Male-specific lethal 1 (MSL1) promotes Erastin-induced ferroptosis in colon cancer cells by regulating the KCTD12-SLC7A11 axis

doi:10.21203/rs.3.rs-5229496/v1

Download PDF

Article

Male-specific lethal 1 (MSL1) promotes Erastin-induced ferroptosis in colon cancer cells by regulating the KCTD12-SLC7A11 axis

https://doi.org/10.21203/rs.3.rs-5229496/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

MSL1, a scaffold protein of the histone acetyltransferase MSL complex, plays a crucial role in the structural integrity and enzyme activity of the complex. Although it has shown that MSL1 is highly expressed in various primary tumor tissues, its role and molecular mechanism in the occurrence and development of tumors, as well as its impact on the process of tumor cell death, are not yet fully understood. Herein, we presence evidence for the first time from systematic biochemical assays and knockdown/overexpression approaches arguing that a negative regulatory mechanism exists between MSL1 and KCTD12. Interestingly, in HCT116 colon cancer cells, the expression of MSL1 was dramatically inhibited by the ferroptosis inducer Erastin, leading to upregulation of KCTD12 expression. Meanwhile, MSL1 promotes Erastin induced ferroptosis in HCT116 cells by regulating the KCTD12-SLC7A11 axis. In line with this, the ROS, GSH, and MDA levels induced by Erastin were impacted by the MSL1-KCTD12-SLC7A axis, suggesting the involvement of this axis in Erastin induced ferroptosis in colon cancer cells. Our findings will provide new therapeutic targets and theoretical basis for clinical colon cancer.

Biological sciences/Cancer/Gastrointestinal cancer/Colorectal cancer/Colon cancer

Health sciences/Medical research/Preclinical research

MSL1

KCTD12

SLC7A11

Ferroptosis

Colon cancer

Gene dosage compensation is an important process for balancing the expression level of X-chromosome genes between males and females. In Drosophila, the male-specific lethal (MSL) complex, also referred to as the dosage compensation complex, consists of five proteins (MSL1, MSL2, MSL3, MLE, and MOF) and two long non-coding RNAs (roX1 and roX2) (1). In contrast, mammals retain only four highly conserved subunits: MOF, MSL1, MSL2, and MSL3 (2). Among them, MSL1 serves as a scaffold protein for the complex, connecting with other subunits to form the MSL complex, and through specifically acetylating histone H4 at lysine 16 site (H4K16ac) (3), not only plays a vital role in dosage compensation (4), but also participates in regulating cell cycle and proliferation (5). Based on this mechanism, in recent years, the key regulatory role of MSL1 in tumor cells has also received widespread attention from scholars (6, 7). Although previous studies have shown that blocking MSL1 can enhance the cytotoxic effects of chemotherapy agents on those cancer cells (6), there is still a lack of relevant evidence to elucidate the potential molecular mechanisms by which MSL1 regulates tumor cell survival rate.

Our preliminary data suggests a potential correlation between MSL1 and KCTD12, and no relevant reports have been found so far. KCTD12, also known as Pfetin, belongs to the F-branch of the KCTD family and participates in GABA_B2 receptor signal transduction (8), inhibits the Wnt-Notch pathway (9), and promotes the transition of the cell cycle to the G2/M phase (10). KCTD12 can exert different oncogenic or anticancer effects in different tumor tissues and is considered a prognostic biomarker for gastrointestinal tumors (11). In colorectal cancer tissues, downregulated KCTD12 might serve as a tumor suppressor (12). However, the potential molecular mechanism by which KCTD12 regulates colon cancer has not yet been fully elucidated. Therefore, further elucidating the potential molecular mechanism of KCTD12 in regulating colon cancer and clarifying the important biomarker status of KCTD12 may provide a theoretical basis for the development of new targets and strategies for clinical diagnosis and treatment of colon cancer patients, which is beneficial for improving the survival rate of colon cancer patients.

The primary objective of cancer treatment is to maximize tumor cell death (13). An increasing number of studies have shown that mesenchymal and dedifferentiated tumor cells often exhibit resistance to typical programmed cell death (RCD) apoptosis, however, these cells are highly sensitive to ferroptosis inducers (14–16). Ferroptosis, a novel form of RCD, has received growing attention for its regulatory role in colon cancer (17, 18). Various anticancer drugs have been shown to inhibit tumor progression by inducing ferroptosis in colon cancer cells, such as Apatinib (19), and honokiol (20), along with Camellia nitidissima Chi (21). Studies reveal that the negative regulator of ferroptosis, SLC7A11, is highly expressed in colon cancer cell lines and tissues (22). SLC7A11 is a multi-channel transmembrane protein that, together with its partner solute carrier family 3 member 2 (SLC3A2), forms the Xc- system, a mechanism regulating ferroptosis negatively. This system mediates the cystine (Cys)/glutamate (Glu) antiporter activity, promoting Cys uptake and glutathione (GSH) biosynthesis, thereby protecting cells from oxidative stress and ferroptosis (23). Therefore, inducing SLC7A11-related ferroptosis has become one of the effective strategies for treating colon cancer.

Although there is currently no research on the relationship between MSL1 or KCTD12 and ferroptosis, KCTD12 has been shown to interact with the metabolic glutamate receptor 1 (mGlu1) (24), and mGlu1 closely regulates Glu (25), which plays an important role in SLC7A11 related ferroptosis as an equimolar exchanger for intracellular uptake of Cys in the Xc system. This result provides the possibility for KCTD12 to regulate SLC7A11 related ferroptosis. Based on the above, we propose a scientific hypothesis that MSL1 can induce SLC7A11 related ferroptosis and inhibit the progression of colon cancer by interacting with KCTD12.

