed by membrane permeabilization with 0.5% Triton for 20 minutes. After blocking with goat serum (room temperature for 30 minutes), primary antibodies against Nrf2 (1:200) and Keap1 (1:200) were applied and incubated overnight at 4°C. The next day, cells were incubated with Alexa Fluor 488-conjugated secondary antibodies (1:1000, ab150077, Abcam, UK) at room temperature for 1 hour in the dark. Following PBS washes, nuclei were stained with DAPI for 5 minutes. Slides were then mounted with an anti-fading agent and imaged using laser confocal microscopy. For phalloidin staining, cells were incubated with 100 nM TRITC Phalloidin (Yeasen, China) at room temperature for 30 minutes, followed by DAPI staining after PBS washing. Samples were mounted with an anti-fading agent and imaged using laser confocal microscopy.

CCK8 Assay

Cells in the logarithmic growth phase were digested to prepare cell suspensions. The cell concentration was then adjusted to 5 ×10³ cells/100 µL. Subsequently, 100 µL of the cell suspension was added to each well of a 96-well plate and cultured for 24 hours. After this incubation and 24 hours of drug treatment, a CCK-8 reaction solution was prepared and incubated in the dark for 1 hour in a cell culture incubator. Finally, absorbance values were measured at 450 nm using a microplate reader.

Clone Ability Analysis

Following 24 hours of drug treatment, cells were digested and adjusted to a uniform density. These cells were then seeded into 6-well plates at varying densities (1000, 2000, and 5000 cells per well) and cultured for 14 days. After removing the culture medium, cells were fixed with 4% paraformaldehyde for 20 minutes, followed by washing with PBS. Subsequently, cells were stained with 0.2% crystal violet for 5 minutes. Positive clones were observed under a microscope, and the cloning rate was calculated by dividing the number of observed clones by the number of initially seeded cells.

Ferroptosis Analysis

Cells were treated with drugs, and the following assay kits were used to measure related cellular components: Fe²⁺ content (Cell Ferrous Iron Colorimetric Assay Kit, Elabscience, China), MDA level (MDA Detection Kit, KGT003, Jiangsu Kaiji Biotechnology Co., Ltd., China), and GSH content (GSH Detection Kit, KGT006, Jiangsu Kaiji Biotechnology Co., Ltd., China).

Animal Experiment

Male BALB/c nude mice aged four to five weeks were purchased from Ningxia Medical University Laboratory animal centre. The animal experiment protocol received approval from the Laboratory Animal Ethical and Welfare Committee of the Laboratory Animal Center, Ningxia Medical University (Approval No. IACUC-NYLAC-2022-022). Animals were randomly divided into four groups (at least eight mice per group according to previous experience) and administered oxaliplatin (5 mg/kg) via intraperitoneal injection or JH-RE-06 (1.6 mg/kg) via intratumoral injection. Injections occurred every two days to allow for recovery and tumor size monitoring. Ensure that the maximum volume of the tumor does not exceed 2000mm³ (Volume calculation formula: V = π / 6×Long×Width×High). After 20 consecutive administrations, animals were euthanized with isoflurane, perfused with PBS and 4% paraformaldehyde, and organs and tumor samples were collected, measured, and recorded. All experimental procedures were conducted following relevant guidelines and regulations and are reported in accordance with the ARRIVE guidelines.

H&E Staining

Organ wax blocks from mice underwent sequential deparaffinization in graded xylene solutions, followed by dehydration in ethanol series. Hematoxylin staining (Servicebio, G1005) was performed for 5 minutes, followed by washing with tap water. Differentiation and counterstaining with eosin were then performed. After dehydration in an alcohol gradient and clearing in xylene, the sections were mounted with neutral gum for microscopic examination.

Immunohistochemistry

Tumor tissues were embedded in paraffin and sectioned. The paraffin sections were then deparaffinized (using xylene and ethanol), followed by antigen retrieval with EDTA for 5 minutes. Endogenous peroxidase activity was blocked, and the sections were incubated with primary antibodies against PCNA, Ki-67, and Caspase-3 overnight at 4°C. After washing, the sections were incubated with secondary antibodies, followed by DAB staining, hematoxylin counterstaining, dehydration, and mounting.

Statistical Methods

Cell and molecular experiments were independently repeated at least three times. Data analysis and plotting were performed using GraphPad Prism 9.5.1. For comparisons between groups, one-way analysis of variance (ANOVA) was used. A p-value less than 0.05 was statistically significant.

Varying Combination Strategies and their Influence on JH-RE-06 and Oxaliplatin Efficacy.

