NEIL3 influences adult neurogenesis and behavioral pattern separation via WNT signaling

doi:10.21203/rs.3.rs-5232393/v1

Download PDF

Research Article

NEIL3 influences adult neurogenesis and behavioral pattern separation via WNT signaling

https://doi.org/10.21203/rs.3.rs-5232393/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Adult neurogenesis in the hippocampus, involving the generation and integration of new neurons, is essential for behavioral pattern separation, which supports accurate memory recall and cognitive plasticity. Here, we explore the role of the DNA repair protein NEIL3 in adult hippocampal neurogenesis and behavioral pattern separation. NEIL3 is required for efficient proliferation and neuronal differentiation of neonatal NSPCs and adult-born NPCs in the hippocampus following a behavioral pattern separation task. NEIL3-depleted mice exhibited a reduced preference for the novel object location, indicating a deficit in pattern separation. NEIL3-deficient adult-born neurons exhibited a significant reduction in mature-like membrane properties, indicating impaired functional maturation. Interestingly, these impairments were not associated with the decreased genomic integrity but with the altered transcriptional regulation of the Wnt signaling pathway. Given the importance of adult neurogenesis in cognitive function, targeting NEIL3 could offer therapeutic potential for addressing age-related hippocampal dysfunction and cognitive decline.

NEIL3

DNA repair

hippocampus

adult neurogenesis

behavioral pattern separation

Wnt signaling

NEIL3 deficiency impairs neonatal NSPC proliferation and neuronal differentiation.
NEIL3 depletion impairs behavioral pattern separation and hippocampal adult neurogenesis.
NEIL3 impacts hippocampal adult neurogenesis by regulating WNT signaling genes.
NEIL3 depletion impairs the functional maturation of newborn DG neurons.

Adult hippocampal neurogenesis in the mammalian brain generates new neurons in the subgranular zone (SGZ) of the dentate gyrus (DG) throughout life. The maturation of dentate granule cells (DGCs) occurs in a complex and multistep process. Slowly dividing radial glia-like type 1 neuronal stem cells (NSCs) give rise to more rapidly dividing type 2 neuronal progenitor cells (NPCs) (1-4). Molecular markers like SOX2 are associated with type 2 NPCs, while NeuroD1 and DCX are indicative of type 3 NPCs (5, 6). After commitment to the neuronal lineage adult-born DGCs travel a short distance to the granule cell layer (GCL) and undergo a lengthy process of morphological and physiological maturation before they functionally integrate into the DG circuitry (7, 8). Newly generated DG neurons contribute to pattern separation, a process crucial for distinguishing similar yet distinct memories, allowing for accurate memory recall and improved cognitive plasticity (9-12).

The process of adult neurogenesis is known to generate localized oxidative stress by reactive oxygen species (ROS) (13, 14). Although the effects of ROS in adult neurogenesis are not well studied, their accumulation has been linked to various clinical neuropathologies, including Alzheimer’s disease(15) and amyotrophic lateral sclerosis (16). Oxidized DNA base lesions are mainly processed by base excision repair (BER), which is initiated by DNA glycosylases (17). NEIL3 is one of several mammalian DNA glycosylases that recognize and excise damaged bases in particular oxidation products of 8-oxoguanine (8-oxoG), spiroiminodihydantoin (Sp), and guanodinohydantoin (Gh) from single-stranded DNA (18). The expression pattern of NEIL3 in the rodent brain is unique among DNA glycosylases, being specifically localized to highly proliferative cells in the subventricular zone (SVZ) and DG-SGZ (19, 20). NEIL3 expression is notably higher during early postnatal development compared to adulthood (21, 22). Our previous research has highlighted the important role of NEIL3 in various processes, including neural progenitor cell growth (23), post-stroke neurogenesis (21), hippocampal maturation (22, 24), neuronal plasticity (22), and the hippocampus-dependent learning and memory (23, 25).

In the present study, we investigated the role of NEIL3 in adult hippocampal neurogenesis and its impact on hippocampal-dependent behavioral pattern separation.

Loss of NEIL3 impairs both proliferation and neuronal differentiation of neonatal NSPCs

Previous work with 18-month-old Neil3^-/- mice revealed impaired in vitro expansion of adult hippocampal neurospheres(23). Here, we assessed neurosphere formation from neural stem and progenitor cells (NSPCs) derived from hippocampal tissue of postnatal-day-5 (p5) wildtype and Neil3^-/- animals. Primary neurosphere formation was successful for both genotypes with no significant differences in growth rate at early passages (2-5). Continuous passaging increased the proliferation rate of wildtype but not Neil3^-/- neurospheres resulting in a 50% lower number of proliferating NSPCs at late passages (11-17) (Figure 1A). We could not detect differences in the number of slowly dividing GFAP⁺ NESTIN⁺ radial glia cells between the genotypes (Figure 1B and C). However, gene expression of neuronal progenitor marker Dcx and early neuronal marker Tuj-1 was significantly decreased in proliferating NSPCs from later passages of Neil3^-/- neurospheres (Figure 1D), while no such decrease was observed in early passages (Supplementary Figure S1A). To evaluate the differentiation potential of NSPCs from wildtype and Neil3^-/- hippocampus, we withdrew the epidermal growth factor and examined the gene expression of neuronal markers (Dcx, Tuj1, NeuN) and glia cell lineage markers (Gfap). All markers exhibited increased expression from the proliferative state to day 5 of differentiation in both wildtype and Neil3^-/- cells, demonstrating impaired cell differentiation (Figure 1D). The highest NEIL3 expression was detected in proliferating NSPCs with a striking reduction in differentiated cells (Supplementary Figure S1B). Notably, a significant decrease in NeuN expression was observed in Neil3^-/- cells, indicating further impairment in the state of neuronal maturation. This finding aligns with our previous research, which highlighted the role of NEIL3 in hippocampal maturation through its influence on transcription(24). There were no differences between wildtype and Neil3^-/- neurospheres to produce astrocytes (Figure 1D). Next, we analyzed nuclear DNA damage levels in proliferating and differentiating neurospheres by real-time quantitative PCR. This method is based on the inability of a restrictive enzyme to cleave damaged DNA, as described in Wang 2016 (28). Surprisingly, despite a significant accumulation of DNA damage during differentiation, the levels in Neil3^-/- cells were indistinguishable from those in wild-type cells (Figure 1E).

