The discovery and molecular mechanism of the subversion of human E3 ligase RNF213 by the Shigella effector IpaH1.4

doi:10.21203/rs.3.rs-5246079/v1

Download PDF

Article

The discovery and molecular mechanism of the subversion of human E3 ligase RNF213 by the Shigella effector IpaH1.4

https://doi.org/10.21203/rs.3.rs-5246079/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ubiquitination plays vital roles in modulating pathogen-host cell interactions. RNF213, a unique E3 ligase, can catalyze the ubiquitination of lipopolysaccharide (LPS) and is crucial for antibacterial immunity in mammals. Shigella flexneri, an LPS-containing pathogenic bacterium, has developed mechanisms to evade host antibacterial defenses during infection. However, the precise strategies by which S. flexneri circumvents RNF213-mediated antibacterial immunity remain poorly understood. Here, through comprehensive biochemical, structural and cellular analyses, we reveal that the E3 effector IpaH1.4 of S. flexneri can directly target human RNF213 via a specific interaction between the IpaH1.4 LRR domain and the RING domain of RNF213, and mediate the ubiquitination and proteasomal degradation of RNF213 in cells. Furthermore, we determine the cryo-EM structure of human RNF213 and the crystal structure of the IpaH1.4 LRR/RNF213 RING complex, elucidating the molecular mechanism underlying the specific recognition of RNF213 by IpaH1.4. Finally, our cell-based function asaays demonstrate that the targeting of host RNF213 by IpaH1.4 promotes S. flexneri proliferation within infected cells. In summary, our work uncovers a novel strategy employed by S. flexneri to subvert the key host immune factor RNF213, thereby facilitating bacterial proliferation during invasion.

Biological sciences/Structural biology/X-ray crystallography/Nanocrystallography

Biological sciences/Microbiology/Bacteria/Bacterial immune evasion

Biological sciences/Structural biology/Electron microscopy/Cryoelectron microscopy

Biological sciences/Biochemistry/Proteins/Ubiquitins

RNF213

IpaH1.4

Ubiquitination

Shigella

pathogen-host interactions

Ubiquitination is one of the most important and versatile post-translational modifications in mammals, which involves the covalent attachment of ubiquitin to a specific target substrate, a process mediated by a cascade of three different enzymes including an E1 activating enzyme, an E2 conjugating enzyme, and an E3 ligase^1–4. Notably, in addition to conventional protein substrates, non-proteinaceous substrates, such as lipopolysaccharide (LPS), relevant sugars and nucleotides, are also found to be modified by ubiquitination^5–7. Ubiquitination plays essential roles in a multitude of cellular processes, such as proteasomal degradation, DNA repair, signal transduction, autophagy and immune responses^2,3,8–10. Particularly, in ubiquitination-mediated antimicrobial selective autophagy (also named as xenophagy)¹¹, the host immune system can utilize specific E3 ligases to mark intracellular invading pathogens with ubiquitin molecules, which are subsequently recognized by ubiquitin-binding autophagy receptors, such as Optineurin, p62, and NDP52^12–17, thereby guiding the pathogens for autophagic degradation to prevent infection spread^18–20. Moreover, ubiquitination is widely involved in activating innate immune pathways, such as the NF-κB pathway, which promotes the expression of antimicrobial peptides and cytokines to restrict the proliferation of invading pathogens^21–23. This dual role of ubiquitination, both in tagging pathogens for autophagic degradation and promoting inflammatory responses, positions it as a key regulator in host immune defenses against a wide range of microbial invaders²⁴.

RNF213 is a giant multifunctional E3 ligase containing more than 5,000 amino acids, and is the only known protein possessing both AAA + ATPase and E3 ligase activities in human proteome^25,26. RNF213 was first identified as a susceptibility gene for Moyamoya disease (MMD), a rare cerebrovascular disorder characterized by progressive stenosis of the cerebral arteries^27,28. RNF213 has been demonstrated to influence angiogenesis and vascular remodeling, although its precise molecular function in vascular development is still under investigation^26,29. In addition, RNF213 is also reported to serve as a positive regulator of lipid droplets³⁰, which are cellular lipid storage organelles and play vital roles in the regulation of inflammation and immunity^31,32. Recently, RNF213 is implicated in the regulation of antimicrobial immunity, and has emerged as a key player to combat various invasive pathogens, including viruses, bacteria, parasites, and chlamydiae^5,33–37. Particularly, RNF213 can directly mediate the ubiquitination of bacterial LPS on the surface of Salmonella Typhimurium, and recruit the linear ubiquitin chain assembly complex (LUBAC), a key E3 ligase complex capable of catalyzing linear ubiquitination, to trigger downstream antimicrobial selective autophagy and cellular autonomic immunity for eliminating invading bacteria⁵. Given the critical roles of RNF213 in host antibacterial immunity, whether RNF213 might be targeted and hijacked by LPS-containing bacterial pathogens remains an open question.