Tissue collection

The pathological tissues of 40 cases of colon cancer were obtained from patients who underwent radical surgery between 2017 and 2018 at the Third Hospital of Jilin University without receiving any neoadjuvant radiotherapy and chemotherapy before their surgical operation. The number of registration of Committees approvals for tissue collection is 201707018. The tumor and adjacent (< 2 cm away from the tumor area) tissues excised during surgery were frozen for quantitative polymerase chain reaction (qPCR) detection. The median age of the patients was 59.8 years (range, 30–85 years). Written informed consent was obtained from all participants, and the study was approved by the institutional ethics board of the Jilin University.

Cell culture and reagents

HEK239T, U2OS, A549, PC3, MCF-7, OCM-1, HCT116, SW480 and DU145 cell lines from the cell tank of Laboratory were cultured in DMEM or 1640 medium (MeilunBio, Dalian, China) supplemented with 10% fetal bovine serum, and incubated in a 37ºC humidified incubator with 5% CO₂. All cell lines were authenticated by short tandem repeat profiling within 3 years and free of mycoplasma contamination. Fer-1 was purchased from Selleckchem (Shanghai, China), while Erastin was from AbMole (Shanghai, China).

Transient transfection and establishment of stable cell lines

HEK293T or HCT116 cells, grown to 30–40% confluence in 6-well plates, were transient transfected with Flag-MSL1, Flag-KCTD12, pLVX-shMSL1 or pLVX-shKCTD12 plasmids using polyethyleneimine (PEI) (23966, Polysciences).

Stably expressing Flag-KCTD12 HCT116 and OCM-1 cell lines were established according to the method previously described (26). Stably expressing Flag-KCTD12 cell line was confirmed by western blotting with anti-Flag antibody.

Lenti-viral mediated interference of gene expression

The pLVX-Puro-shRNA system was used to express shRNA in HEK293T and HCT116 cells, and the target sequences specific for MSL1 were used: shMSL1, GATCCGCACCGGACGTGTAGGAAATTTCAAGAGAATTTCCTACACGTCCGGTGTTTTTTG. pLVX-ZsGreen-shKCTD12 plasmid was synthesized by Sangon Biotech (Beijing, China). The knockdown efficiency was verified by western blot with anti-MSL1 and anti-KCTD12 antibodies following transient transfection of pLVX-shRNAs.

Generation of the MSL1KO and MSL3-KO cell lines

Generation of the human MSL1 and MSL3 knock out cell lines were performed as previously described (27). The MSL1-KO or MSL3-KO was determined by western blot method, and the indel mutations introduced into the genome were confirmed by DNA sequences.

Western blot and antibodies

Proteins in whole cell lysates were analyzed by western blot with specific antibodies and visualized using the chemiluminescent detection system (Clinx Science instruments), and western blot images were quantified using Image J software.

Specific primary antibodies against MSL1 (24373-1-AP, Proteintech), Flag (F3165, Sigma-Aldrich), GPX4 (ab125066, Abcam), SLC7A11 (ab307601, Abcam), KCTD12 (15523-1-AP, Proteintech), H4K16ac (PTM-122, Jingjie Biotechnology), and GAPDH (raised against bacterially expressed protein, Jilin University) were used for western blot assays.

Reverse transcriptase PCR

Reverse transcribed cDNA and the PCR reactions were performed as previously described (28). The primer sets used in real-time PCR were: KCTD12, 5’-GAACGAAAGCCGGGACCCC-3’ (forward) and 5’-TGCACGCCACCATGTGGAA-3’ (reverse); SLC7A11, 5’-CAAGCACACTCCTCTACCA-3’ (forward) and 5’-ATAAATCAGCCCAGCAACT-3’ (reverse); MSL1, 5’- TGCTTCGGAAACTGGACATCA-3’ (forward) and 5’-TAGCCACAAAGGCACCAAAAG-3’ (reverse); GAPDH, 5’- TGTGGGCATCAATGGATTTGG-3’ (forward) and 5’-ACACCATGTATTCCGGGTCAAT-3’ (reverse).

ROS, GSH and MDA assays

The ROS (S0033S), GSH (S0053) and MDA (S0131S) assay kits were from Beyotime (Shanghai, China), and the levels of ROS, GSH and MDA were detected in transfected with different plasmids cells according to the manufacturer’s instructions.

MTT assay

MTT assay was performed as previously described (29). Briefly, 2000 HCT116 cells/well were treated with 0 ~ 40 µM of Erastin, and the cell viability was detected by the cell proliferation assay kit (G3580, Promega, Madison, WI, USA) according to the manufacturer’s instructions. The absorbance at a wavelength of 450 nm was measured using a microplate reader (Infinite F200 Pro, TECAN, Shanghai, China).

Statistical Analysis

All data were analyzed using SPSS 16.0 software (IBM, Armonk, New York, NY, USA). Data from at least three independent replicates were presented as the mean ± SD. Two groups were assessed by a t-test, and three or more groups were assessed by one-way analysis of variance (ANOVA). P < 0.05 was considered statistically significant.

KCTD12 may be one of the targeted regulatory genes of MSL1/MSL3.