It is well-established that oxaliplatin, the primary platinum-based therapy for CRC¹⁸, creates DNA adducts or inter-strand crosslinks (ICLs). REV 1 promotes resistance to oxaliplatin in cancer cells by recruiting Pol ζ to bypass these DNA damage¹⁹. We hypothesized that combining JH-RE-06, a REV1 inhibitor, with oxaliplatin could improve therapeutic efficacy and alleviate resistance. JH-RE-06 was found to suppress the growth and proliferation of CRC cells in a concentration- and time-dependent manner (Figure S1A). SW620 cells were more sensitive to JH-RE-06 than HCT116 cells. We then investigated 3 drug combination protocols: simultaneous delivery, pre-treatment with one drug followed by the other, and vice versa (Fig. 1A). CCK8 assays revealed that the above drug combinations did not yield a synergistic effect on CRC cells (Fig. 1B). Interestingly, CRC cells remained resistant to oxaliplatin even after JH-RE-06 pre-treatment. However, the most effective treatment was sequential administration, with oxaliplatin followed by JH-RE-06 (OXA-JH), yielding an oxaliplatin IC₅₀ of 2.1 µM. We then investigated whether JH-RE-06 enhanced oxaliplatin-induced DNA damage, as this synergy was the theoretical rationale. γH₂AX foci levels were slightly elevated in the combination treatment group, but this increase was not statistically significant (Fig. 1C). This finding is supported by two other DNA damage markers, FANCD2 and 53BP1 (Fig. 1D). Furthermore, western blotting for caspase-3 and PARP1 cleavage showed reduced cleavage with simultaneous drug administration, indicating no synergistic effect on DNA damage-induced cell death (Fig. 1E, F). Finally, using an oxaliplatin-resistant HCT116 cell model (Figure S1B), we assessed the responsiveness of resistant cells to JH-RE-06. CCK8 assays and crystal violet staining indicate that JH-RE-06 effectively inhibits both the proliferation and clonogenic capacity of HCT116 cells(Figure S1C). Importantly, JH-RE-06 effectively suppressed tumor cell growth at concentrations non-toxic to normal cells. In conclusion, the cisplatin sensitizer JH-RE-06 induces elevated levels of cleaved-caspase3 and cleaved-PARP1 in CRC cells, yet does not enhance sensitivity to oxaliplatin. Notably, oxaliplatin-resistant HCT116 cells retain sensitivity to JH-RE-06, suggesting its potential as a second-line chemotherapy option for CRC.

The cellular signal triggered by JH-RE-06 and Oxaliplatin in HCT116 cells beyond the scope of DNA damage.

To understand the global proteomic changes induced by JH-RE-06 and oxaliplatin in CRC cells, we treated HCT116 cells with DMSO, 5 µM OXA, 3 µM JH-RE-06, or the combination (OXA-JH: 5 µM oxaliplatin + 3 µM JH-RE-06) for 24 hours and performed TMT proteomic sequencing (Figure S2A, B). Differentially expressed proteins were defined by a fold change of ≥1.2 or ≤1/1.2 (p-value < 0.05) compared to the DMSO control group. We identified 285, 650, and 570 differentially expressed proteins in the OXA, JH-RE-06, and OXA-JH groups, respectively (Fig. 2A, B, C). OXA treatment downregulated proteins related to ribosomes, ribosome biogenesis, and DNA replication. This aligns with previous research suggesting that oxaliplatin primarily induces ribosomal stress, rather than direct DNA damage, as its mechanism of action ²⁰. Conversely, OXA treatment upregulated proteins enriched in the P53 signaling pathway (Fig. 2D, E). In the JH-RE-06 group, downregulated proteins were associated with DNA replication, oxidative phosphorylation, and cell cycle. Upregulated proteins were significantly enriched in the ferroptosis pathway, including SLC7A11, GCLC, SLC3A2, FTL, NCOA4, FTH1, GCLM, MAP1LC3B, HMOX1, and SLC39A14. These proteins are directly involved in iron metabolism and antioxidant transport, both core processes related to ferroptosis. Additionally, upregulated proteins showed significant enrichment in metabolic pathways such as steroid biosynthesis, cysteine and methionine metabolism, and the TCA cycle (Fig. 2F, G). The OXA-JH combination primarily downregulated proteins involved in DNA damage-related processes (DNA replication, mismatch repair, nucleotide excision repair, and base excision repair). Conversely, ferroptosis pathway proteins remained upregulated (Fig. 2H, I). To clarify, JH-RE-06, a tiny chemical designed to specifically inhibit the DNA damage repair pathway TLS, induces significant changes in the cell that transcend the DNA damage signal. Crucially, JH-RE-06 specifically elevated proteins associated with the ferroptosis pathway. Oxaliplatin, capable of inducing DNA adduct formation, was determined to elicit ribosome stress according to proteome sequencing results (Fig. 2J).