S. flexneri is a type of LPS-containing gram-negative bacterial pathogen. It is the leading cause of shigellosis, and causes over million infection cases and large human deaths world-wide annually^38,39. Interestingly, S. flexneri has evolved different strategies to evade ubiquitination-mediated host immune defenses during infection^40–45. Particularly, S. flexneri can secret relevant IpaH family E3 effectors to exploit the host's ubiquitination system to promote the ubiquitination and subsequent degradation of key host proteins essential for ubiquitination-mediated antibacterial responses^42,44,46. IpaH family E3 effector of S. flexneri contains a conserved C-terminal catalytic novel E3 ligase (NEL) domain and a unique N-terminal substrate-binding leucine-rich repeat (LRR) domain that confers specificity for targeting different host substrates^47,48. For instance, IpaH9.8 can directly target NEMO, a key ubiquitin-binding adaptor of the NF-κB signaling pathway, thereby inhibiting pro-inflammatory cytokine production and diminishing the host's inflammatory response⁴². Moreover, two highly similar IpaH family E3 effectors, IpaH1.4 and IpaH2.5, are recently demonstrated to suppress NF-κB activation and antimicrobial selective autophagy by targeting LUBAC^44,49. However, whether there are other host proteins critical for antibacterial immunity could be targeted by S. flexneri IpaH1.4 is still largely unknown.

In this study, by using IpaH1.4 as a bait via an affinity purification coupled with mass spectrometric analysis, we firstly discover that IpaH1.4 can associate with human RNF213. Subsequently, we demonstrate that IpaH1.4 can directly interact with human RNF213, and mediate the ubiquitination and proteasomal degradation of RNF213 in cells. Further biochemical, cryogenic electron microscopy (cryo-EM) and X-ray crystallography analyses uncover that IpaH1.4 can specifically recognize the RING domain of RNF213 through its LRR domain. Importantly, the determined cryo-EM structure of human RNF213 and the crystal structure of the IpaH1.4 LRR/RNF213 RING complex not only elucidate the molecular mechanism by which IpaH1.4 specifically target RNF213, but also uncover that the binding of IpaH1.4 to RNF213 should inhibit the E3 ligase activity of RNF213 RING by blocking its E2-binding. Finally, our relevant cell-based infection assays demonstrate that the targeting of RNF213 by IpaH1.4 facilitates the proliferation of S. flexneri in host cells. Taken together, our work uncovers that S. flexneri can adopt IpaH1.4 to directly target and subvert host RNF213, thereby escaping from RNF213-mediated host immune defenses to facilitate its proliferation in infected host cells.

The identification of RNF213 as a host targeting protein of S. flexneri IpaH1.4

In order to investigate whether there are additional host proteins might be targeted by IpaH1.4 during the invasion of S. flexneri, we performed a biochemical affinity purification coupled with mass spectrometric analysis-based assay to identify novel IpaH1.4-binding proteins in HEK293F cells (Fig. 1a). The FLAG-tagged catalytically inactive IpaH1.4 C368A mutant and the substrate-binding LRR domain of IpaH1.4 were individually overexpressed in HEK293F cells, and then were enriched and pulled down via anti-FLAG beads. Subsequently, the related human proteins that can associate with the two IpaH1.4 proteins were detected by mass spectrometric-based analysis. One of the identified strongest candidates for potentially binding to IpaH1.4 was the giant human E3 ligase RNF213 (Fig. 1b), which was recently demonstrated to function as a key player in antibacterial immunity^5,26. To confirm the potential interaction between IpaH1.4 and RNF213, we firstly performed relevant GST pull-down assays, which showed that the GST-tagged IpaH1.4 but not the GST tag can interact with the full-length RNF213 (Fig. 1c). Further co-immunoprecipitation (Co-IP) assays confirmed that the full-length RNF213 and the RNF213(371–5207) fragment that lacks the N-terminal highly un-conserved and intrinsically disordered region of RNF213 based on our sequence analyses (Supplementary Fig. 1a, b), can well interact with IpaH1.4 in co-transfected cells (Fig. 1d). To further confirm the direct interaction between RNF213 and IpaH1.4, we sought to purify full-length RNF213 proteins to conduct relevant biochemical assays. However, the purified full-length RNF213 proteins from HEK293F cells tend to form large aggregates and display poor homogeneity (Supplementary Fig. 2a, b), preventing further detailed biochemical and structural characterizations. Fortunately, the purified RNF213(371–5207) fragment, which can still well interact with intracellular IpaH1.4 (Fig. 1d), is homogeneous monomer in solution based on our multi-angle light scattering (MALS) analysis (Supplementary Fig. 2c). Importantly, using size exclusion chromatography (SEC)-based assays with purified RNF213(371–5207) and the full-length IpaH1.4 proteins, we demonstrated that IpaH1.4 can directly interact with RNF213 (Fig. 1e).

