Exploring Mechanistic Insights and Apoptotic Gene Expression Induced by Myricetin Through In-Vitro and In-Silico Approaches

doi:10.21203/rs.3.rs-5236764/v1

Download PDF

Research Article

Exploring Mechanistic Insights and Apoptotic Gene Expression Induced by Myricetin Through In-Vitro and In-Silico Approaches

https://doi.org/10.21203/rs.3.rs-5236764/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Myricetin demonstrates considerable potential in the area of anticancer research. It is known to be recognized as a rich natural polyphenolic flavonoid found abundantly in diverse dietary sources. This study investigates the impact of myricetin on cellular processes, including cell death, cell cycle regulation, and the expression of apoptotic genes in MCF-7 breast cancer cells. The cytotoxicity of myricetin was assessed using the MTT assay and cell cycle analysis on MCF-7 cells. Propidium iodide or Annexin V flow cytometric analysis was used to confirm apoptosis. Quantitative real-time PCR was used to measure the gene expression linked to apoptosis in MCF-7 cells following a 24-hour myricetin administration. Molecular docking was employed to probe the binding of myricetin to BCL-2. The cytotoxicity of myricetin revealed an IC50 of 5.06 µg/100 µl at 24 hours. Myricetin induced apoptosis in the Sub G₀/G₁ phase (10.38%). The findings showed up-regulation of the antiapoptotic gene BCL-2, along with elevated expression of caspase-9 and caspase-7, while the caspase-3 gene exhibited down-regulation. In silico analysis further confirmed the efficient binding of myricetin to BCL-2. The findings suggest that Myricetin exhibits a potent apoptotic effect by inhibiting cell cycle progression, however, further in-vivo investigations are necessary to understand the complexity of this molecule.

Apoptosis

breast cancer

cell cycle

myricetin

Breast cancer stands as the most formidable adversary among gynecological malignancies (Torre et al. 2017). Being the main factor in cancer-related deaths among women emphasizes its deadly impact. Over the recent decades, apoptosis has aroused as a promising process in the pursuit of combatting cancer (Sung et al. 2020).

It’s been indicative that signal transduction pathways show a pivotal role in regulating cellular processes, and their dysregulation is a hallmark of carcinogenesis (Sever & Brugge et al. 2015). Uncontrolled cell proliferation, angiogenesis, and metastasis—three important aspects of cancer progression can result from abnormal activation of these pathways. Understanding and modulating these pathways have become central to cancer research, and recent studies suggest that flavonoids can effectively interfere with these processes (Ravishankar et al. 2013; De Cicco et al. 2019). For over 3,500 years, natural bio-products, of plant origin, served as crucial sources for developing new anticancer drugs with minimal side effect (Iqbal et al. 2017; Seca et al. 2018). Alkaloids, flavonoids, terpenoids, and polyphenols are among the compounds that have shown encouraging anticancer activities through a variety of mechanisms, such as initiation of apoptosis, cell cycle arrest, and inhibition of angiogenesis. The multifaceted nature of these compounds provides researchers with a rich palette to formulate targeted and effective cancer treatments.

Myricetin is a polyphenol flavonoid that has received a lot of attention nowadays because of its prevalence as the main ingredient in herbal edible products (Kumar et al. 2020). It stands out as one of the most prevalent and bioactive flavonoid isolated from Myrica nagi (Middha et al. 2016). Continued research into its pathophysiological properties reveals myricetin as a versatile compound, with antimicrobial, antioxidant, antiviral, cytoprotective, and antiplatelet effects (Li et al. 2022). Several studies have reported myricetin's anticancer properties (Felice et al. 2022). The stimulation of apoptosis is a fundamental mechanism by which myricetin exerts its anticancer effects. A study revealed that myricetin's ability to effectively repress the malignant progression of prostate cancer (Ye et al. 2018).