JH-RE-06 triggers ferroptosis in CRC cells.

Proteomic sequencing revealed enrichment in mitochondrial-related pathways, prompting us to investigate changes in the subcellular structures of JH-RE-06-treated CRC cells. Using transmission electron microscopy (TEM), we observed a significant decrease in mitochondrial abundance in both HCT116 and SW620 cells after 12 and 24 hours of JH-RE-06 treatment. Autophagic vacuoles containing engulfed mitochondria were evident (Fig. 3A, B). Given the proteomic data indicating changes in iron transport proteins and upregulation of ferroptosis markers, together with recent studies on the link between autophagy, the labile iron pool (LIP), and ferroptosis²¹, we hypothesized that JH-RE-06 induces ferroptosis in CRC cells. Using specialized assay kits, we found that intracellular free Fe²⁺ levels increased after 6 hours of treatment, peaking at 24 hours(Fig. 3C, D). Simultaneously, the lipid oxidation marker MDA rose (Fig. 3E, F), while GSH levels consistently decreased (Fig. 3G, H). Since cellular iron homeostasis is a key regulator of ferroptosis sensitivity, we co-treated CRC cells with the iron chelator deferoxamine (DFO) and JH-RE-06. At 12 hours, DFO decreased intracellular Fe²⁺ levels and by 24 hours, MDA levels were also reduced. This suggests that JH-RE-06 may promote Fe²⁺-dependent ferroptosis. We then used QPCR to analyze the transcription levels of ferritin (FTH and FTL) and glutathione-related genes (GCLC and GCLM) in HCT116. JH-RE-06 enhanced the transcription of ferroptosis-related proteins, and this effect was counteracted by DFO (Fig. 3I, J). These findings indicate that an iron-dependent mechanism was involved in the ferroptosis triggered by JH-RE-06 in CRC cells.

JH-RE-06 triggers cleaved-caspase3, cleaved-PARP1 and ferroptosis via NCOA4-mediated ferritinophagy

Proteomics sequencing revealed increased NCOA4 expression and decreased expression of MCM2-7 proteins, which are essential for DNA replication. REV1 inhibition can disrupt DNA gap filling, leading to the activation of DNA replication origins in cancer cells. Since NCOA4 regulates DNA replication origins by managing LIP levels and MCM2-7 proteins^22,23, and promotes ferroptosis via ferritinophagy^24,25, we hypothesized that JH-RE-06 elevates LIP in an NCOA4-dependent manner. To investigate, we used western blotting (WB) to assess changes in ferritinophagy-related proteins expression after JH-RE-06 treatment in CRC cells. We found that NCOA4, P62, and LC3 expression increased at 12h and 24h, while FTH1 increased at 12h but decreased at 24h. Consistent with prior findings, DFO alone increased NCOA4 and decreased FTH1²⁶. However, DFO did not alter these JH-RE-06-induced changes in our setting (Fig. 4A, B). We then silenced ATG7 (essential for autophagy) and treated cells with JH-RE-06 (Fig. 4C). WB analysis showed FTH1 upregulation in si-ATG7 cells compared to si-control cells, reversing the JH-RE-06-induced downregulation. The expression trends of NCOA4, LC3, and P62 were also partially reversed in si-ATG7 cells (Fig. 4D). Using FerroOrange to monitor LIP, we found that JH-RE-06 increased intracellular free iron levels in HCT116 cells. Importantly, this increase was not observed in both si-ATG7 and si-NCOA4 groups, indicating that JH-RE-06 influences free Fe²⁺ levels through NCOA4-mediated ferritinophagy (Fig. 4E). Similarly, MDA levels were reduced when ATG7 or NCOA4 was silenced prior to JH-RE-06 treatment (Fig. 4F). Interestingly, JH-RE-06 increased cleaved-caspase3 and cleaved-PARP1 levels after 24 hours, a response reversed by DFO, especially in si-ATG7 cells, suggesting JH-RE-06 triggers Caspase3 and PARP1 cleavage in a ferritinophagy-dependent manner (Fig. 4D). Based on the above findings, we propose that JH-RE-06 induces NCOA4-mediated ferritinophagy, ultimately leading to altered iron homeostasis and elevated levels of cleaved caspase-3, cleaved PARP1, and lipid peroxidation.

The KEAP1-NRF2-ARE pathway is involved in regulating JH-RE-06 induced programmed cell death in CRC cells.