The ubiquitination and proteasomal degradation of RNF213 mediated by IpaH1.4

Given that the IpaH family members can induce the degradation of their targeting substrates via ubiquitin-proteasome system (UPS), we wondered whether IpaH1.4 could mediate the ubiquitination and proteasome degradation of RNF213. Using relevant in vitro ubiquitination assays with the purified catalytically inactive C4516A mutant of RNF213(371–5207), which loses the E3 enzymatic activity of its RZF domain and cannot undergo auto-ubiquitination, we revealed that IpaH1.4 can directly catalyze the ubiquitination of RNF213 in vitro (Fig. 2a, b). Importantly, the ubiquitination of RNF213 catalyzed by IpaH1.4 requires the presences of ATP, UBA1 (E1), UBE2L3 (E2) and IpaH1.4 (E3) (Fig. 2a), confirming that the ubiquitination of RNF213 by IpaH1.4 is through a canonical mode of ubiquitination modification. Further mass spectrometry analysis revealed that there are multiple ubiquitin modification sites on RNF213(371–5207) catalyzed by IpaH1.4 (Fig. 2c and Supplementary Fig. 2d), all of which located in the E3 module of RNF213 (Supplementary Fig. 2e). Notably, S. flexneri contains two strikingly similar IpaH family effectors IpaH1.4 and IpaH2.5^44,49, which have only two residues different in their substrate-binding LRR domains (Supplementary Fig. 3a). Not surprisingly, based on our in vitro ubiquitination assays, RNF213 can be effectively ubiquitinated by IpaH2.5 (Supplementary Fig. 3b), suggesting that both IpaH1.4 and IpaH2.5 can directly target host RNF213. Importantly, despite the E3 activity of RNF213 contributes to the host immune response during pathogenic infections⁵, the enzymatically active RNF213 was incapable to ubiquitinate IpaH1.4 conversely in vitro (Supplementary Fig. 4a, b). To further elucidate the type of ubiquitin modification on RNF213 catalyzed by IpaH1.4, we constructed 9 different ubiquitin mutants, which contains additional N-terminal extension sequences and/or specific mutations by replacing relevant lysine residues of ubiquitin with arginine residues (Supplementary Fig. 4c). Further in vitro ubiquitination assays revealed that IpaH1.4 mainly catalyzes the K48-linked ubiquitination on RNF213 in vitro (Supplementary Fig. 4d), similar to other IpaH family proteins⁴⁷. In line with our biochemical results and the fact that K48-linked polyubiquitin is a signal for proteasomal degradation, when co-expression of Aequorea coerulescens GFP-tagged (AcGFP) RNF213(371–5207) with relevant IpaH1.4 proteins in HeLa cells, the wild type IpaH1.4 but not the enzymatically inactive C368A mutant or the NEL domain of IpaH1.4 can significantly decrease the cellular protein level of RNF213(371–5207) in the absence of proteasomal inhibitor MG132 (Fig. 2d). Importantly, expression of the wild type IpaH1.4 rather than the E3-dead C368A mutant of IpaH1.4 in HeLa cells can induce the degradation of endogenous RNF213 (Fig. 2e).

To further investigate whether RNF213 is a physiological substrate of IpaH1.4/2.5 during S. flexneri invasion, we firstly generated an RNF213-knockout HeLa cell line using CRISPR-Cas9 technology (Supplementary Fig. 5a, b). Then, RNF213-knockout HeLa cells were transfected with relevant passer transposon system to generate a stable cell line expressing AcGFP-tagged wild-type RNF213 (Supplementary Fig. 5c, d). Subsequently, we infected the AcGFP-RNF213 stable HeLa cells with the wild-type S. flexneri M90T strain or the ipaH1.4/ipaH2.5 double knock-out (ΔipaH1.4/ΔipaH2.5) S. flexneri strain generated in our previous study⁴⁹. As expected, intracellular AcGFP-RNF213 signals can be well detected in cells infected with the S. flexneri ΔipaH1.4/ΔipaH2.5 strain, especially on the surface of invaded bacteria, while they are barely detectable in cells infected with the wild-type S. flexneri (Fig. 2f-h). Consistently, obvious ubiquitin-coat on the surface of invading bacteria can be observed in cells infected with the S. flexneri ΔipaH1.4/ΔipaH2.5 strain but not the wild-type S. flexneri (Fig. 2f, g, and i). Given that RNF213 can directly mediate the ubiquitination of LPS on the surface of invading Salmonella⁵, these data suggested that S. flexneri can utilize its effector IpaH1.4 and IpaH2.5 to eliminate host RNF213 during invasion, thereby helping S. flexneri to escape from being marked by ubiquitination as well as related downstream antibacterial immune processes.