NEIL3 depletion impairs behavioral pattern separation and behavior-induced adult neurogenesis

In the adult hippocampus, NEIL3 displayed the highest gene expression levels in DG, with significantly lower levels in CA1 and CA3 (Figure 2A). Again, no accumulated oxidative DNA base lesions were detected in the adult hippocampus of Neil3^-/- mice, as measured by the levels of 8-oxoguanine (8-oxoG) and 5-oh cytosine (5-ohC) using liquid chromatography-tandem mass spectrometry (LC-MS/MS) (Figure 2B). This suggests that NEIL3 is not crucial for the overall removal of oxidized DNA base lesions in the hippocampus.

Adult neurogenesis is a hallmark of DG, known for its critical role in cognitive functions, particularly in behavioral pattern separation in memory. We refined the Novel Object Location task to assess both short-term and long-term memory in the context of behavioral pattern separation (see methods). In the short-term memory paradigm (1 training session and 1 test session with intertrial intervals of 5 min), wild-type animals spent significantly more time in the novel area than Neil3^-/- mice (mean values: 0.45 vs. 0.3, Figure 2C). Neil3^-/- mice showed no preference for the novel location, spending similar time as indicated by the reference index. In the long-term memory paradigm (3 training sessions and 1 test session with a 24-hour intertrial interval), wild-type animals also spent significantly more time exploring the novel area compared to Neil3^-/- mice (mean values: 0.48 vs. 0.28, Figure 2D). Next, we evaluated adult neurogenesis in the hippocampal DG of wild-type and Neil3^-/- animals (naive vs post-behavior) using immunohistochemistry with various neural proliferation and differentiation markers. Increased numbers of Ki67⁺ proliferating cells, SOX2⁺ neuroprogenitors, and DCX⁺ immature neurons were observed in wildtype mice following the long-term memory paradigm for behavioral pattern separation, but not in Neil3^-/- mice (Figure 2E-F), suggesting impaired adult neurogenesis in the NEIL3-deficient DG. Additionally, we tracked newborn neurons in the DG by administering BrdU intraperitoneally to wildtype and Neil3^-/- mice prior to the behavioral task (see methods). BrdU-labeled newborn neurons were visualized through co-staining with BrdU and NeuroD1. Again, a significant increase in BrdU-labeled newborn neurons was observed in wildtype mice after the long-term memory paradigm for behavioral pattern separation, but this increase was absent in Neil3^-/- mice (Figure 2G-H). Taken together, these results suggest that NEIL3 depletion impairs behavioral pattern separation and behavior-induced hippocampal adult neurogenesis.

NEIL3 impacts hippocampal adult neurogenesis by regulating the WNT signaling pathway

Our previous work has demonstrated the important role of NEIL3 in hippocampal maturation and function by influencing transcription (22, 24). To further explore the NEIL3-associated molecular mechanisms in adult neurogenesis, we performed a specialized analysis of the DG transcriptome from adult wild-type and Neil3^-/- mice, utilizing sequencing data published in Bugaj et al, 2024 (24). In the Neil3^-/- DG, 256 differentially expressed genes (DEGs) were identified (Log₂FC>0.6 and P_adj<0.05), with 157 genes upregulated and 99 downregulated (Figure 3A). PANTHER pathway analysis revealed that NEIL3-associated DEGs were significantly overrepresented in the Cadherin and Wnt signaling pathways (P00012 and P00057, FDR<0.05) (Figure 3B). Genes involved in the Wnt signaling pathway are displayed in the heat plot (Figure 3C). The upregulation of Cadherin 6 (CDH6) and NKD inhibitor of Wnt signaling pathway 1 (NKD1) was further validated by RT-qPCR (Figure 3D). Wnt signaling is known to regulate neuronal differentiation through the proneural transcription factors including Ngn2, NeuroD1, and Prox1(30). We analyzed the level of NeuroD1 and Prox1 by measuring fluorescent voxels in BrdU-labeled newborn neurons and found consistently decreased levels of both NeuroD1 and Prox1 in Neil3^-/- animals, in naive and post-behavior conditions (Figure 3E and 3F). These results suggest that NEIL3 impacts hippocampal adult neurogenesis by regulating the WNT signaling pathway.

