Study population
The statistical population of this research (n=114) consisted of 80 male and 34 female patients, undergoing esophagogastroduodenoscopy in Imam Hospital or Tooba Outpatient Clinic, affiliated with Mazandaran University of Medical Sciences, Sari, Iran, within 2017-2019. Initially, the cases were subjected to endoscopic and histopathological examinations and were then divided into three groups of non-ulcer dyspepsia (NUD, n=32) with normal histology serving as a control group, intestinal metaplasia (IM, n=19), and gastric cancer (GC, n=63) (Table 1). None of the study subjects had a history of chronic inflammatory or autoimmune disorders or H. pylori eradication therapy or received non-steroidal anti-inflammatory drugs during the past 2 weeks. Informed consent was obtained from all the cases before endoscopy/biopsy and blood sampling. The patients’ demographic information was gathered from their medical records. As a protocol, two biopsies were obtained from antrum and corpus separately from NUD and IM cases and the tumor tissue of gastric cancer objects. At the time of endoscopy, 2.5 mL of the blood sample was collected from the patients. According to the medical records, tumors were classified according to the tumor, nodes, and metastases staging system. Histological sections from formalin-fixed and paraffin-embedded gastric biopsies were prepared and stained using modified Giemsa and hematoxylin-eosin. The presence of H. pylori infection was determined by histopathological examination, including Giemsa staining, and a positive result for a rapid urease test performed on at least one additional biopsy sample. This study was approved by the Ethics Committee of the Mazandaran University of Medical Sciences.
Immunohistochemistry
Formalin-fixed and paraffin-embedded tissues from gastric biopsies were collected and cut into 2-3 μm sections, which were mounted on poly L-lysine coated slides, and deparaffinized in xylene, and rehydrated. Then the slides were autoclaved for 15 min in citrate buffer (pH 6.0) for antigen retrieval and, subsequently, incubated with 3% H2O2 to block endogenous peroxidase activity for 15 min. Each slide was blocked with normal goat serum (Cyto Matin Gene, Iran) for 15 min at room temperature in a humid chamber. Then each section was incubated with Rabbit polyclonal anti-BTLA antibody (1:200 dilution, PA5-22248, Invitrogen, USA) at room temperature for 2 h or Rabbit polyclonal anti-HVEM antibody (1:50, PA5-26103, Invitrogen, USA) at 4°C overnight.
The slides were washed in TBS buffer and incubated in secondary antibody (goat anti-rabbit secondary antibody, Thermofisher, USA) at room temperature for 2h. Afterward, each slide was detected with diaminobenzidine reagent sets (Biopharma, China) for 5-7 min. For negative control, rabbit IgG was used in the immunostaining procedure. Finally, the slides were counterstained with haematoxylin, dehydrated by gradient alcohol, and mounted. Immunohistochemistry (IHC) results were evaluated by a pathologist in a blinded manner; therefore, a semi-quantitative H-score approach was used to assess the intensity and percentage of positively stained cells. The H-score was calculated by the following equation:
The percentage of positively stained cells was classified into 5 groups, namely less than 5% staining of cells recorded as negative (0), 5-25%; 1, 26%-50%; 2, 51%-75% ; 3, and more than 75%; 4. The staining intensity was graded as 0=negative staining, 1=weak, 2=moderate, and 3=strong. The final immunostaining score was calculated using multiplying the intensity and the percentage of positively stained cells.
Quantitative real-time polymerase chain reaction
Total RNA was extracted from fresh gastric biopsies in RNAlater solution using the Qiagen RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The quality and quantity of RNA were evaluated by a nano-spectrophotometer (Thermo Fisher Scientific Inc, Massachusetts, USA) and agarose gel electrophoresis, respectively. A volume of 1 μg of RNA was reversely transcribed by complementary a DNA synthesis kit (Yekta Tajhiz, Iran), according to the manufacturer’s protocol.
Polymerase chain reaction (PCR) was performed using Takara SYBR Green MasterMix with ROX kit (Takara, Japan) on a 96x Bio-Rad real-time PCR system (Bio-Rad, USA) with the following primers: BTLA forward: CCATATCTGGACATCTGGAACATC, reverse: CACAGTATTTCACAGGGCATTCTA; HVEM forward: CTGACTCTCGGTGCCTCC, reverse: CCACTTCTGCATCGTCCA. Hypoxanthine guanine phosphoribosyltransferase (HPRT) forward: CTGGCGTCGTGATTAGTGATGATG, reverse: CAGAGGGCTACAATGTGATGGC was used as an internal control. All reactions were performed in duplicate.
Polymerase chain reaction thermal cycle parameters were: initial denaturation at 95°C for 30 seconds, followed by 40 cycles at 95°C for 15 seconds, 60°C for 45 seconds, and 72°C for 30 seconds. A melting curve analysis was displayed to ensure the specificity of the PCR products.
Enzyme-linked immunosorbent assay
Soluble HVEM concentration was measured (in pg/ml) in patients’ sera using human HVEM/TNFRSF14 DuoSet enzyme-linked immunosorbent assay (ELISA) Kit (R&D Systems, USA) according to the manufacturer’s instructions. Moreover, anti-H. pylori IgG antibody was assessed in sera of all patients using the AccuBindTM ELISA kit (Monobind, USA) according to the manufacturer’s instructions. The concentrations higher than 20 U/mL were considered positive.
Statistical analysis
The collected data were analyzed in SPSS software (version 21) using one-sample Kolmogorov-Smirnov test (for normal distribution of data), as well as t-test, Mann-Whitney U test, ANOVA, and Kruskal-Wallis tests. The p-values of less than 0.05 were considered significant.