The cryo-EM structure of human RNF213

To elucidate the molecular basis underlying the specific recognition of RNF213 by IpaH1.4, we firstly purified the RNF213(371–5207)/IpaH1.4 complex by mixing excess amounts of IpaH1.4 with human RNF213(371–5207) followed by SEC-based separation (Supplementary Fig. 6a and b). The purified RNF213(371–5207)/IpaH1.4 complex exhibited reasonable homogeneity based on our negative staining electron microscopy analysis (Supplementary Fig. 6c). Subsequently, using the cryo-EM method, we obtained the final consensus density map of the RNF213(371–5207)/IpaH1.4 complex to an overall resolution of 3.46 Å (Supplementary Fig. 7a-c and Supplementary Table 1). Unfortunately, based on the solved cryo-EM density map, we could only build a high-confidence model of RNF213, which mainly contains five structural segments, the N-terminal stalk, the middle six AAA units-containing AAA ring, the C-terminal multi-domain E3 module, and the stalk/AAA ring-connecting linker as well as the AAA ring/E3 module-connecting hinge (Fig. 3a-c). Similar to previously determined cryo-EM structure of mouse RNF213⁵⁰, human RNF213 folds into a compact zig-zag conformation from its N-terminal stalk to the C-terminal CTD (Fig. 3a-c). Notably, the E3 module of human RNF213 is composed of six sub-domains, namely back, RING, shell, RZF, core and CTD, and has direct contacts with the stalk and AAA ring modules through its back and CTD, respectively (Fig. 3a-c). The RING domain swinging between the E3 back and E3 shell was previously thought to be the only domain with E3 enzymatic activity just like other RING-type E3 ligases^51,52, however recent studies well demonstrated that RNF213 can also perform its E3 ligase function in a RING-independent manner⁵. Particularly, RNF213 can directly ubiquitylate LPS on the surface of invading Salmonella through its active C4516 residue within the RZF domain⁵. Notably, the electron densities of the RING and RZF regions are relatively weak, likely owing to their conformational flexibilities (Fig. 3b). Further detailed structural analyses revealed that, among the six AAA units of RNF213, only AAA3 and AAA4 harbor all the essential catalytic residues and functional motifs for exerting ATP-binding and ATP-hydrolysis (Supplementary Fig. 8), while the AAA1, AAA5, and AAA6 are completely inactive due to the lack of relevant key structural elements (Supplementary Fig. 8a, e, f). Intriguingly, in the cryo-EM structure of human RNF213, the AAA2 of RNF213 contains a well defined ATP molecule, but lacks the catalytic arginine finger for ATP hydrolysis (Supplementary Fig. 8b and Fig. 3b, c), suggesting that it is catalytically incompetent, in line with a previous study⁵⁰. Moreover, there is a unique insertion existed between the AAA2 and AAA3 of RNF213 (Fig. 3a-c). Further structural comparison analyses showed that the overall structure of human RNF213 is very similar to that of previously determined the apo-form mouse RNF213⁵⁰, however the relative orientation and gap between the N-terminal segment of stalk and the E3 module of human RNF213 is very different from that of mouse RNF213 (Supplementary Fig. 9a-f). In addition, the density map of the RZF domain within the E3 module of human RNF213 is much better than that of mouse RNF213 (Supplementary Fig. 9g-i).

IpaH1.4 recognizes the RING domain of RNF213 through its LRR domain

After fitting the whole RNF213 structure model into the cryo-EM density map, we found an extra weak density around the RING domain of RNF213, which does not belong to RNF213 but can be partially matched with the IpaH1.4 LRR domain (Supplementary Fig. 10). Further local refinement focusing around the RNF213 E3 module resulted in a local density map with a much improved resolution for fitting the IpaH1.4 LRR domain (Fig. 3d, e and Supplementary Fig. 7). Based on the refined local density map, IpaH1.4 LRR can directly bind to the RING domain of RNF213 through its concave side (Fig. 3d and e). However, due to the low resolution of the local density map, we were unable to observe the detailed interactions between interface residues of RNF213 RING and IpaH1.4 LRR. Moreover, we also could not identify any density belonging to the IpaH1.4 NEL domain, likely due to its dynamic nature for facilitating its ubiquitination on multiple sites of RNF213. Importantly, consistent with our structural data, when mapping aforementioned MS-identified ubiquitination sites of RNF213 onto the cryo-EM structure of RNF213, we found that they are all adjacent to RNF213 RING and are reachable for the IpaH1.4 NEL domain (Supplementary Figs. 2d and 11a-c).