The researchers and group demonstrated that myricetin acts by inhibiting the PIM1 kinase, a critical player in prostate cancer development. PIM1, a proto-oncogene, is known to promote cell survival and proliferation, and its overexpression is associated with aggressive prostate cancer. Myricetin disrupts the PIM1 kinase activity, thereby hindering the cancer-promoting effects. Furthermore, the study highlighted another mechanism by which myricetin strives its anti-cancer potential by subverting the PIM1/CXCR4 interaction. CXCR4, a chemokine receptor, plays a significant part in the invasion and migration of cancer cell (Ye et al. 2018). Myricetin inhibits the spread of hepatocellular carcinoma via., targeting Yes-associated protein (YAP) and its target genes (Li et al. 2019), decreases angiogenesis by inhibiting the Akt/PI3K/mTOR signaling cascade and causing reactive oxygen species (ROS)-mediated apoptosis (Kim et al. 2017). However, we are yet to clearly comprehend the mechanism underlying the induction of Myricetin's apoptotic effects in breast cancer. A group of cysteine proteases known as caspases are activated during the highly controlled process of apoptosis, which are inherently present in their inactive forms as zymogens or proenzymes. This process takes place via two primary pathways: the intrinsic (mitochondrial) pathway and the extrinsic (death receptor) pathway. The BCl-2 protein family is thought to largely regulate the discharge of cytochrome-C from mitochondria by altering the permeability of the mitochondrial membrane. The regulation of the BCl-2 family proteins is critically dependent on the tumor suppressor protein p53 (Hemann et al. 2006). The intrinsic apoptotic process is initiated by the meticulous balance of pro and antiapoptotic BCL-2 proteins (Singh et al. 2019).

MCF-7 cells are ideal for in-vitro research as they have several desirable characteristics created explicitly to simulate the mammary epithelial tissues. The MCF-7 cell line is commonly used as an imitation for estrogen receptor-positive breast cancer, particularly in studies investigating the association between breast cancer and these cells' vulnerability to apoptosis (Yang et al. 2006). Previously, our lab studied the anti-inflammatory potential of myricetin in Lipopolyscahharide treated cell lines (Nishad K et al. 2024). Investigating myricetin's effects on MCF-7 cells is prominent in knowing its potential in breast cancer treatment. The current study is focused on myricetin’s effect on MCF-7 breast cancer cells' ability to undergo apoptosis.

2.1 Cell-culture

MCF-7 breast cancer cell lines were sourced from NCCS Pune, India for this study. The cells were grown in Dulbecco's modified Eagle medium (DMEM), which contained 10% Fetal Bovine Serum (FBS) from HiMedia, Brazil. 1% penicillin-streptomycin was added to the media, and then cells were incubated at 37°C with 5% CO₂. When the cells were 80% confluent, the experiments were carried out. Tissue culture complete medium (i.e., DMEM + 10% FBS) was used as control whereas Cisplatin was used as positive control.

2.2 Determining the myricetin IC₅₀ dosage by MTT Assay

The cytotoxic potency of myricetin on the MCF-7 cells was assessed using the MTT assay. Briefly, MCF-7 cells were seeded onto 96-well plates at a density of roughly 1x5⁴ cells per well. After 24 hours of incubation, the cells were treated with different concentrations of myricetin (1.5, 3.12, 6.25, 12.5 and 25 µg /100 µl) and Cisplatin (2, 4, 6, 8, 10 and 25 µg/100 µl) as a positive control group. After 24 hours of treatment, MTT (100µl of 5mg/ml) was put to all the wells and incubated at 37°C for 4hr inside the CO₂ incubator. The medium was then removed, and the Formazan was dissolved by the addition of 100µl of crude Dimethyl sulfoxide (DMSO). OD was read at 570nm using a microplate reader (Sajedi et al. 2020). After that, the IC₅₀ value (inhibitory concentration) was determined and collated with that of the control group, that received no treatment.

2.3 Flow cytometric analysis with Annexin-V staining

Using flow cytometry and Annexin V-FITC, it was determined whether myricetin could trigger apoptosis in MCF-7 cells. At an optical density of 1x10⁶ cells/ml, cells were grown in 6-well plates and incubated for 24hours at 37°C in a CO2 incubator. After 24hr, culture medium was removed, and cells were treated with the IC₅₀ concentration of myricetin and Cisplatin, as positive control. Again, after 24hr of incubation, the grown cells subjected to trypsinization and collected into polystyrene tubes and centrifuge at 300g at 25°C for 5mins. The supernatant solution was decanted, and the wells with cells were cleansed twice with PBS. After discarding the PBS, the pellet was re-suspended in 400µl of 1X binding buffer. Then, 5µl of FITC-Annexin V and 5µl PI (Propidium Iodide) was added for cell staining purpose. The cell-suspension was gently vortexed and incubated at 27°C for 15mins in the dark. Apoptotic cells were assessed by using flow cytometry (BD FACSCalibur). The experiments were performed in triplicates independently.