NEIL3 depletion impairs the functional maturation of newborn DG neurons

Lastly, we assessed the physiological characteristics of newborn DG neurons in Neil3^-/-::DCX-cre mice using patch-clamp recordings, after viral transduction of a fluorescent reporter and tamoxifen injection (see methods). Newborn neurons were identified by eYFP expression under epifluorescence (Figure 4A). We recorded from 9 Cre+ cells in DCX-Cre and 9 Cre+ cells in Neil3^-/-::DCX-cre mice. The Neil3^-/- cells exhibited membrane properties compatible with immature granule cells (GCs) (Figure 4B). Input resistance in control and Neil3^-/- cells was equal to 1.02 ± 0.05 GW and 2.13 ± 0.18 GW, respectively (n=18, p=0.00002, t test, Figure 4C). Resting membrane potential in control and Neil3^-/- cells was equal to -66.70 ± 0.91 mV and -59.68 ± 0.50 mV (n=18, p=0.000004, t test, Figure 4C). Moreover, action potential amplitude was equal to 62.89 ± 3.96 mV and 33.11 ± 2.02 mV (n=18, p=0.000005, t test, Figure 4C). In addition, we recorded from adult DG granule cells in 7 Neil3^-/- and 5 Neil3^+/- mice (409±36.6 MOhm vs. 370±31.8 MOhm, respectively, n=24 cells, Supplementary Figure S2A). Resting membrane potential, action potential (AP) amplitude and AP half-width (of the first AP elicited by current steps) were also not different between Neil3^+/- and Neil3^-/- mice (-73.3 ±2.6 mV vs 73.6±3.0 mV, AP amplitude: 80.7±4.8 mV vs. 79.8±4.2 mV, and AP half-width: 1.7±0.19 ms vs 1.3±0.05 ms, for control and Neil3^-/-, respectively, n=24 cells). However, there were significant differences in the amplitude of the after hyperpolarization potential (following the first AP: -17.1±3.4 mV in Neil3^+/- vs. -8.5±1.3 mV in Neil3^-/- cells, p=0.04, n=24 cells, Supplementary Figure S2B). Also, the sag produced by -100 pA hyperpolarizing step was slightly larger in cells from Neil3-/- mice (-0.38±0.61 mV in Neil3^+/- vs. -3.51±0.54 mV in Neil3^-/- cells, p=0.001, n=24 cells, Supplementary Figure S2C). We then filled granule cells of Neil3^+/- and Neil3^-/- mice with biocytin for post hoc reconstruction and Sholl analysis (31) (Supplementary Figure S2D). No significant differences in number of branch and terminal points were found between Neil3^+/- and Neil3^-/- mice. Taken together, these data suggest that Neil3^-/- newborn (DCX+) neurons may take longer to acquire mature-like membrane properties, highlighting NEIL3’s role in the functional maturation of adult-born DG neurons.

Unlike other DNA glycosylases, NEIL3 mRNA expression is restricted to neurogenic niches in the brain (19, 20). As expected, we found the highest expression in vitro in DG of the adult hippocampus (Figure 2A), corresponding to the brain region with proliferating stem cell populations. Loss of NEIL3 has previously been shown to impair in vitro expansion of adult NSPCs from the aged hippocampus (23) and to affect stroke-induced neurogenesis (21). Here, we found that NSPCs from the Neil3^-/-neonatal hippocampus initially expand like wild-type cells but fail to increase their proliferation rate during propagation (Figure 1A). In vivo, previous studies indicate that NEIL3 depletion did not affect the number of proliferating cells in the perinatal hippocampal DG in naive mice, as assessed by the proliferation marker Ki67 and BrdU incorporation (24, 32). Interestingly, in a mouse model of Alzheimer’s disease, NEIL3 depletion impaired adult hippocampal neurogenesis and hippocampus-dependent working memory (25). This study revealed a significant reduction in proliferating cells (marked by Ki67 or BrdU), neuro-progenitors (marked by Sox2), and immature neurons (marked by DCX) in the DG of Neil3^-/- animals following a behavioral pattern separation task (Figure 2 E-H), indicating an important role of NEIL3 in the behavior-induced adult neurogenesis. Behavioral pattern separation is a cognitive process crucial for differentiating similar experiences and forming accurate, contextually appropriate memories (33). This process depends on the integration and functional maturation of new neurons in the hippocampal circuitry (34). Research has shown that disrupting hippocampal adult neurogenesis impairs spatial discrimination of stimuli with minimal separation(34). Conversely, enhancing neurogenesis in the DG by increasing the survival of adult-born neurons improves pattern separation (35). Consistent with these findings, Neil3^-/- mice exhibited impaired behavioral pattern separation (Figure 2C-D), likely due to disrupted neurogenesis in the adult DG following various experiences. Furthermore, electrophysiological measurements of newborn DCX⁺ DG neurons revealed that NEIL3 depletion impairs their functional maturation (Figure 4). This finding aligns with our earlier observations of delayed hippocampal maturation due to NEIL3 depletion (22, 24). Thus, our study identifies NEIL3 as a positive regulator of neuronal maturation in the hippocampus.