Using SEC-based biochemical assays, we further confirmed that the isolated RNF213 RING (residues 3990–4056) can directly interact with the IpaH1.4 LRR domain (residues 38–273) (Fig. 4a). In addition, quantitative isothermal titration calorimetry (ITC) analysis uncovered that IpaH1.4 LRR binds to RNF213 RING with a dissociation constant (K_D) value of ∼0.18 µM (Fig. 4b). Consistent with our cryo-EM data, further analytical ultracentrifugation-based assay revealed that RNF213 RING and IpaH1.4 LRR can associate with each other to form a stable 1:1 stoichiometric complex in solution (Fig. 4c).

The crystal structure of RNF213 RING in complex with the LRR domain of IpaH1.4

In order to elucidate the detailed binding mode between RNF213 RING and IpaH1.4 LRR, we solved the complex structure of RNF213 RING and IpaH1.4 LRR to 1.70 Å resolution using X-ray crystallographic method (Supplementary Table 2). As expected, in the RNF213 RING/IpaH1.4 LRR complex structure, IpaH1.4 LRR forms a horseshoe-shape fold, and directly binds to RNF213 RING through its concave side (Fig. 4d). No significant structural changes can be observed in the IpaH1.4 LRR domain upon its binding to RNF213 RING (Supplementary Fig. 12a). Concurrently, in the complex structure, RNF213 RING that mainly consists of one N-terminal α-helix followed by two short C-terminal antiparallel β-strands, adopts a unique architecture containing two Zn²⁺ ions to engage with the β4 to β9 leucine-rich repeat region of IpaH1.4 LRR, burying a total surface area of ∼693 Å² (Fig. 4d). Further structural comparison analyses revealed that the overall structure of human RNF213 RING in the RNF213 RING/IpaH1.4 LRR complex is similar to that of the apo-form mouse RNF213 RING (Supplementary Fig. 12b), and the overall binding mode of IpaH1.4 LRR with RNF213 RING resembles that of the IpaH1.4 LRR/HOIP RING1 and IpaH1.4 LRR/HOIL-1L UBL interactions (Supplementary Fig. 12c-e).

Detailed structural analysis of the RNF213 RING/IpaH1.4 LRR complex unravelled that the specific interaction between IpaH1.4 LRR and RNF213 RING is mediated by both hydrophobic contacts and polar interactions (Fig. 4e and Supplementary Fig. 13a, b). Specifically, the hydrophobic side chains of I3999, W4024 and L4036 of RNF213 RING form hydrophobic contacts with the hydrophobic side chains of L175, V177, A197, A199, V217, M219, and F238 as well as the aliphatic side chain groups of R215 from IpaH1.4 LRR (Fig. 4e and Supplementary Fig. 13a). In parallel, the positively charged side chain of K100 in IpaH1.4 LRR forms a salt bridge with the negatively charged side chain of D4013 from RNF213 RING (Fig. 4e and Supplementary Fig. 13b). Concurrently, the side chains of D140, N200 and R215 in IpaH1.4 LRR form three hydrogen bonds with the side chains of H4014, Y4034 and Q4029 in RNF213 RING (Fig. 4e). In addition, the side chains of R157, S179, N200, and N220 residues of IpaH1.4 LRR couple with the backbone carboxyl groups of S3998, I3999, Y4034, C4035, and L4036 from RNF213 RING to form six specific hydrogen bonds (Fig. 4e). Using site-directed mutagenesis-based biochemical assays, we further validated the specific interactions between RNF213 RING and IpaH1.4 LRR found in the complex structure. In keeping with our structural data, mutations of key binding interface residues either from IpaH1.4 LRR or RNF213 RING, such as the R157A, A197R, R215E and R157A/R215E mutations of IpaH1.4 LRR or the D4013R, Q4029A, Y4034A, and L4036R mutations of RNF213 RING, all significantly reduced or essentially abolished the interaction of RNF213 RING with IpaH1.4 LRR in our ITC-based assays (Fig. 4f and Supplementary Fig. 14a-h). In agreement with our aforementioned biochemical and structural results, further in vitro ubiquitination assays proved that mutations of key interface residues of IpaH1.4 or RNF213, such as the A197R mutation of IpaH1.4 or the L4036R mutation of RNF213 C4516A, largely attenuate or completely disrupt the ubiquitination of RNF213 imposed by IpaH1.4 (Fig. 4g and h). Concomitantly, the A197R mutation of IpaH1.4 or the L4036R mutation of RNF213(371–5207) can effectively dampen the IpaH1.4-induced degradation of cellular AcGFP-RNF213(371–5207) in co-transfected cells (Fig. 4I). Notably, the key interface residues of IpaH1.4 LRR for recognizing RNF213 can be also found in IpaH2.5 but are absence in other S. flexneri IpaH family proteins or S. typhimurium effector SspH1 and SspH2 (Supplementary Fig. 15). Thus, IpaH1.4 and IpaH2.5 are the only two members in the IpaH family that can specifically target RNF213.