MSL1 and MSL3 knockout (KO) 293T cell lines were established using CRISPR/Cas9 gene editing technology (27) (Fig. 1A). The effects of MSL1-KO (Fig. 1B) and MSL3-KO (Fig. 1C) on cell division were observed by cell immunofluorescence staining (Fig. 1D), and spindle multipolarity (green) was found in both MSL1-KO or MSL3-KO cells, suggesting the involvement of MSL1/MSL3 in cell division process. Based on the analysis of MSL1-KO and MSL3-KO gene expression profiles, a total of 2448 and 3431 differentially expressed genes (DEGs) were found in MSL1-KO and MSL3-KO cells respectively. Among them, 1817 DEGs were overlapped, and 34 genes in 1817 DEGs belong to the solute carrier (SLC) family genes, indicating the possibility of SLC family genes being regulated by MSL1/MSL3 (Fig. 1E, upper). Our results are consistent with the analysis conducted by Gao et al, who obtained 10 SLC family genes related to ferroptosis through intersecting SLC family genes and ferroptosis related genes (30). These 10 genes intersected with 34 SLC family genes coregulated by MSL1/MSL3, resulting in 4 overlapping genes (Fig. 1E, lower), demonstrating the involvement of MSL1/MSL3 in regulating the cell ferroptosis.

Venn diagram analysis was further performed using genes coregulated by MSL1/MSL3 (TCGA data) in different tumors and DEGs from RNA-Seq of MSL1-KO and MSL3-KO cells, and a total of 18 genes were overlapped (Fig. 1F). Among the 18 overlapping genes, KCTD12 aroused our curiosity because we have found in previous research that KCTD12 can inhibit the cell proliferation of OCM-1 (26). Based on TCGA database, lower expression of KCTD12 and higher expressed of MSL1/MSL3 were found in most tumor tissues, a negative correlation between MSL1/MSL3 and KCTD12 was speculated in COAD and KIRC tissues (Table 1 and Fig. 1G).

Table 1

Differentially expressed MSL1, MSL3, and KCTD12 genes in various tumor tissues
Tumors	KCTD12 (P-value)	Regulated type	MSL1 (P-value)	Regulated type	MSL3 (P-value)	Regulated type
BRCA	1.17E-51	Down	0.14378164	ns	0.000532	Up
LUAD	2.14E-27	Down	0.00247984	Up	0.823263	ns
LUSC	2.03E-29	Down	0.00394354	Up	0.317808	ns
UCEC.	8.06E-21	Down	1.29E-07	Up	0.096974	ns
COAD	1.45E-15	Down	7.30E-08	Up	3.88E-09	Up
KIRC	3.43E-16	Down	1.15E-05	Up	5.33E-09	Up
READ	8.76E-07	Down	0.15319792	ns	0.011912	Up
SKCM	2.86E-07	Down	0.10306048	ns	0.000118	Up
BLCA	1.81E-06	Down	0.04491664	Up	0.004616	Up
KIRP	0.02023342	Down	0.00027205	Up	0.344453	ns
KICH	0.05205218	Down	7.71E-09	Up	2.82E-08	Up
ESCA	0.63818056	ns	4.03E-05	Up	0.000269	Up
HNSC	0.66916146	ns	1.14E-12	Up	9.64E-07	Up
LIHC	0.46169307	ns	2.60E-19	Up	2.01E-11	Up
STAD	0.12251715	ns	5.89E-13	Up	2.12E-13	Up
PRAD	0.43480534	ns	1.18E-07	Up	0.109063	ns
THCA	0.70438965	ns	0.25788699	ns	0.14111	ns
CHOL	0.00222305	Down	1.58E-08	Up	2.26E-09	Up
P-value, represents the difference in gene expression compared to normal tissues. BRCA, breast cancer; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; UCEC, endometrioid cancer; COAD, colon cancer; KIRC, kidney clear cell carcinoma; READ, rectal cancer; SKCM, skin melanoma; BLCA, bladder cancer; KIRP, kidney papillary cell carcinoma; KICH, kidney chromophobe; ESCA, esophageal cancer; HNSC, head and neck cancer; LIHC, liver cancer; STAD, stomach cancer; PRAD, prostate cancer; THCA, thyroid cancer; CHOL, cholangiocarcinoma.

Downregulation of KCTD12 was verified in primary diagnosed colon cancer tissues

The data from TCGA database showed a significant downregulation of KCTD12 in both mRNA (Fig. 2A) and protein (Fig. 2B) level compared those to normal tissues. Moreover, low expression of KCTD12 was detrimental to the survival rate of colon cancer patients (Fig. 2C). Furthermore, paired tumor and adjacent tissues were collected from 40 patients (24 males and 16 females). H&E staining images of tumor and adjacent tissues are shown in Fig. 2D. In addition, the immunohistochemical staining of Ki67, p53, PMS2, MSH2, and MLH1 was shown in Fig. 2E, and those proteins are used as reference indicators for tumor diagnosis in routine clinical testing. As shown in Fig. 2F, KCTD12 mRNA levels revealed a significant difference between tumor and matched adjacent tissues. Also, a significant (> 2-fold decreased) downregulation of KCTD12 in 67.5% (27/40) of patients was detected (Fig. 2G). It is worth mentioning that the downregulation of KCTD12 expression was more pronounced in patients with distant metastasis (Fig. 2H).

A negative correlation between MSL1 and KCTD12 was confirmed in 293T and HCT116 cells

As an essential key subunit in the MSL complex, in subsequent studies, we take MSL1 as the main research object to explore its interaction with KCTD12. First, a negative correlation (cor = − 0.339) between KCTD12 and MSL1 in colon cancer cells (Fig. 3A) was clarified with the TIMER platform. Consistent with this, KCTD12 expression levels in both protein (Fig. 3B) and mRNA (Fig. 3C) were dramatically increased in MSL1-KO cells. Conversely, overexpressed MSL1 resulted in a dose-dependent decrease in KCTD12 protein and mRNA levels (Fig. 3D-3F), which supports the conclusion that MSL1 negatively regulates KCTD12. In addition, relative higher expression of KCTD12 in HCT116 colon cancer cells was detected, thus, it was selected for further mechanism studies (Fig. 3G and 3H).