2.4 Cell cycle Analysis

The breast cancer cells MCF-7 were grown in 6-well plates at an optical density of 1x10⁶cells/ml. Then, the plates were incubated for overnight in a CO₂ incubator at 37°C. After 24hr, the grown cells were treated with IC₅₀ concentration of myricetin and Cisplatin. Again, after 24hr of incubation, the spent medium was decanted from the wells with a good PBS rinsing. After washing, the cells were trypsinised and collected into polystyrene transparent tubes. Then the tubes were centrifuged at 300g for 5mins at 25°C. Later, the supernatant was discarded and washed using cold PBS buffer. After discarding the PBS, the cells were made stable by adding 1ml of chilled 70% ethanol dropwise to the cell pellet. This ensured fixation of all the cells and minimized clumping. This was incubated for 30 mins in -20°C. Then, the cells were pelleted by centrifuging at 1000rpm for 5mins. The supernatant was aspirated carefully to avoid losing the pellet. Cells were then washed twice with PBS buffer. For ensuring that, only DNA is stained, the cells were subjected to a wash with 400µl Propidium Iodide (PI)/RNase staining buffer (Catalog No: 550825, BD Biosciences, USA) and mixed well. Cells were incubated for 15 to 20 mins at 27°C in dark chamber and analyzed using flow cytometry.

2.5 Real-Time PCR

Real-time PCR was used to measure the expression levels of caspase3, caspase7, caspase9, and Bcl-2. The cells were exposed to the IC₅₀ value of myricetin for 24hr. Trizol was used to extract the total RNA from the treated, untreated, and positive controls. The procedure of RNA extraction was followed as per the supplier instructions. Using a First Strand cDNA Synthesis Kit, cDNA was reverse transcribed (PCR Biosystems, United Kingdom). qPCR SyGreen Master Mix kit (PCR Biosystems) was used according to the company protocol. Quantitative Real-time PCR (qPCR) was applied to investigate mRNA expression of caspase7, caspase8, caspase3, and BCL-2 genes using specific primers (Table 1). The PCR cycling parameters were highly specific & as follows: 95°C for 10 min-the initial denaturation; followed by the denaturation step for 40cycles at 95°C for 15sec; finally, extension or annealing at 60°C for 1min. As a reference gene for internal control, GAPDH was employed. Utilizing the comparative Ct (ΔΔct) approach, data were examined. The experiments were run in triplicates to minimize the errors (Sajedi et al. 2020; Ozben et al. 2020). Table 1 depicts the target primer pairs for test genes and control gene (GAPDH).

Table 1

Primer sequence of the genes used in quantitative real time- PCR (qRT-PCR)
Genes	Forward Primer	Reverse Primer
Caspase 7	AGCAACGTCTAGGAGACCAC	CCGTGGAATAGGCGAAGAGG
Caspase 3	TGCTATTGTGAGGCGGTTGT	TCTGTTGCCACCTTTCGGTT
Caspase 9	CGGTGACCCCAGAATTGACC	GGACTCACGGCAGAAGTTCA
BCL-2	ACAGGGTACGATAACCGGGA	GCCCAGACTCACATCACCAA
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA

2.6 In silico Docking

In-silico docking was advocated to analyze the binding of myricetin to the anti-apoptotic protein BCL-2. The X-ray crystallographic protein structure of BCL-2 was downloaded from the Protein Data Bank (PDB) (Berman et al. 1999) with PDBID 2W3L, having a resolution of 2.10 Å. The protein structure was prepared using Discovery Studio 3.4 by removing hetero atoms, water molecules, and duplicate chains, and by adding missing residues and loops to achieve completeness in the structure prior to docking. Hydrogen atoms were also added to the polar groups. Meanwhile, the 3D structure of myricetin was retrieved from the PubChem database (Kim et al. 2016) in sdf format. Myricetin was subjected to ligand preparation, which included neutralizing charged groups, optimizing ring conformers with low energy, and refining geometric structures. After preparing the proteins and the ligand, the binding site was defined based on the receptor cavity predicted by the software, with sphere dimensions of X = 40.44, Y = 33.20, Z= -5.15, and a radius of 21.78 Å. Molecular docking was executed using the CDOCKER module in Discovery Studio, and the results were analyzed based on CDOCKER energy and types of interactions.