IpaH1.4 can be recruited to the RNF213-coat decorated on cellular lipid droplets through the specific RNF213 RING/IpaH1.4 LRR interaction

Previous studies well demonstrated that RNF213 directly participates in the lipid droplet (LD) formation, and can form toroidal patterns decorated on the surface of intracellular LDs, when cells are treated with oleic acid (OA)³⁰. Consistently, the OA-treatment of the AcGFP-RNF213 stable HeLa cells can induce the intracellular toroidal pattern formation of RNF213 surrounded LDs (Supplementary Fig. 16). To further validate whether IpaH1.4 can directly target RNF213 under physiological conditions, we also generated a specific cell line from RNF213-knockout HeLa cells with a stable expression of the RNF213 L4036R mutant, which was proved to be unable to interact with IpaH1.4 (Fig. 4f, h, and I). Then, we over-expressed the mCherry-tagged E3-dead IpaH1.4 C368A mutant, relevant IpaH1.4 variants, or the control mCherry tag in the AcGFP-RNF213 or AcGFP-RNF213 L4036R stable cell lines, which were further treated with OA to induce cellular LD formations (Fig. 5a-e). As expected, the mCherry-tagged IpaH1.4 C368A but not the mCherry tag in the transfected AcGFP-RNF213 stable cells exhibited an obvious enrichment on the RNF213-coated LDs in the cytoplasm (Fig. 5a and f), suggesting that RNF213 can effectively recruit IpaH1.4 to cellular LDs. In contrast, the R157A/R215E/C368A and A197R/C368A mutants of IpaH1.4, both of which were demonstrated to lose their abilities to interact with RNF213 (Fig. 4f and g), were essentially unable to co-localize with the RNF213-coat on the surface of LDs in the transfected AcGFP-RNF213 stable cells (Fig. 5b, c and f). Conversely, the RNF213 L4036R-coat surrounded LDs was unable to recruit IpaH1.4 C368A in the transfected AcGFP-RNF213 L4036R stable cells (Fig. 5d and f). Taken together, these data clearly demonstrated that the specific RNF213 RING/IpaH1.4 LRR interaction is essential for the cellular targeting of IpaH1.4 to the RNF213-coat decorated on lipid droplets.

Targeting of RNF213 by IpaH1.4 facilitates the proliferation of S. flexneri in host cells

To further investigate the impact of the RNF213 RING/IpaH1.4 LRR interaction towards bacteria proliferation during S. flexneri invasion, we utilized the ipaH1.4/ipaH2.5 double-knockout (ΔipaH1.4/ΔipaH2.5) S. flexneri strain and rescued it with the wild type ipaH1.4 gene or relevant different ipaH1.4 mutant gene (the R157A/R215E, A197R or C368A mutant of IpaH1.4). Then, we performed infection experiments in the wild type or RNF213-knockout HeLa cells using these S. flexneri strains. The results showed that the lack of RNF213 facilitates the invasion of wild type S. flexneri but not S. flexneri ΔipaH1.4/ΔipaH2.5 (Supplementary Fig. 17a), suggesting that RNF213 can restrain the infection of S. flexneri and is likely one of the targets of IpaH1.4/2.5 in host cells. Importantly, comparing with that of the wild type S. flexneri, the proliferation of S. flexneri ΔipaH1.4/ΔipaH2.5 stain in the wild type HeLa cells was largely attenuated (Fig. 5g). However, the deficiency of RNF213 facilitates the replication of both wild type S. flexneri and S. flexneri ΔipaH1.4/ΔipaH2.5 in infected RNF213-knockout cells (Fig. 5g). These findings strongly suggested that S. flexneri relies on IpaH1.4/2.5 to target RNF213 thereby promoting its proliferation in infected host cells. Consistently, although S. flexneri ΔipaH1.4/ΔipaH2.5 strain rescued with the ipaH1.4 R157A/R215E or A197R mutant has a similar infective activity towards the wild type HeLa cells as that of S. flexneri rescued with the wild type ipaH1.4 (Supplementary Fig. 17b), the proliferation of S. flexneri rescued with ipaH1.4 R157A/R215E, or A197R in the infected cells was largely reduced compared with that of S. flexneri rescued with the wild type ipaH1.4 (Fig. 5h), confirming that the targeting of RNF213 by IpaH1.4 is critical for promoting the proliferation of S. flexneri in host cells. Intriguingly, S. flexneri rescued with E3-dead ipaH1.4 C368A shows a much lower infective activity than that of S. flexneri rescued with the wild type ipaH1.4, the ipaH1.4 R157A/R215E mutant, or the ipaH1.4 A197R mutant (Supplementary Fig. 17b), implying that the E3 activity of IpaH1.4 contributes to the infection of S. flexneri and there are other host targets of IpaH1.4 except for RNF213, in line with previous studies^44,49,53. Notably, our quantitative RT-PCR analyses revealed that the transcription levels of RNF213 in host cells are not significantly changed during the infection of S. flexneri (Supplementary Fig. 17c and d). Taken together, all these data well demonstrated that RNF213 can restrain S. flexneri proliferation in infected host cells, but S. flexneri can secrete E3 effector IpaH1.4/2.5 to specifically target and subvert RNF213, thereby facilitating its proliferation during invasion.