SLC7A11 was identified as one of the potential targeted regulatory genes of MSL1 -KCTD12 axis.

The RNA-Seq was performed using lentiviral-mediated stably expressing KCTD12 HCT116 and OCM-1 cell lines (Fig. 4A). Obtained 284 and 107 DEGs (p < 0.001) from HCT116 and OCM-1 cells were conducted to Venn diagram analysis. Six overlapped genes including SLC7A11 were identified (Fig. 4B). DEGs from Flag-KCTD12 HCT116 cells (p < 0.01) were further visualized in volcano plot (Fig. 4C). SLC7A11 and SLC3A2 jointly constitute the important negative regulatory mechanism Xc-system of ferroptosis. To confirm the correlation between SLC7A11 and MSL1-KCTD12 axis, the protein and mRNA levels of SLC7A11 were first detected in MSL1-KO cells. As a result, higher expression of KCTD12 and decreased SLC7A11 in protein and mRNA levels were observed in MSL1-KO cells (Fig. 4D-4F). Conversely, dose-dependent declined KCTD12 and increased SLC7A11 in protein and mRNA levels were detected (Fig. 4H-4I). Moreover, compared to 293T cells, overexpressed KCTD12 in MSL1-KO cells resulted in decreased SLC7A11 and GPX4 (Fig. 4J, Lane 4), in contrast, shKCTD12 inhibited the upregulation of KCTD12 caused by MSL1-KO and the inhibitory effect of MSL1-KO on SLC7A11 expression (Lane 8, compared to Lane 7). Meanwhile, GPX4 proteins were modulated by MSL1-KCTD12 axis. Quantified protein levels for 4J were shown in Fig. 4K. The above results suggest the regulation of MSL1-KCTD12 axis on SLC7A11.

MSL1-KTD12 axis was involved in Erastin-induced ferroptosis by mediating SLC7A11 in HCT116 cells

Based on the facts that the MSL1-KTD12 axis regulates the expression of SLC7A11, the involvement of MSL-KCTD2 axis in ferroptosis was speculated. Therefore, the ferroptosis inducer Erastin was used in following experiments. Firstly, a median lethal dose of Erastin was determined through MTT assay (Fig. 5A), and 10 µM Erastin was used in subsequent experiments. And 10 µM Erastin induced ferroptosis can be effectively inhibited by the ferroptosis inhibitor Fer-1 (Fig. 5B). Furthermore, MSL1 protein and H4K16ac levels were dramatically decreased in Erastin exposed cells, meanwhile, high level of KCTD12, and decreased SLA7A11 and GPX4 were detected (Fig. 5C, Lane 2). As expected, these changes were reversed by the addition of Fer-1 (Lane 3). Quantified proteins were shown in Fig. 5D.

Next, the effect of KCTD12 on SLC7A11 protein level was tested in cells with or without Erastin treatment. Compared to without Erastin cells, overexpressed KCTD12 significantly reduced SLC7A11 and GPX4 protein level (Fig. 5E and 5F). Similar experiments were conducted in cells knocking down KCTD12, and a statistically significant increase of SLC7A11 and GPX4 proteins was found in Erastin induced ferroptosis cells (Fig. 5G, 5H). Taken together, KCTD12 negatively regulates the expression level of SLC7A11 and GPX4 in Erastin induced ferroptosis.

Similarly, KCTD12, SLC7A11 and GPX4 proteins were assessed in cells treated with Erastin after transient transfection of Flag-MSL or pVLX-shMSL1. As shown in Fig. 5I, compared to DMSO group, Erastin resulted in a remarkable decrease of MSL1 and H4K16ac, and consistent with previous results, the decreased MSL1 upregulated KCTD12, which further led to a reduction in SLC7A11 and GPX4 protein levels (Lane 2 compared to Lane 1). However, once MSL1 was replenished in Erastin treated cells, the protein levels of KCTD12, SLC7A11 and GPX4 tended to the DMSO control group levels in a dose-dependent manner (Lane 3–4, compared to Lane 1). On the basis of Erastin induced reduction of MSL1, further knockdown of MSL1 promoted the upregulation of KCTD12 and downregulation of SLC7A11 and GPX4 by Erastin (Fig. 5J, Lane 3–4, compared to Lane 2). The numbers below the immunoblot image represented the quantified values compared to the DMSO control group. In summary, MSL1 regulated SLC7A11 and GPX4 by mediating KCTD12 in Erastin induced ferroptosis.

Both MSL1 and KTD12 regulated Erastin produced GSH, MDA and ROS levels in HCT116 cells.

Based on the potential role of the MSL1-KCTD12-SLC7A11 axis in Erastin induced ferroptosis, the levels of intermediate products ROS, GSH and MDA related to ferroptosis were detected in cells treated with Erastin. Compared to the control cells or transfection of pcDNA3.1 and shNT groups, there was no significant changes in GSH contents in KCTD12 overexpressed or knocked down cells (Fig. 6A,6B left panel), however, a significant decrease or increase was observed in overexpressing or knocking down KCTD12 cells (Fig. 6A,6B, right panel). In addition, the elevated MDA content induced by Erastin was suppressed by overexpressing Flag-MSL1 (Fig. 6C, left panel), while it was enhanced by knocking down MSL1 with pLVX-shMSL1 (Fig. 6C, right panel) in a dose-dependent manner.