The process of adult neurogenesis is known to generate localized oxidative stress by reactive oxygen species (ROS) (13, 14). In the brain, oxidized DNA base lesions are mainly processed by base excision repair (BER), initiated by DNA glycosylases(17). NEIL3 is the main glycosylase that removes the oxidation products of 8-oxoguanine (8-oxoG), including spiroiminodihydantoin (Sp) and guanodinohydantoin (Gh), as well as 5-Hydroxymethylcytosine (5-ohC)(18). Notably, depletion of NEIL3 does not lead to a global accumulation of 8-oxoG and 5-ohC in the hippocampal genome (Figure 2B), suggesting that NEIL3 is not essential for the overall removal of oxidized DNA base lesions during hippocampal adult neurogenesis. Our recent studies have highlighted the important role of NEIL3 in shaping the hippocampal transcriptome during development and behavior (22, 24). Here, we identified differentially expressed genes (DEGs) in the Neil3^-/- DG that are involved in the Wnt signaling pathway (Figure 3). The Wnt pathway is crucial for adult neurogenesis, influencing the proliferation, differentiation, and integration of new neurons in DG (30). Notably, Wnt-target genes involved in neuronal differentiation and maturation, such as NeuroD1 (36) and Prox1 (37), exhibit reduced expression in behavior-induced newborn neurons in Neil3^-/- DG (Figure 3 E-F). Our findings suggest that NEIL3 modulates Wnt-mediated activation of behavior-induced adult neurogenesis. However, the molecular mechanisms by which NEIL3 regulates transcription require further investigation. It is tempting to speculate that NEIL3 may initiate BER on gene-specific DNA sequences to regulate gene expression. For example, NEIL3 may function in gene regulation by removing oxidized lesions in quadruplex structures of promoter regions (38).

In summary, this study shows that NEIL3 regulates hippocampal adult neurogenesis and behavioral pattern separation through the WNT signaling pathway. Given the importance of adult neurogenesis in cognitive function, targeting NEIL3 could offer therapeutic potential for addressing age-related hippocampal dysfunction and cognitive decline.

Animals

Mice used in this study were on C57BL6 background. Neil3^-/- animals were generated as previously described (26). For behavioral studies, 5-week-old mice were used, for other experimental procedures 3- to 6-month-old mice were used unless stated otherwise. The mice were bred and housed in 12-hour light and dark cycle with food and water ad libitum. All experiments were approved by the Norwegian Animal Research Authority and conducted in accordance with laws and regulation controlling experimental procedures in live animals in Norway and the European Union Directive 86/609/EEC and experiments conducted in Brazil were approved by the Animal Ethics Committee of the Federal University of Rio Grande do Norte (CEUA Proj. No. 051/2015).

Isolation and culture of NSPCs

Hippocampal NSPC were prepared from postnatal day 5 old mice and propagated as described previously (27). Briefly, neurospheres were cultured for 7 days in a proliferation medium consisting of Neurobasal-A medium with 2% B27 supplement, 20 ng/ml basic fibroblast growth factor, 10 ng/ml epidermal growth factor, 2 mM L-glutamine, and penicillin/streptomycin. For immunostaining of undifferentiated NSPCs, single cells were immobilized on a slide using a Thermo Shandon Cytospin (Thermo Fisher) centrifuge at 800 rpm for 4 min before fixation with 4% PFA. Cells were blocked with 5% BSA, 5% goat serum and 0.5% Triton-X-100 in PBS for 1 hour followed by incubation with primary antibodies in PBS containing 0.5% BSA and 0.5% goat serum at 4°C overnight. Staining with secondary antibodies was performed for 1 hour at room temperature (RT). The percentage of double-positive cells was calculated in relation to the total number of cells visualized by DAPI nuclear staining (1mg/ml, Invitrogen). For differentiation, single cells were plated onto poly-D-lysine-coated plates in proliferation medium without epidermal growth factor. Cultures from at least three different mice of each genotype were expanded separately.

Extraction of nucleic acid

Genomic DNA from NSPC cultures was isolated using the DNeasy Blood and Tissue kit and total RNA using the RNeasy Kit (Qiagen) following the manufacturer’s protocol. DNA and RNA from mouse hippocampal tissue were extracted using the AllPrep DNA/RNA/Protein mini Kit (Qiagen). Briefly, tissue was homogenized in RLT lysis buffer using Fastprep^R-24 instrument, centrifuged for 3 min, 13000 rpm, and supernatant was used for nucleic acid isolation.

DNA damage detection

Nuclear DNA damage was analyzed using a real-time qPCR-based method described previously (28). Briefly, genomic DNA was digested with Taq^aI restriction enzyme, and subsequent real-time PCR was carried out with 6 ng total DNA. Relative amounts of PCR products were calculated by the comparative DDCT method. The following primers were used: forward: 5’-tggtgactcctacctgaagc and reverse, 5’-ttcggtcgtgaattttgtt.