2.7 Statistical analysis

For analysis of variance, ANOVA was employed to evaluate the significance of the data. The mean ± standard deviation (SD) was utilized to report the quantitative data. One-way ANOVA was used for the statistical comparison between the groups, and data were deemed significant at p < 0.05.

3.1 MTT Assay

The MTT assay results demonstrated that myricetin-treated MCF-7 cells exhibited significant cytotoxicity as shown in Fig. 1. The cells were investigated with different concentrations of myricetin (1.5, 3.12, 6.25, 12.5, and 25 µg/100 µl) for 24 h. After myricetin treatment, MCF-7 cells showed 50% cell viability at a dose of 5.06 µg/100 µl, which turned out to be the IC₅₀ dosage for this investigation. Cisplatin as the positive control demonstrated anti-proliferative potential over MCF-7 cells. IC₅₀ of Cisplatin was ascertained as 4.4 µg/100 µl. The inhibition of cell proliferation could have been the result of apoptotic activity, growth inhibition, or cell-cycle growth arrest. Hence, we investigated if Myricetin stimulates breast cancer cells to undergo apoptosis.

3.2 Cell cycle

Cell cycle analysis indicates that MCF7 cell-lines treated with 5.06 µg/100 µl of myricetin arrests the cancer cells in Sub G₀/G₁ phase after 24 h of exposure. The percentage of sub G₀/G₁ phase cells (apoptotic phase) in the untreated group was identified to be 1.39%; while, it was increased to 10.38% in the treated group and 4.74% in Cisplatin treated cells (Fig. 2 and Table 2). The cells in G₀/G₁ phase (in growth phase) were assessed as 64.96% in control and 51.21% in treated group. In S-Phase (synthesis phase), 3.46% and 5.43% of cells were arrested in untreated group and treated group respectively. In contrast, the result of G₂/M phase was recorded as 30.19% in the control and slightly increased to 32.98% in treated groups, whereas it decreased to 7.82% in Cisplatin treated cells. It can be concluded from the data that, the MCF-7 cell lines are arrested in sub G₀/G₁ phase of cell-cycle upon treatment with myricetin (Fig. 3) and apoptotic cells are increased in sub G₀/G₁ phase. So, the result establishes that myricetin induced the death of MCF-7 cells by arresting the cells in Sub G0/G1 phase.

Table 2

Percentage of cells arrested in the different phases of MCF-7 cell cycle
Cell cycle stage	Untreated	Myricetin	Cisplatin
Sub G0/G1	1.39	10.38	4.74
G0/G1	64.96	51.21	77.9
S	3.46	5.43	9.53
G2/M	30.19	32.98	7.82

3.3 Effect of Myricetin on MCF-7 Cells Apoptosis

Annexin V-FITC staining is used for detection of apoptotic activity and compared with control & Cisplatin (Positive control); MCF-7 cell lines exposed to myricetin for 24 hr displayed significant boosting of apoptosis. Flow cytometry analysis (Fig. 4) determined that, after the treatment from myricetin at a concentration of 5.063 µg/100 µl for 24 h, 15.87% of cells showed early apoptosis and 84.11% cells were viable. As illustrated in Table 3, 98.9% of untreated MCF cells were viable. No apoptosis occurred in untreated cells. Furthermore, cells treated with cisplatin showed 47.95% of viable cells and 52.03% of early apoptotic cells (Fig. 5).

Table 3

Percentage of cells showing viable cells, necrotic cells, late apoptotic cells and early apoptotic cells.
Quadrant	Untreated	Cisplatin	MN
Necrosis	0	0	0
Late apoptosis	0	0.02	0.02
Viable cells	98.9	47.95	84.11
Early apoptosis	0	52.03	15.87

3.4 Real-time PCR

In the current study, we investigated the expression of caspase9, caspase7, caspase3 and BCl-2 genes following the treatment of MCF-7 cell line with Myricetin (Fig. 6). The expression of caspase 9 was found to be upregulated by 2.17%, caspase 7 showed 2.06%-fold change, BCl2 showed 1.92%-fold change. Caspase 3 is the most downregulated gene with the fold change of 0.45%.