The accumulation of lipid peroxides is an important cause of ferroptosis. Therefore, the reactive oxygen species (ROS) levels were assessed in Fig. 6D-6G experiments. Firstly, overexpression of KCTD12 dose dependently increased the ROS levels in cells treated with Erastin (Fig. 6D, upper), but the opposite effect was observed in cells knocking down KCTD12 (lower). The quantified fluorescence intensity was shown in Fig. 6E. In contrast, the ROS levels were negatively regulated by overexpressing or knocking down MSL1 in Erastin exposed cells in a dose dependent manner (Fig. 6F). The quantified fluorescence intensity was shown in Fig. 6G. The above results are sufficient to demonstrate the involvement of MSL1 and KCTD12 in regulating Erastin induced ferroptosis in HCT116 cells, and MSL1 and KCTD12 have opposite effects on ROS, GSH and MDA, which is consistent with the previous experimental results, once again indicating a negative regulatory relationship between MSL1 and KCTD12.

MSL1-KCTD12 axis synergistically regulated ROS, GSH and MDA levels produced by Erastin in HCT116 cells

Here, the effects of simultaneously changing the expression levels of MSL1 and KCTD12 on ROS, GSH, and MDA levels induced by Erastin were detected. Firstly, in cells exposed to Erastin, Flag-MSL1 and Flag-KCTD12 were overexpressed alone, or cotransfected, and 24 hours later, the ROS levels were detected. In line with the previous results, Erastin produced ROS can be visualized in cells transfected with pcDNA3.1 plasmid, and this ROS level was inhibited by transfection of MSL1 and enhanced by transfection with KCTD12. Conversely, the ROS levels promoted by KCTD12 can be reversed by adding MSL1 (Fig. 7A, left panel). Quantified integrated density of fluorescence was shown in Fig. 7B (left panel). However, opposite results were obtained when pLVX-shMSL1 and pLVX-shKCTD12 were transfected alone or cotransfected in Erastin exposed HCT116 cells (Fig. 7A, right panel). Quantified integrated density of fluorescence was shown in Fig. 7B (right panel). Similar experiments were also performed in detecting the GSH and MDA levels. As shown in Fig. 7C (upper panel), Erastin produced GSH level was promoted by overexpressing MSL1, while inhibited by knocking down MSL1. Contrary to the effect of MSL1, overexpression of KCTD12 reduced GSH produced by Erastin, while knockdown of KCTD12 increased GSH. If both were overexpressed or knocked down simultaneously, the effect on GSH was neutralized. The MDA content assessment was showed in Fig. 7C (lower panel). Higher MDA content was observed in Erastin treated cells (compared to the DMSO group), and this level was negatively regulated by MSL1 expression level, however, KCTD12 positively regulated the MDA content. When both MSL1 and KCTD12 were overexpressed or knocked down simultaneously, the effect on MDA was neutralized.

In this study, we have confirmed for the first time the negative regulatory effect of MSL1 on KCTD12, and found that the downregulated MSL1 induced by Erastin can inhibit the expression levels of SLC7A11 and GPX4 by mediating KCTD12, regulating the ROS, GSH, and MDA levels produced by Erastin, suggesting the involvement of MSL1-KTD12-SLC7A axis in Erastin induced ferroptosis in colon cancers (Fig. 7D).

Previous studies have shown that MSL1 can promote the survival of tumor cells, and this effect is regulated by multiple mechanisms (31). Analysis of TCGA database showed that MSL1 is highly expressed in colon cancer tissues. This is consistent with the findings of Kunisky et al., who found that MSL1 can be upregulated by DNA damage, and elevated MSL1 can protect cells from DNA damage induced apoptosis, thereby promoting tumor cell survival (6). Therefore, reducing the level of MSL1 in tumor cells may be one of the strategies for inhibiting tumor cells. In line with this, spindle multipolar was observed in MSL1-KO 293T cells, suggesting that MSL1-KO led to abnormal cell division. It is worth mentioning that the MSL1 protein level was significantly decreased in HCT116 colon cancer cells treated with ferroptosis inducer Erastin (Fig. 5), suggesting the involvement of MSL1 in the process of cell ferroptosis. Consistent with this inference, 34 genes belonging to the SLC family were identified in the MSL1-KO DEG profile, including SLC38A1, SLC16A1, SLC7A11, and SLC3A2 (Fig. 1E), and these genes are closely related to the process of ferroptosis in cells.

The abnormal expression of KCTD12 is closely related to the occurrence and development of various tumors (11, 12). We confirm the downregulation of KCTD12 expression in primary colon cancer tissues (Fig. 2), also, KCTD12 may be a potential regulatory target gene for MSL1/MSL3. Notably, declined KCTD12 promotes the stemness characteristics of colorectal cancer cells, such as self-renewal in vitro and in vivo, tumorigenesis, and drug resistance, by regulating the downstream component ERK pathway of GABA, leading to poor prognosis in colorectal cancer patients (32). In line with this, increasing the expression level of KCTD12 by inhibiting MSL1 in colon cancer cells may achieve the goal of suppressing cell proliferation.

In this paper, we confirm for the first time the negative regulatory mechanism between MSL1 and KCTD12 using overexpression and interference gene expression techniques. Both MSL1 and KCTD12 have been involved in regulating mitochondrial function. For example, MSL1 can be activated by the elevated mitochondrial membrane potential, inducing mitochondrial ROS production and lipid peroxidation (33), while KCTD12 is considered a key characteristic gene associated with hypoxia and mitochondrial scoring (34), this indirectly explained the potential mechanism of their interaction.