LC-MS/MS quantification

DNA samples were digested by incubation with a mixture of nuclease P1 from Penicillium citrinum (SIGMA, N8630), DNase I (Roche, 04716728001) and ALP from E. coli (SIGMA P5931) in 10 mM ammonium acetate buffer pH 5.3, 5 mM MgCl₂ and 1 mM CaCl₂ for 30 min at 40°C. The samples were methanol precipitated, supernatants were vacuum centrifuged at room temperature until dry, and dissolved in 50 ml of water for LC/MS/MS analysis. Quantification was performed with the use of an LC-20AD HPLC system (Shimadzu) coupled to an API 5000 triple quadrupole (ABSciex) operating in positive electrospray ionization mode. The chromatographic separation was performed with the use of an Ascentis Express C18 2.7 mm 150 x 2.1 mm i.d. column protected with an Ascentis Express Cartridge Guard Column (Supelco Analytical with an Exp Titanium Hybrid Ferrule (Optimize technologies Inc.). The mobile phase consisted of A (water, 0.1% formic acid) and B (methanol, 0.1% formic acid) solutions. The following conditions were employed for chromatography: for unmodified nucleosides – 0.13 mL/min flow, starting at 10% B for 0.1 min, ramping to 60% B over 2.4 min and re-equilibrating with 10% B for 4.5 min; for 5-oh(dC) – 0.14 mL/min flow, starting at 5% B for 0.1 min, ramping to 70% B over 2.7 min and re-equilibrating with 5% B for 5.2 min; for dC modifications, and 8-oxo(dG) – 0.14 mL/min flow, starting at 5% B for 0.5 min, ramping to 45% B over 8 min and re-equilibrating with5% B for 5.5 min. For mass spectrometry detection the multiple reaction monitoring (MRM) was implemented using the following mass transitions: 252.2/136.1 (dA), 228.2/112.1 (dC), 26832/152.1 (dG), 243.2/127.0 (dT), 244.1/128 [5-oh(dC)], 284.1/168.1 [8-oxo(dG)].

Analysis of mRNA expression level

Total RNA (1mg) was reversely transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Relative expression levels were calculated using the comparative DCT method and related to the housekeeping gene b-actin. Primer sequences are listed in Table 1 below.

Table 1

Target	Forward	Reverse
Dcx	TACCTGGGATTTTCCTTTGG	CTCGTTCGTCAAAATGTCCA
Tuj-1	CCAAGACAAGCAGCATCTGT	CAGAGCCAAGTGGACTCACA
NeuN	GAGTCTATGCCGCTGCTGAT	TTGCTAGTAGGGGGTGAAGC
Gfap	TCCTGGAACAGCAAAACAAG	CAGCCTCAGGTTGGTTTCAT
b-actin	CTTGATAGTTCGCCATGGAT	GGTCACTTACCTGGTGCCTA
Cdh6	GGAGCCGTAACCTTCCCATC	CGGTCTTCTGCTCTGTGCTT
Nkd1	TTGGGGAAAAGAGGCTGCTGA	CTCTAGAAGTGTCACCCACGAG

Behavioral test

Animals were handled in 5-minute sessions following a 3-day habituation period. For the short-term memory paradigm, the pattern separation behavioral task was performed in 2 sessions (1 training session and 1 test session) with intertrial intervals of 5 min. During the training session, animals were presented to 3 equal objects in a circular arena (46 cm diameter) equally distant from each other and the wall of the arena. Spatial cues were placed on the wall immediately behind the objects and animals were allowed to explore the objects for 10 min. In the test session, one of the objects was moved 40˚ away from its original position and we recorded the time animals spent exploring each object also during a total time of 10 min. Data acquisition was performed using the EthoVision live video tracking system (Noldus Information Technology Inc., VA, USA), and preference indexes for Neil3^-/- and control animals were determined by calculating the amount of time spent in the moved object divided by the sum of the total amount of time spent in each object. Results were plotted as mean ± SEM. and statistical analysis was performed applying Student’s t-test. For the long-term memory paradigm, the pattern separation behavioral task was performed in 4 sessions (3 training sessions and 1 test session) with intertrial intervals of 24 hours. During the training sessions, animals were presented to 3 identical objects in a white square arena (50 cm x 50 cm), with a black cue card placed on the wall, equally distant to each other in a circular manner with the objects being spread apart 120°. The animals were allowed to explore the objects and the arena for 10 min. In the test session, one of the objects was moved 60° away from its original position and we recorded the animals exploring the objects and arena for 10 min. Data acquisition was performed using the ANY-Maze video tracking tool (Stoelting) and preference indexes for wildtype and Neil3^-/- animals were determined by calculating the amount of time investigating the novel zone divided by the sum of the total amount of time investigating all objects. Results were plotted in GraphPad Prism (Dotmatics) as mean ± SEM and statistical analysis was performed using unpaired t-test.

Frozen section immunohistochemistry

Mice were transcardially perfused with saline solution (BBraun) before brain removal. For BrdU analysis, mice were injected intraperitoneally with BrdU (Sigma, 100mg/kg bodyweight) every 24h for 7 days before dissection. Brains were fixed in 4% PFA for at least 48h, then frozen sectioned into 30um sagittal sections. DNA hydrolysis was performed using 1M HCl for 1h at 37°C, the reaction was neutralized by incubating in 0.1M Sodium Borate (pH 8.5) for 10min at RT and sections were washed thoroughly with PBS. Antigen retrieval was performed using sodium citrate 40mM, pH 6.0, incubated at 99°C for 4 min. Subsequently, sections were blocked with 5% BSA 5% NGS and 0.1% Triton-X in PBS for 1 hour. After blocking, sections were incubated with primary antibodies in the antibody dilution buffer (1% BSA 1% NGS, and 0.1% Triton-X in PBS) overnight at 4°C. After washing in PBS with 0.1% Tween-20, sections were incubated with secondary antibodies for 2h at RT (protected from light). Samples were mounted in SuperfrostÔ Plus Adhesion Microscope Slides (Epredia) while submerged and let to dry overnight. Samples were then incubated with DAPI staining solution (1ug/ml, Thermo Scientific) for 15 min before being cover slipped with ProLongÔ Gold Antifade with DAPI Mountant (Invitrogen).