3.5 Molecular docking

Molecular docking analysis demonstrated that myricetin effectively binds to the BCL-2 protein, with a calculated CDOCKER energy of − 30.52 kcal/mol, indicating a favorable interaction. The binding analysis revealed that myricetin engages with several key amino acids within the BCL-2 binding site, including Lys22, Glu119, Glu111, Ser64, Phe71, Ala72 and Val115 (Fig. 7). Lys22, Glu119 and Glu111 formed 6 conventional hydrogen bonds with myricetin, forming a strong and specific interaction that significantly contributed to the binding affinity. Ser64 was involved in carbon-hydrogen bonds with myricetin, which, although generally weaker than conventional hydrogen bonds, still play a crucial role in stabilizing the myricetin-BCL-2 complex. Additionally, Phe71, Ala72 and Val115 were involved in hydrophobic interactions, further enhancing the stability and specificity of the binding.

One of the most well-known, potentially fatal malignancy is breast cancer. Advances in food and lifestyle are contributing to a significant increase in the morbidity of breast cancer (Arving et al. 2014). In the present study, myricetin exhibits powerful cytotoxic attributes against MCF-7 cell line (Fig. 1). As concentration increased, breast cancer cells viability declined. Our results demonstrated that the IC₅₀ dosage (5.06 µg/100 µl) of myricetin succeeded in preventing the cells from proliferating. Moreover, the investigation by Sajedi et al. (2020) indicated that myricetin depicted a significant impact on MCF-7 cell viability. The concentration of myricetin that substantially decreased cell viability was 54µM. This observation implies that myricetin holds promise as a prospective cancer-fighting compound that targets breast cancer cells. The researchers observed that 54 µM of myricetin reduced the cell viability by intrinsic and extrinsic apoptotic pathways (Sajedi et al. 2020).

The cell cycle comprises of G1, S, G2 (interphase), and M Phase (mitosis). According to our findings, inhibition of cell growth with IC₅₀ (5.06 µg/100 µl) at 24 h presented in Fig. 1 was attributed to the induction of apoptotic activity at sub G₀/G₁ phase. Kumar et al. (2023) employed a unique nano-platform to deliver myricetin by fusing a hydrogel with a cross-linked hydrophilic polymer (CA-Myr-NG) with chitosan/alginate (CA) as the core. With a dosage of 6 µg/ml, 30.92% of treated cells showed apoptosis and cell cycle arrest at the G₂/M phase in MCF-7. Our data revealed that percentages of untreated cells with sub G₀/G₁, G₀/G₁, S-phase and G₂/M phase were determined to be 1.39%, 64.96%, 3.46% and 30.19% respectively; whereas myricetin treated cells were 10.38%, 51.21%, 5.43% and 32.98% respectively (Table 2, Fig. 3). This result confirms that myricetin inhibits cell cycle progression at G₀/G₁-phase and increases the apoptotic cell concentration in sub G₀/G₁ phase.

The study using Annexin V-FITC/PI flow cytometry verified that myricetin caused the MCF-7 cells displayed in Fig. 4 to suffer apoptosis. Since, apoptosis is a monitored and highly controlled process, its occurrence during cancer treatment has attracted a lot of attention. (Fulda 2009). Phospholipid PS, a membrane phospholipid, travels from the inner to the outside leaflet of the plasma membrane in apoptotic cells. This change enables fluorescently labelled annexin V to attach to PS, which may be found using flow cytometry. Propidium iodide(PI) is excluded from intact membranes, but damaged or dead cells are penetrable for PI staining. FITC-conjugated annexin V (FITC-annexin V) staining is therefore usually combined with PI (Nagata et al. 2016). Our findings disclosed that treatment with myricetin for 24 h at IC₅₀ concentration (5.06 µg/100 µl), yielded 15.08% of early apoptotic cells while there was no cell death via necrosis (Table 3). These findings clearly show that myricetin causes MCF-7 cells to undergo early apoptosis.