In recent years, the mechanism of ferroptosis in colon cancer has attracted the attention of many scholars (17, 35, 36). Ferroptosis is a novel programmed cell death mode induced by excessive accumulation of iron dependent lipid peroxides, which has become an effective strategy for the prevention and treatment of colon cancer (37). Therefore, exploring the potential molecular mechanism of classical ferroptosis inducer Erastin inducing ferroptosis in colon cancer cells can help to discover potential therapeutic targets for clinical colon cancer. Research has shown that Erastin can target and inhibit the Xc-system, leading to cysteine deficiency, glutathione depletion, and inducing cell death (38).

Another important finding of this study is that remarkable downregulation of MSL1 by Erastin was found in HCT116 cells. More important thing is that the MSL1-KCTD12 axis regulates the SLC7A11 protein levels in cells. SLC7A11, a negative regulator of ferroptosis, transfers extracellular cysteine into the cell and further reduces it to cysteine, participating in the formation of GSH (39). In MSL1 knocking down cells, a decreased GSH, and increased ROS and MDA contents were detected in the presence of Erastin. However, the opposite results were obtained in cells knocking down KCTD12 (Fig. 6 and Fig. 7), suggesting the negative regulatory mechanism between MSL1 and KCTD12 in HCT116 cell ferroptosis. Although there are currently few reports on the interaction between KCTD12 and SLC7A11, Zhou et al. found that the inactivation of cullin-3 ligase can increase the uptake of cysteine, leading to the accumulation of SLC7A11 (40), suggesting the possibility for KCTD12 to negatively regulate SLC7A11. Consistent with the these results, overexpression of MSL1 not only downregulated KCTD12, but also increased the expression level of SLC7A11, indicating that MSL1 regulates SLC7A11 expression by mediating KCTD12, and this regulatory effect of MSL1-KCTD12 axis on SLC7A11 is more pronounced in Erastin induced ferroptosis in HCT116 cells. However, the specific molecular mechanism by which Erastin regulates MSL1 protein expression is currently unclear. Previous studies have shown that, in addition to the Xc-system, p53 is also a target of Erastin in tumor cells (41). According to reports, ROS induced by Erastin can activate p53 and its downstream pathways, which further exacerbates the increase of ROS and inducing ferroptosis. However, the regulatory effect of Erastin on p53 has not been found in normal lung cells, indicating that Erastin's regulatory effect on p53 is tumor cell specific (41). Another study showed that the MOF-MSL1v1 (a paralogous homolog of MSL1) complex can specifically bind to transcription factor p53, and MSL1 has also been shown to preferentially bind downstream sequences of transcription start sites (42). Therefore, we consider two possibilities for the decrease in MSL1 expression level induced by Erastin. One is that Erastin may directly inhibit the MSL1 expression through acting on the gene promoter region or binding to the protein of MSL1, on the other hand, it may indirectly affect the expression level of MSL1 through transcriptional regulation of p53. This discovery will provide new therapeutic targets and theoretical basis for clinical colon cancer.

DATA AVAILABILITY

All data used in this work can be acquired from the TCGA database (http://cancergenome.nih.gov/), ENCODE database (http://encodeproject.org/), CCLE database (http://sites.broadinstitute.org/ccle), Gene Expression Omnibus (GEO) datasets (https://www.ncbi.nlm.nih.gov/geo/), GTEx project (https://gtexportal.org/home/). Raw and processed RNA-seq data of H520 cells transfected with Gapmer ASOs or deleted for NFYC-AS1 TSS have been deposited at GEO under accession number GSE240468 and are available from the corresponding author upon reasonable request.

AUTHOR CONTRIBUTIONS

LL, JJ, and BL: conceived and coordinated the project and the experiments. JJ, NJ, and YW: interpreted the data and edited the manuscript. LL, SD, QZ, and XC performed the most of the experiments and helped to analyze the data. All authors have read and agreed to the published version of the manuscript.

FUNDING

This work was supported by grants from the National Natural Science Foundation of Jilin Province (YDZJ202301ZYTS042); the National Natural Science Foundation of China (32170599; the Jilin Provincial Science and Technology Development Plan project(20240404042ZP). The funders had no role in study design, data collection and analysis, publication decisions, or manuscript preparation.

COMPETING INTERESTS

The authors declare no competing interests.