Antibodies

Primary antibodies used were anti-Ki67 (rat IgG2a, 1:500, ThermoFisher, Cat. No. 14-5698-82, RRID: AB_10854564), anti-BrdU (mouse IgG2a, 1:500, Invitrogen, Cat. No. MA3-071, RRID: AB_ 10986341), anti-DCX (rabbit IgGs, 1:1000, Cell Signaling, Cat. No. 4604S, RRID: AB_ 561007), anti-SOX2 (rabbit IgGs, 1:1000, Sigma-Aldrich, Cat. No. PA1-094, RRID: AB_ 2539862), anti-NeuroD1 (rabbit IgGs, 1:500, Abcam, Cat. No. ab213725, RRID: AB_2801303), anti-PROX1 (rabbit, 1:1000, Porteintech, Cat. No. 11067-2-AP, RRID: AB_2268804), anti-Nestin (mouse IgGs, 1:200, Millipore Cat. No. MAB5326, RRID:AB_2251134), rabbit anti-GFAP (rabbit IgGs, 1:500, Agilent Cat. NO. Z0334, RRID:AB_10013382), and anti-NeuN (mouse IgG1, 1:500, Millipore, Cat.No. MAB377, RRID: AB_2298772). Secondary antibodies were Alexa FluorÒ 488 anti-mouse IgG1 (1:1000, Cat. No. A-21121, RRID: 2535764), Alexa FluorÒ 488 anti-mouse IgG2a (1:1000, Cat. No. A-21131, RRID: AB_2535771), Alexa FluorÒ 488 anti-rabbit (1:1000, Cat. No. A32731, RRID: AB_2633280), Alexa FluorÒ 555 anti-mouse IgG1 (1:1000, Cat. No. A-31570, RRID: AB_2536180), Alexa FluorÒ 555 anti-rabbit (1:1000, Cat. No. A-31572, RRID: AB_162543), Alexa FluorÒ 647 anti-mouse IgG2a (1:1000, Cat. No. A-21241, RRID: AB_2535810), Alexa FluorÒ 647 anti-rabbit (1:1000, Cat. No. A-21244, RRID: AB_2535812) Alexa FluorÒ 647 anti-rat (1:1000, Cat. No. A-21247, RRID: AB_141778) and Alexa FluorÒ 647 anti-guinea pig (1:1000, Cat. No. A-21450, RRID: AB_141882).

3D-image analysis

Microscopy was carried out using a Zeiss LSM 880 confocal laser scanning microscope equipped with a 40X oil immersion objective. 3D-image analysis was performed using IMARIS 9 (Oxford Instruments). The surface tool was utilized to select the granular and subgranular zones in the DG, allowing for calculating their volume across all visible stacks. For cell density analysis, the Cell Counter plugin in FIJI(29) was used to manually count the number of Ki67⁺, SOX2⁺, DCX⁺, BrdU⁺, and NeuroD1⁺ cells in their respective channels. For fluorescent voxel analysis, the initial surface created in IMARIS was masked in the BrdU channel. A new surface was then generated by selecting only BrdU-positive cells within this mask, and the fluorescent voxel counts were obtained from this surface for NeuroD1 or Prox1 in their corresponding channels. Results were calculated by dividing the number of positive cells or the number of voxels by the volume in mm³. Data were plotted as mean ± SEM using GraphPad (Dotmatics), and statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparison test.

RNAseq data and analysis

The RNAseq dataset consisted of 6 samples, including 3x wildtype samples (3m-DG) and 3x Neil3^-/- samples (3m-DG). It is a part of the RNAseq dataset (GSE175360) (24) and is available in the Gene Expression Omnibus repository (GEO). Sample and sequencing details were described in Bugaj et al., 2024. Briefly, the raw data of gene expression was obtained from BGI and the normalized expression levels were transformed by the variance stabilizing function DESeq2::vst. DESeq2 was used to test for differential expression between genotypes in adult DG. Differential gene expression was determined by the threshold of adjusted p-value < 0.05 and ABS(log2 fold change) > 0.6. For the PANTHER pathway over-representation analysis, the list of DEGs was uploaded to the online version of PANTHER Classification System using Binomial test and Bonferroni correction and mouse genome as background.

Patch-clamp

Horizontal hippocampus slices of Neil3^-/- (homozygous and heterozygous, mean age of 2.5 months) with DCX-Cre/ERT2 mice (P60-P90) were obtained after quick decapitation under ketamine (80mg/kg) anesthesia. Some experiments were conducted only with Neil3^-/- (homozygous and heterozygous). Tamoxifen (20 mg/g of body weight) was administered 7 days before the experiment. Also, to target newborn neurons we stereotaxically injected AAV2/9-dio-eYFP (obtained from the University of Pennsylvania vector core, 1mL at the following coordinates (in mm): 3.5 AP, 3 ML and 4DV (leao 2012 OLM interneurons)) to induce the expression of fluorescent reporter protein approximately 30 days prior to the experiment. Brains were removed after decapitation and placed in ice-cold artificial cerebrospinal fluid (ACSF)/sucrose solution (in mM: KCl, 2.49; NaH₂PO₄, NaHCO₃, 26; glucose, 10; sucrose, 252; CaCl₂, 1; MgCl₂, 4) (leao 2012). Horizontal slices (400 mm) were collected on a vibratome (VT1200, Leica) and transferred to a chamber filled with recording ACSF (in mM: NaCl, 124; KCl, 3.5; NaH₂PO₄, 1.25; MgCl₂, 1.5; CaCl₂, 1.5; NaHCO₃, 30; glucose, 10), constantly bubbled with 95% O₂ and 5% CO₂ (White-Martins). For whole cell patch clamp recordings, slices were transferred to the stage of an upright microscope (Zeiss). Recording pipettes were filled either with a K-gluconate-based solution (in mm: 17.5 KCl, 122.5 K-gluconate, 9 NaCl, 1 MgCl₂, 3 Mg-ATP, 0.3 GTP-Tris, 1 HEPES, 0.2 EGTA; pH was adjusted to 7.2 using KOH) supplemented with 1-2% biocytin (Sigma-Aldrich). Granule cells were patched under visual guidance using an upright microscope equipped with differential interference contrast optics (Leao 2009 kv7/kcnq). After obtaining whole-cell configuration, current-clamp recordings were obtained to analyze the firing properties of DG cells using an Axopatch 200B amplifier.