To investigate whether JH-RE-06-induced cell death could be reversed, we pre-treated CRC cells with a series of programmed cell death inhibitors, including apoptosis inhibitor Z-VAD-FMK, necroptosis inhibitor Necrostatin-1, autophagy inhibitor Chloroquine, and Brefeldin A, ferroptosis inhibitor DFO and ferrostatin-1, and cysteine regenerator L-Penicillamine (L-Pen), 2-Mercaptoethanol (2-ME) and N-acetylcysteine (NAC). CCK8 assays showed that while JH-RE-06 increased MDA levels, neither ferroptosis inhibitor prevented cell death. However, co-treatment with a disulfidptosis inhibitor completely rescued JH-RE-06-induced cell death (Fig. 5A, B). Given that disulfidptosis involves cytoskeletal collapse, we used phalloidin staining after drug treatment. In SW620 cells, cytoskeletal collapse began 12h post-JH-RE-06 treatment and worsened by 24h. Co-treatment with NAC, 2-ME, and L-Pen significantly reversed this collapsed morphology (Fig. 5C). Considering that L-Pen, 2-ME, and NAC all play roles in cysteine regeneration and antioxidant activity, we speculate that the cells experience oxidative stress following drug induction.Based on the results of proteomic sequencing, we focused on NRF2 and its downstream gene SLC7A11, GCLC, SLC3A2 (4F2hc), GCLM, HMOX1, and SLC39A14²⁷. We isolated proteins from HCT116 and SW620 cells treated with JH-RE-06 for 12 and 24 hours. WB revealed time-dependent KEAP1 degradation and increased NRF2 levels at 12 hours following drug treatment. Simultaneously, the ARE proteins SLC7A11 and SLC3A2 (4F2hc, 75KD band) were upregulated. Pre-treatment with DFO reversed the increase in SLC7A11 expression but did not affect SLC3A2. We also observed a time-dependent decrease in glutathione peroxidase 4 (GPX4) levels (Fig. 5D, E). Immunofluorescence confirmed that JH-RE-06 induced NRF2 nuclear translocation from 6 to 24 hours, correlating with KEAP1 degradation (Fig. 5F, G). Furthermore, MDA levels increased significantly in NRF2 knockdown cells treated with JH-RE-06 compared to the si-control group (Figure S3A, B). The qPCR results suggest that the upregulation of SLC7A11 and SLC3A2 occurs at the transcriptional level (Figure S3C). This, suggests that KEAP1-NRF2-ARE pathway is involved in regulating JH-RE-06 induced programmed cell death in CRC cells.

JH-RE-06 inhibited the growth of oxaliplatin-resistant tumors in vivo.

While the combination of oxaliplatin and JH-RE-06 yielded inconsistent therapeutic effects across various drug combination methods, the ability of JH-RE-06 to inhibit oxaliplatin-resistant cancer cells suggests its potential application in second-line chemotherapy for colorectal cancer. To investigate this potential, we evaluated the therapeutic efficacy of JH-RE-06 in vivo using a xenograft mouse model established with the oxaliplatin-resistant HCT116 cells. Mice were divided into four groups and treated with oxaliplatin and JH-RE-06 for 40 days following a 12-day tumor growth period (Fig. 6A). No significant differences in body weight were observed among the treated groups. As expected, the tumors in the DMSO group were significantly larger, and oxaliplatin treatment failed to control tumor growth, confirming the resistance of the cell line. Conversely, the JH-RE-06 treatment group exhibited the most significant control of tumor volume, demonstrating its efficacy against oxaliplatin-resistant tumors (Fig. 6B, C). While pre-treatment with oxaliplatin did not abolish the effectiveness of JH-RE-06, it did not lead to a higher therapeutic effect. We further evaluated the safety of JH-RE-06 by examining the hearts, livers, spleens, lungs, and kidneys of treated mice through H&E staining. No significant pathological damage was observed in these major organs(Fig. 6D). Additionally, immunohistochemistry for proliferation markers Ki67 and PCNA revealed that JH-RE-06 significantly suppressed tumor growth and blood vessel formation. Consistent with previous findings suggesting JH-RE-06-induced caspase3 cleavage in resistant cells, immunohistochemistry confirmed an increase in cleaved-caspase3 levels in the tumor tissue (Fig. 6E). These findings suggest that JH-RE-06 effectively suppresses the proliferation of oxaliplatin-resistant CRC cells in vivo with minimal adverse effects. This data supports the potential of JH-RE-06 as a viable second-line chemotherapeutic option for CRC treatment.