The qRT-PCR approach was used to investigate the molecular pathways involved in myricetin-induced apoptosis. Caspases 9 activation and an increased BAX/BCl-2 ratio are important factors in the intrinsic route of apoptosis that cause cells to die (Vaskivo et al. 2002). In our study, the mRNA expression of caspase 9, caspase 7, and Bcl-2 was upregulated while caspase 3 was downregulated following treatment with myricetin as shown in Fig. 6. A significant element influencing cell sensitivity to apoptosis-inducing stimuli is the ratio of Bcl-2 to Bax proteins. A number of proteins in the bcl-2 family are essential during cell apoptosis. As a result, Bcl-2 expression levels overall have an impact on the development, course, and prognosis of malignancies (Guo et al. 2015). Our research revealed that myricetin increased the activity of caspase 9, caspase 3, and BCl-2, which in turn hindered the proliferation of MCF-7 cells.

A research investigation found that myricetin promoted apoptosis in the human promyeloleukemic cell line HL-60 by upregulating the activities of caspase3 and caspase9, as well as BAX/BCl2 expression (Wang et al. 1999). Different myricetin doses cause breast cancer cell lines to undergo apoptosis, shown by a specific study conducted on MCF-7 cell lines. Moreover, it was discovered that myricetin increased caspase3 activity and activated the production of the Bax protein (Jiao and Zhang 2016). BCl-2 family proteins regulate a pore in the outer mitochondrial membrane, that allows cytochrome c release during mitochondrial death. This pore also facilitates the activation of caspase9 in apoptotic bodies, which later triggers the activation of the apoptotic effector caspases − 3 and − 7, ultimately resulting in cell apoptosis (Iurlaro and Munoz 2016). Research by Li et al. (2022) provides valuable insights into the dynamic regulation of apoptosis-related genes, specifically highlighting the enhanced expression of caspase3 and the attenuated expression of BCl-2 gene and P53 following the administration of myricetin. In line with this, the molecular docking analysis of the current study showed efficient binding of myricetin to BCL-2, inhibiting its anti-apoptotic activity. These findings open avenues for further exploration into the molecular mechanisms governing programmed cell death and offer potential targets for therapeutic interventions in diseases where apoptosis regulation is dysregulated.

The current study's findings support the notion that myricetin prevents breast cancer cells from proliferating. It was discovered that MCF-7 cell viability decreased in a concentration-dependent manner. According to flow cytometer results, myricetin caused MCF-7 cells to undergo apoptosis; suppressed the progression of the cell cycle during the G₀/G₁-phase, and raised the number of apoptotic cells during the sub-G₀/G₁-phase. Myricetin also stimulates the apoptotic pathway by upregulation of caspase9 and caspase7 in treated MCF-7 cells. The findings presented here demonstrates that Myricetin has a high potential to improve treatment options for incurable diseases like cancer.

MTT: 3- [4, 5-dimethylthiazole-2-yl]-2,5-diphenyltetrazolium bromide

IC50: Half maximal Inhibitory concentration

LPS: Lipopolysaccharide

DMSO: Dimethyl Sulfoxide

PBS: Phosphate buffer saline

qRT-PCR: Real time Quantitative Reverse Transcription PCR

ROS: Reactive Oxygen Species

Annexin V-FITC: Annexin V-Fluorescein isothiocyanate

DMEM: Dulbecco’s Modified Eagle Medium

PI: Propidium Iodide

Author Contribution

"S.K.M and H.R, Concept, manuscript, K.N. and T.N. standardization, wrote the main manuscript text, HPP and KNH, in-silico studies, and A.J. prepared figures 1-3. All authors reviewed the manuscript.

Acknowledgement

Authors acknowledge the facilities provided under mROOTS by Maharani Lakshmi Ammanni College For Women(mLAC). The partial work was carried-out in DST-FIST for PG Level O facility (SR/FST/College-2018-404) and DBT-BIF facility at mLAC.