Conrad T, Akhtar A. Dosage compensation in Drosophila melanogaster: epigenetic fine-tuning of chromosome-wide transcription. Nature reviews Genetics. 2012;13(2):123-34.
Smith ER, Cayrou C, Huang R, Lane WS, Côté J, Lucchesi JC. A human protein complex homologous to the Drosophila MSL complex is responsible for the majority of histone H4 acetylation at lysine 16. Molecular and cellular biology. 2005;25(21):9175-88.
Wu L, Zee BM, Wang Y, Garcia BA, Dou Y. The RING finger protein MSL2 in the MOF complex is an E3 ubiquitin ligase for H2B K34 and is involved in crosstalk with H3 K4 and K79 methylation. Molecular cell. 2011;43(1):132-44.
Kadlec J, Hallacli E, Lipp M, Holz H, Sanchez-Weatherby J, Cusack S, et al. Structural basis for MOF and MSL3 recruitment into the dosage compensation complex by MSL1. Nat Struct Mol Biol. 2011;18(2):142-9.
Li X, Wu L, Corsa CA, Kunkel S, Dou Y. Two mammalian MOF complexes regulate transcription activation by distinct mechanisms. Molecular cell. 2009;36(2):290-301.
Kunisky AK, Anyaeche VI, Herron RS, Park CY, Hwang HW. Shift in MSL1 alternative polyadenylation in response to DNA damage protects cancer cells from chemotherapeutic agent-induced apoptosis. Cell reports. 2021;37(2):109815.
Wang MY, Qi B, Wang F, Lin ZR, Li MY, Yin WJ, et al. PBK phosphorylates MSL1 to elicit epigenetic modulation of CD276 in nasopharyngeal carcinoma. Oncogenesis. 2021;10(1):9.
Ivankova K, Turecek R, Fritzius T, Seddik R, Prezeau L, Comps-Agrar L, et al. Up-regulation of GABA(B) receptor signaling by constitutive assembly with the K+ channel tetramerization domain-containing protein 12 (KCTD12). The Journal of biological chemistry. 2013;288(34):24848-56.
Abbaszadegan MR, Taghehchian N, Li L, Aarabi A, Moghbeli M. Contribution of KCTD12 to esophageal squamous cell carcinoma. BMC cancer. 2018;18(1):853.
Zhong Y, Yang J, Xu WW, Wang Y, Zheng CC, Li B, et al. KCTD12 promotes tumorigenesis by facilitating CDC25B/CDK1/Aurora A-dependent G2/M transition. Oncogene. 2017;36(44):6177-89.
Hasegawa T, Asanuma H, Ogino J, Hirohashi Y, Shinomura Y, Iwaki H, et al. Use of potassium channel tetramerization domain-containing 12 as a biomarker for diagnosis and prognosis of gastrointestinal stromal tumor. Human pathology. 2013;44(7):1271-7.
Smaldone G, Pecoraro G, Pane K, Franzese M, Ruggiero A, Vitagliano L, et al. The Oncosuppressive Properties of KCTD1: Its Role in Cell Growth and Mobility. Biology. 2023;12(3).
Hänggi K, Ruffell B. Cell death, therapeutics, and the immune response in cancer. Trends in cancer. 2023;9(5):381-96.
Viswanathan VS, Ryan MJ, Dhruv HD, Gill S, Eichhoff OM, Seashore-Ludlow B, et al. Dependency of a therapy-resistant state of cancer cells on a lipid peroxidase pathway. Nature. 2017;547(7664):453-7.
Hangauer MJ, Viswanathan VS, Ryan MJ, Bole D, Eaton JK, Matov A, et al. Drug-tolerant persister cancer cells are vulnerable to GPX4 inhibition. Nature. 2017;551(7679):247-50.
Tsoi J, Robert L, Paraiso K, Galvan C, Sheu KM, Lay J, et al. Multi-stage Differentiation Defines Melanoma Subtypes with Differential Vulnerability to Drug-Induced Iron-Dependent Oxidative Stress. Cancer cell. 2018;33(5):890-904.e5.
Wu Z, Lu Z, Li L, Ma M, Long F, Wu R, et al. Identification and Validation of Ferroptosis-Related LncRNA Signatures as a Novel Prognostic Model for Colon Cancer. Frontiers in immunology. 2021;12:783362.
Wang Y, Zhang Z, Sun W, Zhang J, Xu Q, Zhou X, et al. Ferroptosis in colorectal cancer: Potential mechanisms and effective therapeutic targets. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2022;153:113524.
Tian X, Li S, Ge G. Apatinib Promotes Ferroptosis in Colorectal Cancer Cells by Targeting ELOVL6/ACSL4 Signaling. Cancer management and research. 2021;13:1333-42.
Guo C, Liu P, Deng G, Han Y, Chen Y, Cai C, et al. Honokiol induces ferroptosis in colon cancer cells by regulating GPX4 activity. American journal of cancer research. 2021;11(6):3039-54.
Chen Y, Zhang F, Du Z, Xie J, Xia L, Hou X, et al. Proteome Analysis of Camellia nitidissima Chi Revealed Its Role in Colon Cancer Through the Apoptosis and Ferroptosis Pathway. Frontiers in oncology. 2021;11:727130.
Ma MZ, Chen G, Wang P, Lu WH, Zhu CF, Song M, et al. Xc- inhibitor sulfasalazine sensitizes colorectal cancer to cisplatin by a GSH-dependent mechanism. Cancer letters. 2015;368(1):88-96.
Koppula P, Zhuang L, Gan B. Cystine transporter SLC7A11/xCT in cancer: ferroptosis, nutrient dependency, and cancer therapy. Protein & cell. 2021;12(8):599-620.
Mansouri M, Kremser L, Nguyen TP, Kasugai Y, Caberlotto L, Gassmann M, et al. Protein Networks Associated with Native Metabotropic Glutamate 1 Receptors (mGlu(1)) in the Mouse Cerebellum. Cells. 2023;12(9).
Niedzielska-Andres E, Pomierny-Chamioło L, Andres M, Walczak M, Knackstedt LA, Filip M, et al. Cocaine use disorder: A look at metabotropic glutamate receptors and glutamate transporters. Pharmacology & therapeutics. 2021;221:107797.
Luo L, Cui J, Feng Z, Li Y, Wang M, Cai Y, et al. Lentiviral-mediated overexpression of KCTD12 inhibits the proliferation of human uveal melanoma OCM-1 cells. Oncology reports. 2017;37(2):871-8.
Wei T, Liu H, Zhu H, Chen W, Wu T, Bai Y, et al. Two distinct males absent on the first (MOF)-containing histone acetyltransferases are involved in the epithelial-mesenchymal transition in different ways in human cells. Cell Mol Life Sci. 2022;79(5):238.
Li Y, Li F, Feng C, Wu T, Chen Y, Shah JA, et al. MiR-372-3p Functions as a Tumor Suppressor in Colon Cancer by Targeting MAP3K2. Front Genet. 2022;13:836256.
Liu H, Wei T, Sun L, Wu T, Li F, Zhao J, et al. The Non-Specific Lethal (NSL) Histone Acetyltransferase Complex Transcriptionally Regulates Yin Yang 1-Mediated Cell Proliferation in Human Cells. Int J Mol Sci. 2022;23(7).
Gao S, Gong G, Wang X, Gao X, Guo X, Luo Y, et al. Classification of SLC family-related genes involved in ferroptosis predicts lung cancer prognosis and immunotherapy response. Scientific reports. 2023;13(1):20032.
He Y, Wang S, Liu S, Qin D, Liu Z, Wang L, et al. MSL1 Promotes Liver Regeneration by Driving Phase Separation of STAT3 and Histone H4 and Enhancing Their Acetylation. Adv Sci (Weinh). 2023;10(23):e2301094.
Li L, Duan T, Wang X, Zhang RH, Zhang M, Wang S, et al. KCTD12 Regulates Colorectal Cancer Cell Stemness through the ERK Pathway. Scientific reports. 2016;6:20460.
Lee CP, Maksaev G, Jensen GS, Murcha MW, Wilson ME, Fricker M, et al. MSL1 is a mechanosensitive ion channel that dissipates mitochondrial membrane potential and maintains redox homeostasis in mitochondria during abiotic stress. The Plant journal : for cell and molecular biology. 2016;88(5):809-25.
Zhao W, Huang H, Zhao Z, Ding C, Jia C, Wang Y, et al. Identification of Hypoxia and Mitochondrial-related Gene Signature and Prediction of Prognostic Model in Lung Adenocarcinoma. Journal of Cancer. 2024;15(14):4513-26.
Zheng X, Wang Q, Zhou Y, Zhang D, Geng Y, Hu W, et al. N-acetyltransferase 10 promotes colon cancer progression by inhibiting ferroptosis through N4-acetylation and stabilization of ferroptosis suppressor protein 1 (FSP1) mRNA. Cancer communications (London, England). 2022;42(12):1347-66.
Kuang H, Sun X, Liu Y, Tang M, Wei Y, Shi Y, et al. Palmitic acid-induced ferroptosis via CD36 activates ER stress to break calcium-iron balance in colon cancer cells. The FEBS journal. 2023;290(14):3664-87.
Sinha BK, Bortner CD, Jarmusch AK, Tokar EJ, Murphy C, Wu X, et al. Ferroptosis-Mediated Cell Death Induced by NCX4040, The Non-Steroidal Nitric Oxide Donor, in Human Colorectal Cancer Cells: Implications in Therapy. Cells. 2023;12(12).
Sato M, Kusumi R, Hamashima S, Kobayashi S, Sasaki S, Komiyama Y, et al. The ferroptosis inducer erastin irreversibly inhibits system x(c)- and synergizes with cisplatin to increase cisplatin's cytotoxicity in cancer cells. Scientific reports. 2018;8(1):968.
Chen X, Li J, Kang R, Klionsky DJ, Tang D. Ferroptosis: machinery and regulation. Autophagy. 2021;17(9):2054-81.
Zhou Q, Yu H, Chen Y, Ren J, Lu Y, Sun Y. The CRL3(KCTD10) ubiquitin ligase-USP18 axis coordinately regulates cystine uptake and ferroptosis by modulating SLC7A11. Proceedings of the National Academy of Sciences of the United States of America. 2024;121(28):e2320655121.
Huang C, Yang M, Deng J, Li P, Su W, Jiang R. Upregulation and activation of p53 by erastin‑induced reactive oxygen species contribute to cytotoxic and cytostatic effects in A549 lung cancer cells. Oncology reports. 2018;40(4):2363-70.
Hilfiker A, Hilfiker-Kleiner D, Pannuti A, Lucchesi JC. mof, a putative acetyl transferase gene related to the Tip60 and MOZ human genes and to the SAS genes of yeast, is required for dosage compensation in Drosophila. The EMBO journal. 1997;16(8):2054-60.