In the last ten years, numerous investigations have concentrated on increasing cancer cell sensitivity to platinum-based agents by genetically blocking TLS^7,8. Prior research has demonstrated that the ablation of REV1 can enhance the susceptibility of cancer cells to oxaliplatin, evidenced by increased DNA damage and apoptosis. Our findings indicate that pretreatment with the REV1-targeting inhibitor JH-RE-06 enhances cellular resistance to oxaliplatin. The increase in cleaved-caspase 3 and cleaved-PARP1 levels caused by JH-RE-06 is diminished when administered with oxaliplatin, suggesting that the two agents do not demonstrate a synergistic effect. Proteomic analysis indicates that the signaling induced by JH-RE-06 and oxaliplatin in cells extends beyond mere DNA damage. Oxaliplatin predominantly downregulates ribosome-associated proteins, indicating that ribosomal stress is its principal mechanism, in accordance with prior findings. Conversely, JH-RE-06 induces multiple biological reactions, including as oxidative stress, ferroptosis, and autophagy. Consequently, the combination of JH-RE-06 with oxaliplatin is not advised.

While previous research has explored the effect of JH-RE-06 on lung cancer and BRCA1/2-deficient cancer cells^28,29, the specific PCD mechanisms remained unclear. Following JH-RE-06 treatment, intracellular Fe²⁺ and MDA concentrations in cancer cells markedly elevated, but GSH levels diminished. Moreover, many autophagosome-like vacuoles were detected within the cells, indicating the presence of ferroptosis. Western blot examination indicated that JH-RE-06 dramatically elevated the expression of autophagy markers LC3I/II and P62, and modulated the levels of ferritinophagy-related proteins NCOA4 and ferritin FTH1. In si-ATG7 and si-NCOA4 cells, the alterations in FTH1, LC3I/II, and P62 expression generated by JH-RE-06 were reversed. Furthermore, the elevation of LIP and MDA levels caused by JH-RE-06 was significantly diminished in si-NCOA4 cells. The results indicate that JH-RE-06-induced ferroptosis dependent on NCOA4-mediated ferritinophagy. The iron ion dynamics addressed by REV1 may be indirectly seen in Recent studies: Several nuclear DNA polymerase enzymes depend on [4Fe-4S] cluster to perform DNA metabolism tasks, such as Pol α, δ, ɛ, and Pol ζ³⁰; Iron is essential for DNA metabolism, with Fe-S-containing enzymes facilitating accurate replication³¹ and ISCs integrated within DNA repair enzymes to mend damage based on their electron diffusion ability ³²; Last, but not the least, Recent research highlights NCOA4's role in regulating DNA replication origins, iron autophagy-mediated LIP, and Fe-S cluster-dependent degradation³³.

A fundamental difference between PCD and physical/chemical damage is the possibility of its reversal using particular inhibitors. Drug screening revealed that conventional ferroptosis inhibitors, including DFO and ferrostatin-1, failed to display any protective effects. Cysteine regenerators, such as L-Pen, 2-ME, and NAC, substantially inhibited cell death produced by JH-RE-06. Furthermore, phalloidin staining demonstrated that JH-RE-06 produced cytoskeletal collapse, which was subsequently restored by L-Pen, 2-ME, and NAC. This compelled us to conduct a more thorough investigation of alterations in intracellular oxidative stress. The results from WB and IF demonstrated that following drug induction, NRF2 translocated to the nucleus in a way reliant on KEAP1 degradation, thereby beginning the transcription of the downstream antioxidant factors SLC7A11 and SLC3A2. An acceptable rationale for the activation of the KEAP1-NRF2 pathway in cells is that: The rise in dynamic LIP levels promptly initiates the Fenton reaction. Then, intracellular MDA levels are heightened subsequent to JH-RE-06 therapy. In response to cellular damage from excessive lipid peroxidation, cells increase the expression of SLC7A11 and SLC3A2 via the KEAP1-NRF2-ARE antioxidant pathway, which improves the uptake of extracellular cysteine and promotes the synthesis of intracellular GSH.