Arving C, Brandberg Y, Feldman I et al (2014a) Cost-utility analysis of individual psychosocial support interventions for breast cancer patients in a randomized controlled study. Psychooncology 23(3):251–258. https://doi.org/10.1002/pon.3411.
Berman HM, Westbrook J, Feng Z et al (1999) The Protein Data Bank. Nucleic Acids Research 28: 235-242. https://doi.org/10.1093/nar/28.1.235
De Cicco P, Catani MV, Gasperi V et al (2019) Nutrition and Breast Cancer: A Literature Review on Prevention, Treatment and Recurrence. Nutrients 11(7):1514. https://doi.org/10.3390/nu11071514.
Felice MR, Maugeri A, De Sarro G et al (2022) Molecular Pathways Involved in the Anti-Cancer Activity of Flavonols: A Focus on Myricetin and Kaempferol. Int J Mol Sci 23(8):4411. https://doi.org/10.3390/ijms23084411.
Fulda S (2009) Tumor resistance to apoptosis. Int J Cancer 124(3):511–515. https://doi.org/10.1002/ijc.24064
Guo Y, Zhang Y, Yang X et al (2015) Effects of methylglyoxal and glyoxalase I inhibition on breast Cancer cells proliferation, invasion, and apoptosis through modulation of MAPKs, MMP9, and Bcl-2. Cancer Biol Ther 17(2):169–180. https://doi.org/10.1080/15384047.2015.1121346
Hemann MT, Lowe SW (2006) The p53–Bcl-2 connection. Cell Death Differ 13(8):1256–1259. https://doi.org/10.1038/sj.cdd.4401962.
Iqbal J, Abbasi BA, Mahmood T et al (2017) Plant-derived anticancer agents: A green anticancer approach. Asian Pac J Trop Biomed 7:1129–1150. https://doi.org/10.1016/j.apjtb.2017.10.016.
Iurlaro R, Munoz-Pinedo C (2016) Cell death induced by endoplasmic reticulum stress. FEBS J 283(14):2640–2652. https://doi.org/10.1111/febs.13598
Jiao D, Zhang XD (2016) Myricetin suppresses p21-activated kinase 1 in human breast cancer MCF-7 cells through downstream signaling of the β-catenin pathway. - Oncol Rep 36: 342–348. https://doi.org/10.3892/or.2016.4777.
Kim GD (2017) Myricetin Inhibits Angiogenesis by Inducing Apoptosis and Suppressing PI3K/Akt/mTOR Signaling in Endothelial Cells. J Cancer Prev 22(4):219–227. https://doi.org/10.15430/JCP.2017.22.4.219
Kim S, Thiessen PA, Bolton EE et al (2016). PubChem substance and compound databases. Nucleic Acids Research, 44(D1), D1202–D1213. https://doi.org/10.1093/nar/gkv951
Kumar HPP, Dutta S, Usha T et al (2020) Preliminary Phytochemical analysis and antioxidants properties of Myrica nagi-a himalayan jewel. Journal of Critical Reviews 7.
Kumar NSD, Rejeeth Dr. C, Ragunathan SCB et al (2023) Enhanced Drug Delivery, G2/M Cell Cycle Arrest and Apoptosis Induced by Myricetin-Loaded Nanogels in MCF-7 Breast Cancer Cells. Journal of Cluster Science 35:533-544. https://doi.org/10.1007/s10876-023-02497-6.
Li M, Zha G, Chen R et al (2022) Anticancer effects of myricetin derivatives in non-small cell lung cancer in vitro and in vivo. Pharmacol Res Perspect 10(3):e00948. https://doi.org/10.1002/prp2.905
Li M, Chen J, Yu X (2019) Myricetin Suppresses the Propagation of Hepatocellular Carcinoma via Down-Regulating Expression of YAP. Cells 8(4):358. https://doi.org/10.3390/cells8040358.
Middha SK, Goyal AK, Bhardwaj A (2016) In silico exploration of cyclooxygenase inhibitory activity of natural compounds found in Myrica nagi using LC-MS. Symbiosis 70:169–178. https://doi.org/10.1007/s13199-016-0417-8.
Nagata S, Suzuki J, Segawa K et al (2016) Exposure of phosphatidylserine on the cell surface. - Cell Death Differ 23:952–961. https://doi.org/10.1038/cdd.2016.7.
Nishad K, Usha T, Kumar HPP et al (2024) Anti-inflammatory potential of myricetin in leukemia cells: in silico and in vitro exploration. Adv Tradit Med (ADTM). https://doi.org/10.1007/s13596-023-00740-z
Ozben RS, Cansaran-Duman D (2020) The expression profiles of apoptosis-related genes induced usnic acid in SK-BR-3 breast cancer cell. Hum Exp Toxicol 39(11):1497–1506. https://doi.org/10.1177/0960327120930257.
Ravishankar D, Rajora AK, Greco F et al (2013) Flavonoids as prospective compounds for anti-cancer therapy. Int J Biochem Cell Biol 45(12):2821–2831.
Sajedi N, Homayoun M, Mohammadi F et al (2020) Myricetin Exerts its Apoptotic Effects on MCF-7 Breast Cancer Cells through Evoking the BRCA1-GADD45 Pathway. Asian Pac J Cancer Prev 21(12):3461–3468. https://doi.org/10.31557/APJCP.2020.21.12.3461.
Sever R, Brugge JS (2015) Signal Transduction in Cancer. Cold Spring Harbor Perspectives in Medicine 5(4). https://doi.org/10.1101/cshperspect.a006098
Seca AML, Pinto DCGA (2018) Plant Secondary Metabolites as Anticancer Agents: Successes in Clinical Trials and Therapeutic Application. Int J Mol Sci 19:263. https://doi.org/10.3390/ijms19010263.
Singh R, Letai A, Sarosiek K (2019) Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nat Rev Mol Cell Biol 20(3):175-193.
Sung H, Ferlay J, Siegel RL et al (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71(3):209–249. https://doi.org/10.3322/caac.21660
Torre LA, Islami F, Siegel RL et al (2017) Global Cancer in Women: Burden and Trends. Cancer Epidemiol Biomarkers Prev 26(4):444–457. https://doi.org/10.1158/1055-9965.EPI-16-0858
Vaskivuo TE, Stenback F, Tapanainen JS (2002) Apoptosis and apoptosis-related factors Bcl-2, Bax, tumor necrosis factor-alpha, and NF-kappaB in human endometrial hyperplasia and carcinoma. Cancer 95:1463–1471
Wang IK, Lin-Shiau SY, Lin JK (1999) Induction of apoptosis by apigenin and related flavonoids through cytochrome c release and activation of caspase-9 and caspase-3 in leukaemia HL-60 cells. Eur J Cancer 35(10):1517–1525.
Yang C, Trent S, Ionescu-Tiba V et al (2006) Identification of cyclin D1- and estrogen-regulated genes contributing to breast carcinogenesis and progression. Cancer Res 66(24):11649–11658. https://doi.org/10.1158/0008-5472.CAN-06-1645.
Ye C, Zhang C, Huang H et al (2018) The Natural Compound Myricetin Effectively Represses the Malignant Progression of Prostate Cancer by Inhibiting PIM1 and Disrupting the PIM1/CXCR4 Interaction. Cell Physiol Biochem 48(3):1230–1244. https://doi.org/10.1159/000492009.