Funding

This work was supported by the Research Council of Norway (FriMedBio and Stem Cell Program) and The Liaison Committee for Education, Research, Innovation in Central Norway (Samarbeidsorganet).

Declaration of competing interests

The authors declare no competing interests.

Data availability

The RNAseq data is a part of the RNAseq dataset (GSE175360) (24) and is available in the Gene Expression Omnibus repository (GEO). Other data generated and analyzed during the current study are available from the corresponding author upon request.

Ethics statement

All animal experiments were approved by the Norwegian Animal Research Authority and conducted in accordance with laws and regulations controlling experimental procedures in live animals in Norway and the European Union Directive 86/609/EEC. Experiments conducted in Brazil were approved by the Animal Ethics Committee of the Federal University of Rio Grande do Norte (CEUA Proj. No. 051/2015).

CRediT authorship contribution statement

Marion S. Fernandez-Berrocal: Data curation, Validation, Formal analysis, Visualization, Writing - original draft. Amilcar Reis: Data curation, Validation, Visualization. Veslemøy Rolseth: Data curation, Validation. Rajikala Suganthan: Data curation, Validation. Anna Kuśnierczyk: Data curation, Validation. Arthur França: Data curation, Validation. Annara YM Soares: Data curation, Validation. Nicolas Kunath: Methodology, Data curation. Anna M. Bugaj: Formal analysis. Andreas Abentung: Data curation, Validation. Lars Eide: Conceptualization, Funding acquisition, Resources, Review. Richardson N. Leão: Conceptualization, Funding acquisition, Resources, Supervision, Visualization, Writing - original draft. Magnar Bjørås: Conceptualization, Funding acquisition, Investigation, Project administration, Resources, Supervision, Writing - review & editing. Katja Scheffler: Conceptualization, Funding acquisition, Resources, Project administration, Data curation, Visualization, Supervision, Visualization, Writing - original draft, Writing - review & editing. Jing Ye: Conceptualization, Funding acquisition, Resources, Project administration, Data curation, Visualization, Supervision, Writing - original draft, Writing - review & editing

Declaration of competing interests

The authors declare no competing interests.