Recently, a case report indicated that L-Pen, 2-ME, and NAC can be used to inhibit disulfidptosis³⁴. Disulfidptosis is a recently discovered form of PCD characterized by the high expression of SLC7A11 in cells³⁵. When NADPH is limited, intracellular cystine cannot be reduced to cysteine, leading to the accumulation of disulfide bonds in the cytoskeleton, ultimately resulting in the collapse of the cytoskeleton. There exists a subtle balance between ferroptosis and disulfidptosis: Cells import exogenous cystine through SLC7A11/SLC3A2 to boost antioxidant levels and counter iron-dependent cell death. However, increased expression of SLC7A11 and SLC3A2 to take in cysteine and convert it to GSH requires the consumption of NADPH³⁶. The NADPH is crucial for preserving equilibrium between ferroptosis and disulfidptosis. Our research indicates that JH-RE-06 may trigger disulfide-mediated cell death; however, its molecular markers and regulatory mechanisms require additional examination. This research represents a preliminary investigation into the correlation between TLS inhibition and iron homeostasis; nevertheless, extensive studies are necessary to thoroughly clarify the complex molecular regulatory mechanisms involved. These research are essential, as JH-RE-06 triggers pivotal PCD pathways, including ferroptosis and disulfidptosis, thus offering substantial promise for cancer treatment.

Recent studies indicate that drug-induced (ATR/WEE1 inhibition) or oncogene-induced (Cyclin E overexpression) RS can make cancer cells hypersensitive to TLS inhibition^12,37. This concept holds significant clinical relevance. While drug-resistant cells become insensitive to chemotherapy drugs, drug-induced RS can potentially increase their sensitivity to REV1 inhibitors. To validate this hypothesis, we established a separate group within a tumor xenograft model. Resistant cells were exposed to oxaliplatin for 20 days, followed by JH-RE-06 treatment. The tumor shrinkage slope indicated that drug-induced RS did not appear to influence the susceptibility of resistant cells to JH-RE-06 therapy. However, the inhibitory effect of JH-RE-06 on resistant cells, combined with its minimal side effects, suggests its potential as a second-line chemotherapeutic option for CRC treatment.

This study illustrates that JH-RE-06, a specific REV1 inhibitor, promotes NCOA4-mediated ferritinophagy in CRC cells. This process results in alterations to the LIP, initiating a specific type of ferroptosis marked by increased labile iron levels, activation of ferritinophagy, and ensuing cytoskeletal collapse. Cancer cells engage the KEAP1-NRF2-ARE pathway to mitigate the effects of oxidative stress generated by JH-RE-06. Moreover, although JH-RE-06 does not enhance the susceptibility of cancer cells to oxaliplatin, it markedly suppresses the growth of oxaliplatin-resistant xenograft tumors in vivo, underscoring its considerable promise as a second-line chemotherapy alternative for CRC. The capacity of JH-RE-06 to provoke PCD in colorectal cancer cells has considerable implications for the management of both wild-type and chemotherapy-resistant malignancies. Developing drugs that induce PCD is a vital approach to surmount chemotherapy resistance, especially when conventional apoptosis mechanisms are compromised.

Ethical Approval

All animals were kept in a pathogen-free environment and fed ad lib. The procedures for care and use of animals were approved by the Laboratory Animal Ethical and Welfare Committee of the Laboratory Animal Center, Ningxia Medical University (Approval No. IACUC-NYLAC-2022-022) and all applicable institutional and governmental regulations concerning the ethical use of animals including the ARRIVE guidelines were followed.

Statement of Informed Consent

There are no human subjects in this article and informed consent is not applied.

Consent for publication

Not applicable.

Data Availability

Sequence data that support the findings of this study have been deposited in the China National Center for Bioinformation repository, https://ngdc.cncb.ac.cn/omix/preview/eHgcD72b.

Competing interests

The authors declare that there is no conflict of interest .

Funding

This work was supported by Ningxia Hui Autonomous Region Science and Technology Support Program (grant number . 2021BEG03084) ; Ningxia Education Department Scientific research Program (grant number . NYG2024117).