In this study, through comprehensive biochemical, structural and functional characterizations, we demonstrated that the S. flexneri effector IpaH1.4 can directly bind to the RING domain of the host immune sensor RNF213 through its substrate-binding LRR domain, and induces the K48-linked ubiquitination as well as the proteasomal degradation of RNF213, thereby helping S. flexneri escape from the RNF213-mediated ubiquitylation of LPS on its surface as well as the downstream antimicrobial processes to facilitate its proliferation in host cells. Based on the cryo-EM structure of RNF213 and the crystal structure of the RNF213 RING/IpaH1.4 LRR complex, we elucidated the detailed binding mechanism of IpaH1.4 with RNF213, and obtained an intact structure model for the RNF213/IpaH1.4 LRR complex, in which IpaH1.4 LRR specifically recognizes RNF213 via binding to its RING domain (Supplementary Fig. 18). Thus, in addition to the two LUBAC subunits, HOIP and HOIL-1L^44,49, the key immune factor RNF213 of host cells can be also directly targeted and hijacked by IpaH1.4 during S. flexneri invasion. Notably, based on a previous report⁵, RNF213 works in the upstream of LUBAC during antibacterial immune processes. Interestingly, our structural comparison analysis revealed that the binding interfaces of IpaH1.4 LRR for interacting with RNF213 RING, HOIP RING1, and HOIL-1L UBL are different but highly overlapped (Supplementary Fig. 19), suggesting that RNF213, HOIP and HOIL-1L should be competitive in binding to IpaH1.4. Based on our ITC results in this study and a previous report⁴⁹, the binding affinity of IpaH1.4 LRR for HOIP RING1 (K_D ~1.0 µM) or HOIL-1L UBL (K_D ~10.7 µM) is much weaker than that for RNF213 RING (K_D ~0.18 µM), therefore the upstream RNF213 rather than the downstream LUBAC was more likely to be firstly targeted by IpaH1.4 during S. flexneri invasion. Moreover, it is well established that cellular LDs play important roles in host defense^54,55, and RNF213 can physically associate with LDs and promote LD formation⁵⁶. In this study, we elucidated that IpaH1.4 can directly target the RNF213-coat on LDs. Therefore, our findings in this work also implied that IpaH1.4 may suppress LD-mediated antimicrobial process via hijacking RNF213.

Previous studies well demonstrated that both RING domains of RNF213 and the RING-type E3 ligase RNF4 can specifically collaborate with the E2 enzyme UBE2N to conduct relevant K63-linked ubiquitination^51,57. Our structural alignment analysis of the RNF213 RING/IpaH1.4 LRR complex and the RNF4 RING/UBE2N ~ Ub/UBE2V1 complex (PDB ID: 5AIT) revealed that IpaH1.4 LRR and UBE2N should be mutually exclusive in binding to the RING domain of RNF213, due to the potential steric exclusion (Supplementary Fig. 20). Therefore, in addition to triggering the K48-linked ubiquitination of RNF213 for proteasomal degradation, IpaH1.4 should also inhibit the E3 ligase activity of RNF213 RING by blocking its E2-binding. Notably, similar tactics were adopted by IpaH1.4 to hijack the host RBR-type E3 ligase HOIP⁴⁹. Interestingly, although the RNF213-mediated ubiquitylation of LPS on invaded bacteria is independent of the RING domain of RNF213⁵, many Moyamoya disease-associated mutations of RNF213 are found to locate in the RING domain, underscoring the critical role of RNF213 RING for human physiology⁵⁰. However, the precise function of the RNF213 RING domain remains to be elucidated in the future.