(Not answered)

Download PDF

Reviewer #1 agreed at journal
30 Oct, 2024
Reviewers invited by journal
25 Oct, 2024
Submission checks completed at journal
15 Oct, 2024
First submitted to journal
14 Oct, 2024
Unknown event
10 Oct, 2024
Editor assigned by journal
09 Oct, 2024

You are reading this latest preprint version

Male-specific lethal 1 (MSL1) promotes Erastin-induced ferroptosis in colon cancer cells by regulating the KCTD12-SLC7A11 axis

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Tissue collection

Cell culture and reagents

Transient transfection and establishment of stable cell lines

Lenti-viral mediated interference of gene expression

Generation of the MSL1KO and MSL3-KO cell lines

Western blot and antibodies

Reverse transcriptase PCR

ROS, GSH and MDA assays

MTT assay

Statistical Analysis

RESULTS

Downregulation of KCTD12 was verified in primary diagnosed colon cancer tissues

A negative correlation between MSL1 and KCTD12 was confirmed in 293T and HCT116 cells

MSL1-KTD12 axis was involved in Erastin-induced ferroptosis by mediating SLC7A11 in HCT116 cells

MSL1-KCTD12 axis synergistically regulated ROS, GSH and MDA levels produced by Erastin in HCT116 cells

DISCUSSION

Declarations

References

Additional Declarations

Status:

Version 1