Authors' contributions

Jianhua Cheng And Xiaoxia Yang contributed equally. Fang Xu provided guidance and supervision. Jianhua Cheng conceived and designed the experiments. Jianhua Cheng and Xiaoxia Yang performed the cell and molecular experiments. Jianhua Cheng and Jie Xu performed pathological analysis. Jianhua Cheng and Wen Zhao performed the animal experiment. Jianhua Cheng and Xiaoxia Yang wrote the manuscript. Feimiao Wang and Yanjie Hao provided technical assistance. All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71, 209-249, doi:10.3322/caac.21660 (2021).
Liu, Z. et al. Nomogram for predicting overall survival in colorectal cancer with distant metastasis. BMC gastroenterology 21, 103, doi:10.1186/s12876-021-01692-x (2021).
Veenstra, C. M. & Krauss, J. C. Emerging Systemic Therapies for Colorectal Cancer. Clin Colon Rectal Surg 31, 179-191, doi:10.1055/s-0037-1602238 (2018).
Gmeiner, W. H. & Okechukwu, C. C. Review of 5-FU resistance mechanisms in colorectal cancer: clinical significance of attenuated on-target effects. Cancer drug resistance (Alhambra, Calif.) 6, 257-272, doi:10.20517/cdr.2022.136 (2023).
Berti, M., Cortez, D. & Lopes, M. The plasticity of DNA replication forks in response to clinically relevant genotoxic stress. Nature reviews. Molecular cell biology 21, 633-651, doi:10.1038/s41580-020-0257-5 (2020).
Yang, W. & Gao, Y. Translesion and Repair DNA Polymerases: Diverse Structure and Mechanism. Annual review of biochemistry 87, 239-261, doi:10.1146/annurev-biochem-062917-012405 (2018).
Hicks, J. K. et al. Differential roles for DNA polymerases eta, zeta, and REV1 in lesion bypass of intrastrand versus interstrand DNA cross-links. Mol Cell Biol 30, 1217-1230, doi:10.1128/MCB.00993-09 (2010).
Sharma, S. et al. REV1 and polymerase ζ facilitate homologous recombination repair. Nucleic Acids Res 40, 682-691, doi:10.1093/nar/gkr769 (2012).
Baranovskiy, A. G. et al. DNA polymerase δ and ζ switch by sharing accessory subunits of DNA polymerase δ. J Biol Chem 287, 17281-17287, doi:10.1074/jbc.M112.351122 (2012).
Mellor, C., Nassar, J., Šviković, S. & Sale, J. E. PRIMPOL ensures robust handoff between on-the-fly and post-replicative DNA lesion bypass. Nucleic Acids Res 52, 243-258, doi:10.1093/nar/gkad1054 (2024).
Taglialatela, A. et al. REV1-Polzeta maintains the viability of homologous recombination-deficient cancer cells through mutagenic repair of PRIMPOL-dependent ssDNA gaps. Mol Cell 81, 4008-4025 e4007, doi:10.1016/j.molcel.2021.08.016 (2021).
Nayak, S. et al. Inhibition of the translesion synthesis polymerase REV1 exploits replication gaps as a cancer vulnerability. Science advances 6, eaaz7808, doi:10.1126/sciadv.aaz7808 (2020).
Nayak, S., Calvo, J. A. & Cantor, S. B. Targeting translesion synthesis (TLS) to expose replication gaps, a unique cancer vulnerability. Expert opinion on therapeutic targets 25, 27-36, doi:10.1080/14728222.2021.1864321 (2021).
Lin, X. & Howell, S. B. DNA mismatch repair and p53 function are major determinants of the rate of development of cisplatin resistance. Mol Cancer Ther 5, 1239-1247, doi:10.1158/1535-7163.Mct-05-0491 (2006).
Sasatani, M. et al. Overexpression of Rev1 promotes the development of carcinogen-induced intestinal adenomas via accumulation of point mutation and suppression of apoptosis proportionally to the Rev1 expression level. Carcinogenesis 38, 570-578, doi:10.1093/carcin/bgw208 (2017).
Zhu, N. et al. REV1: A novel biomarker and potential therapeutic target for various cancers. Frontiers in genetics 13, 997970, doi:10.3389/fgene.2022.997970 (2022).
Wojtaszek, J. L. et al. A Small Molecule Targeting Mutagenic Translesion Synthesis Improves Chemotherapy. Cell 178, 152-159.e111, doi:10.1016/j.cell.2019.05.028 (2019).
Amatu, A. et al. Efficacy of Retreatment with Oxaliplatin-Based Regimens in Metastatic Colorectal Cancer Patients: The RETROX-CRC Retrospective Study. Cancers (Basel) 14, doi:10.3390/cancers14051197 (2022).
Sharma, S., Shah, N. A., Joiner, A. M., Roberts, K. H. & Canman, C. E. DNA polymerase zeta is a major determinant of resistance to platinum-based chemotherapeutic agents. Mol Pharmacol 81, 778-787, doi:10.1124/mol.111.076828 (2012).
Bruno, P. M. et al. A subset of platinum-containing chemotherapeutic agents kills cells by inducing ribosome biogenesis stress. Nature Medicine 23, 461-471, doi:10.1038/nm.4291 (2017).
Yang, P. et al. Ionizing radiation-induced mitophagy promotes ferroptosis by increasing intracellular free fatty acids. Cell death and differentiation 30, 2432-2445, doi:10.1038/s41418-023-01230-0 (2023).
Bellelli, R. et al. NCOA4 transcriptional coactivator inhibits activation of DNA replication origins. Mol Cell 55, 123-137, doi:10.1016/j.molcel.2014.04.031 (2014).
Federico, G. et al. NCOA4 links iron bioavailability to DNA metabolism. Cell reports 40, 111207, doi:10.1016/j.celrep.2022.111207 (2022).
Hou, W. et al. Autophagy promotes ferroptosis by degradation of ferritin. Autophagy 12, 1425-1428, doi:10.1080/15548627.2016.1187366 (2016).
Gao, M. et al. Ferroptosis is an autophagic cell death process. Cell research 26, 1021-1032, doi:10.1038/cr.2016.95 (2016).
Wu, H., Liu, Q., Shan, X., Gao, W. & Chen, Q. ATM orchestrates ferritinophagy and ferroptosis by phosphorylating NCOA4. Autophagy 19, 2062-2077, doi:10.1080/15548627.2023.2170960 (2023).
Cuadrado, A. et al. Therapeutic targeting of the NRF2 and KEAP1 partnership in chronic diseases. Nature reviews. Drug discovery 18, 295-317, doi:10.1038/s41573-018-0008-x (2019).
Chen, Y. et al. REV1 promotes lung tumorigenesis by activating the Rad18/SERTAD2 axis. Cell Death Dis 13, 110, doi:10.1038/s41419-022-04567-5 (2022).
Taglialatela, A. et al. REV1-Polζ maintains the viability of homologous recombination-deficient cancer cells through mutagenic repair of PRIMPOL-dependent ssDNA gaps. Mol Cell 81, 4008-4025.e4007, doi:10.1016/j.molcel.2021.08.016 (2021).
Netz, D. J. et al. Eukaryotic DNA polymerases require an iron-sulfur cluster for the formation of active complexes. Nature chemical biology 8, 125-132, doi:10.1038/nchembio.721 (2011).
Puig, S., Ramos-Alonso, L., Romero, A. M. & Martínez-Pastor, M. T. The elemental role of iron in DNA synthesis and repair. Metallomics : integrated biometal science 9, 1483-1500, doi:10.1039/c7mt00116a (2017).
Arnold, A. R., Grodick, M. A. & Barton, J. K. DNA Charge Transport: from Chemical Principles to the Cell. Cell chemical biology 23, 183-197, doi:10.1016/j.chembiol.2015.11.010 (2016).
Kuno, S. & Iwai, K. Oxygen modulates iron homeostasis by switching iron sensing of NCOA4. J Biol Chem 299, 104701, doi:10.1016/j.jbc.2023.104701 (2023).
Zhong, Z. et al. NFATc1-mediated expression of SLC7A11 drives sensitivity to TXNRD1 inhibitors in osteoclast precursors. Redox biology 63, 102711, doi:10.1016/j.redox.2023.102711 (2023).
Liu, X. et al. Actin cytoskeleton vulnerability to disulfide stress mediates disulfidptosis. Nature cell biology 25, 404-414, doi:10.1038/s41556-023-01091-2 (2023).
Liu, X., Zhuang, L. & Gan, B. Disulfidptosis: disulfide stress-induced cell death. Trends Cell Biol, doi:10.1016/j.tcb.2023.07.009 (2023).
Sekimoto, T., Oda, T., Kurashima, K., Hanaoka, F. & Yamashita, T. Both high-fidelity replicative and low-fidelity Y-family polymerases are involved in DNA rereplication. Mol Cell Biol 35, 699-715, doi:10.1128/mcb.01153-14 (2015).