No competing interests reported.

Download PDF

Submission checks completed at journal
14 Oct, 2024
First submitted to journal
10 Oct, 2024

You are reading this latest preprint version

Exploring Mechanistic Insights and Apoptotic Gene Expression Induced by Myricetin Through In-Vitro and In-Silico Approaches

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material and methods

2.1 Cell-culture

2.2 Determining the myricetin IC₅₀ dosage by MTT Assay

2.3 Flow cytometric analysis with Annexin-V staining

2.4 Cell cycle Analysis

2.5 Real-Time PCR

2.6 In silico Docking

2.7 Statistical analysis

3 Results

3.1 MTT Assay

3.2 Cell cycle

3.3 Effect of Myricetin on MCF-7 Cells Apoptosis

3.4 Real-time PCR

3.5 Molecular docking

4 Discussion

5 Conclusion

Abbreviations

Declarations

Author Contribution

Acknowledgement

References

Additional Declarations

Status:

Version 1

Exploring Mechanistic Insights and Apoptotic Gene Expression Induced by Myricetin Through In-Vitro and In-Silico Approaches

Status:

Version 1

Abstract

Figures

1 Introduction

2 Material and methods

2.1 Cell-culture

2.2 Determining the myricetin IC50 dosage by MTT Assay

2.3 Flow cytometric analysis with Annexin-V staining

2.4 Cell cycle Analysis

2.5 Real-Time PCR

2.6 In silico Docking

2.7 Statistical analysis

3 Results

3.1 MTT Assay

3.2 Cell cycle

3.3 Effect of Myricetin on MCF-7 Cells Apoptosis

3.4 Real-time PCR

3.5 Molecular docking

4 Discussion

5 Conclusion

Abbreviations

Declarations

Author Contribution

Acknowledgement

References

Additional Declarations

Status:

Version 1

2.2 Determining the myricetin IC₅₀ dosage by MTT Assay