A. D. Garcia, N. B. Doan, T. Imura, T. G. Bush, M. V. Sofroniew, GFAP-expressing progenitors are the principal source of constitutive neurogenesis in adult mouse forebrain. Nat Neurosci 7, 1233-1241 (2004).
B. Seri, J. M. Garcia-Verdugo, L. Collado-Morente, B. S. McEwen, A. Alvarez-Buylla, Cell types, lineage, and architecture of the germinal zone in the adult dentate gyrus. J Comp Neurol 478, 359-378 (2004).
D. A. Laplagne et al., Functional convergence of neurons generated in the developing and adult hippocampus. PLoS Biol 4, e409 (2006).
H. van Praag et al., Functional neurogenesis in the adult hippocampus. Nature 415, 1030-1034 (2002).
G. Kempermann, S. Jessberger, B. Steiner, G. Kronenberg, Milestones of neuronal development in the adult hippocampus. Trends Neurosci 27, 447-452 (2004).
B. Steiner et al., Type-2 cells as link between glial and neuronal lineage in adult hippocampal neurogenesis. Glia 54, 805-814 (2006).
M. S. Esposito et al., Neuronal differentiation in the adult hippocampus recapitulates embryonic development. J Neurosci 25, 10074-10086 (2005).
C. Zhao, E. M. Teng, R. G. Summers, Jr., G. L. Ming, F. H. Gage, Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus. J Neurosci 26, 3-11 (2006).
J. K. Leutgeb, S. Leutgeb, M. B. Moser, E. I. Moser, Pattern separation in the dentate gyrus and CA3 of the hippocampus. Science 315, 961-966 (2007).
A. Bakker, C. B. Kirwan, M. Miller, C. E. Stark, Pattern separation in the human hippocampal CA3 and dentate gyrus. Science 319, 1640-1642 (2008).
A. Treves, A. Tashiro, M. P. Witter, E. I. Moser, What is the mammalian dentate gyrus good for? Neuroscience 154, 1155-1172 (2008).
T. Kitamura, K. Inokuchi, Role of adult neurogenesis in hippocampal-cortical memory consolidation. Mol Brain 7, 13 (2014).
J. E. Le Belle et al., Proliferative neural stem cells have high endogenous ROS levels that regulate self-renewal and neurogenesis in a PI3K/Akt-dependant manner. Cell Stem Cell 8, 59-71 (2011).
N. M. Walton et al., Adult neurogenesis transiently generates oxidative stress. PLoS One 7, e35264 (2012).
S. Oka et al., MTH1 and OGG1 maintain a low level of 8-oxoguanine in Alzheimer's brain, and prevent the progression of Alzheimer's pathogenesis. Sci Rep 11, 5819 (2021).
R. J. Ferrante et al., Evidence of increased oxidative damage in both sporadic and familial amyotrophic lateral sclerosis. J Neurochem 69, 2064-2074 (1997).
H. E. Krokan, M. Bjoras, Base excision repair. Cold Spring Harb Perspect Biol 5, a012583 (2013).
M. Liu et al., The mouse ortholog of NEIL3 is a functional DNA glycosylase in vitro and in vivo. Proc Natl Acad Sci U S A 107, 4925-4930 (2010).
G. A. Hildrestrand et al., Expression patterns of Neil3 during embryonic brain development and neoplasia. BMC Neurosci 10, 45 (2009).
V. Rolseth et al., Widespread distribution of DNA glycosylases removing oxidative DNA lesions in human and rodent brains. DNA Repair (Amst) 7, 1578-1588 (2008).
Y. Sejersted et al., Endonuclease VIII-like 3 (Neil3) DNA glycosylase promotes neurogenesis induced by hypoxia-ischemia. Proceedings of the National Academy of Sciences 108, 18802-18807 (2011).
N. Kunath et al., DNA repair enzyme NEIL3 enables a stable neural representation of space by shaping transcription in hippocampal neurons. iScience 24, 103470 (2021).
C. E. Regnell et al., Hippocampal adult neurogenesis is maintained by Neil3-dependent repair of oxidative DNA lesions in neural progenitor cells. Cell Rep 2, 503-510 (2012).
A. M. Bugaj et al., Dissecting gene expression networks in the developing hippocampus through the lens of NEIL3 depletion. Prog Neurobiol 235, 102599 (2024).
M. A. Egiazarian et al., Age- and sex-dependent effects of DNA glycosylase Neil3 on amyloid pathology, adult neurogenesis, and memory in a mouse model of Alzheimer's disease. Free Radic Biol Med 193, 685-693 (2022).
Y. Sejersted et al., Endonuclease VIII-like 3 (Neil3) DNA glycosylase promotes neurogenesis induced by hypoxia-ischemia. Proc Natl Acad Sci U S A 108, 18802-18807 (2011).
W. Wang et al., Mitochondrial DNA integrity is essential for mitochondrial maturation during differentiation of neural stem cells. Stem cells 28, 2195-2204 (2010).
Y. Wang et al., A nuclease that mediates cell death induced by DNA damage and poly(ADP-ribose) polymerase-1. Science 354, (2016).
J. Schindelin et al., Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682 (2012).
S. B. Arredondo, D. Valenzuela-Bezanilla, M. D. Mardones, L. Varela-Nallar, Role of Wnt Signaling in Adult Hippocampal Neurogenesis in Health and Disease. Front Cell Dev Biol 8, 860 (2020).
C. G. Langhammer et al., Automated Sholl analysis of digitized neuronal morphology at multiple scales: Whole cell Sholl analysis versus Sholl analysis of arbor subregions. Cytometry A 77, 1160-1168 (2010).
V. Rolseth et al., Loss of Neil3, the major DNA glycosylase activity for removal of hydantoins in single stranded DNA, reduces cellular proliferation and sensitizes cells to genotoxic stress. Biochim Biophys Acta 1833, 1157-1164 (2013).
B. Schmidt, D. F. Marrone, E. J. Markus, Disambiguating the similar: the dentate gyrus and pattern separation. Behav Brain Res 226, 56-65 (2012).
C. D. Clelland et al., A functional role for adult hippocampal neurogenesis in spatial pattern separation. Science 325, 210-213 (2009).
A. Sahay et al., Increasing adult hippocampal neurogenesis is sufficient to improve pattern separation. Nature 472, 466-470 (2011).
T. Kuwabara et al., Wnt-mediated activation of NeuroD1 and retro-elements during adult neurogenesis. Nat Neurosci 12, 1097-1105 (2009).
O. Karalay et al., Prospero-related homeobox 1 gene (Prox1) is regulated by canonical Wnt signaling and has a stage-specific role in adult hippocampal neurogenesis. Proc Natl Acad Sci U S A 108, 5807-5812 (2011).
J. Zhou, A. M. Fleming, A. M. Averill, C. J. Burrows, S. S. Wallace, The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures. Nucleic acids research 43, 4039-4054 (2015).

SupplementalFiguresupdated.pdf

Download PDF

Editorial decision: Major Revision
06 Nov, 2024
Reviewers agreed at journal
25 Oct, 2024
Reviewers invited by journal
24 Oct, 2024
Editor assigned by journal
14 Oct, 2024
First submitted to journal
09 Oct, 2024

You are reading this latest preprint version

NEIL3 influences adult neurogenesis and behavioral pattern separation via WNT signaling

Status:

Version 1

Abstract

Figures

Highlights

Introduction

Results

Discussion

Conclusion

Materials and Methods

Declarations

References

Supplementary Files

Status:

Version 1