No competing interests reported.

Download PDF

Editorial decision: Revision requested
18 Nov, 2024
Reviews received at journal
08 Nov, 2024
Reviews received at journal
07 Nov, 2024
Reviewers agreed at journal
29 Oct, 2024
Reviewers agreed at journal
27 Oct, 2024
Reviewers invited by journal
25 Oct, 2024
Editor assigned by journal
25 Oct, 2024
Editor invited by journal
25 Oct, 2024
Submission checks completed at journal
23 Oct, 2024
First submitted to journal
07 Oct, 2024

You are reading this latest preprint version

The REV1-Targeting Inhibitor JH-RE-06 Triggers Programmed Cell Death by Regulating NCOA4-Mediated Ferritinophagy and the KEAP1-NRF2-ARE Pathway in CRC Cells

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Cell Culture

Inhibitors

RNA interference

Tandem Mass Tags (TMT) Proteomic Sequencing

Western Blotting

Transmission Electron Microscopy

Real-time qPCR

Immunofluorescence assay

CCK8 Assay

Clone Ability Analysis

Ferroptosis Analysis

Animal Experiment

H&E Staining

Immunohistochemistry

Statistical Methods

RESULT

JH-RE-06 triggers cleaved-caspase3, cleaved-PARP1 and ferroptosis via NCOA4-mediated ferritinophagy

DISCUSSION

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1