Primates are the natural reservoirs of S. flexneri, while mice show million-fold higher doses of resisting S. flexneri infection⁵⁸. Interestingly, our sequence alignment analysis showed that all the key binding interface residues of RNF213 RING for interacting with IpaH1.4 LRR are highly conserved during evolution, including mouse (Supplementary Fig. 21a), suggested that mouse RNF213 should be also targeted by S. flexneri IpaH1.4. Using SEC and ITC-based analyses, we further confirmed the direct interaction between mouse RNF213 RING and IpaH1.4 LRR (Supplementary Fig. 21b and c). Therefore, the binding of IpaH1.4 to RNF213 RING is highly likely to be a general mechanism adopted by S. flexneri during invasion of different mammals. In the future, it will be interesting to know how mice can tolerate such high doses of S. flexneri infection.

Finally, based on our findings in this work and previous reports^5,44,49, we proposed a model depicting the targeting and subversion of host RNF213 by S. flexneri effector IpaH1.4/2.5 as well as the counteraction of S. flexneri with the relevant RNF213-mediated host antibacterial processes during invasion (Supplementary Fig. 22). In this model, once S. flexneri invades the cytosol of a host cell, its LPS molecules on the outer membrane will be specifically recognized by RNF213, which can further mediate the ubiquitylation of LPS and in turn recruit LUBAC to mediate the linear ubiquitination on the invading bacterial surface (Supplementary Fig. 22). Then, relevant downstream linear ubiquitin-binding proteins, such as NEMO and Optineurin, will be recruited to trigger inflammation and antibacterial selective autophagy processes to suppress replication of invading bacteria in the host cell (Supplementary Fig. 22). However, S. flexneri can secrete the E3 effector IpaH1.4/2.5 to directly target and hijack RNF213 via a specific interaction between IpaH1.4/2.5 LRR and RNF213 RING uncovered in this study (Supplementary Fig. 22). Subsequently, IpaH1.4/2.5 can mediate the K48-linked ubiquitination and proteasomal degradation of RNF213, thereby counteracting the relevant host antibacterial immune processes induced by RNF213 to facilitate the proliferation of S. flexneri in host cells (Supplementary Fig. 22).

Plasmids and Mutagenesis.

For recombinant protein expression in E. coli, the DNA fragments encoding desired proteins were cloned into a modified pRSFDuet-1 vector, which encodes a Trx-6×His (for expression of S. flexneri IpaH1.4) or glutathione-S-transferase (GST) tag (for expression of RNF213 RING) followed by an HRV 3C protease cutting sequence before the multiple cloning sites. All the point mutations in constructs were introduced by standard PCR protocol. For expression in HeLa cells, the coding sequences for human RNF213 were inserted into a modified version of pAcGFP-C1 vector, resulting in a fusion protein with an N-terminal AcGFP tag. The coding sequences for IpaH1.4 were cloned into a modified version of pFLAG-CMV-1 vector, which has an N-terminal FLAG-mCherry tag. All mutations were introduced by standard PCR methods and verified by DNA sequencing. The cDNA of human RNF213 was purchased from the cDNA library of youbio. The full-length or truncated RNF213 were cloned into a modified pCAGGS vector for expression in HEK293F cells, which encodes a 3×FLAG-6×His-HRV 3C before the multiple cloning sites. The IpaH1.4 C368A mutant and IpaH1.4 NEL were cloned into a modified pCAGGS vector for expression in HEK293F cells, which encodes a 3×FLAG-TEV before the multiple cloning sites.

Protein expression and purification

For recombinant protein expressions in E. coli. Proteins were expressed in BL21 (DE3) E. coli cells induced by 100 µM IPTG at 16 ℃. For RNF213 proteins expression, additional 0.1 mM ZnCl₂ was added into the culture to improve protein folding before IPTG induction. The bacterial cell pellets were lysed by the ultrahigh pressure homogenizer FB-110XNANO homogenizer machine (Shanghai Litu Machinery Equipment Engineering Co., Ltd.). Then, the lysate was spun down by centrifuge at 37,000 g for 30 minutes to remove the pellets fractions. Trx-6×His-tagged proteins were purified by Ni²⁺ Sepharose excel beads (GE Healthcare) affinity chromatography in binding buffer (50 mM Tris, 500 mM NaCl, and 5 mM imidazole at pH 7.9). GST fusion proteins were affinity purified by glutathione sepharose 4B beads (GE Healthcare) with column buffer containing 20 mM Tris, 100 mM NaCl, 1 mM dithiothreitol (DTT) at pH 7.5. Each recombinant protein was further purified by size-exclusion chromatography. The N-terminal Trx tag or GST tag was cleaved by HRV 3C protease, and then further removed by HisTrap excel column or GSTrap HP column (GE Healthcare) respectively. For proteins used in crystal screening, the GST-tagged RNF213 RING and N-terminal methionine extended IpaH1.4 LRR were co-expressed in Rosetta (DE3) E. coli cells.

For protein expression of full length RNF213 or N-terminal truncated RNF213 in HEK293F cells. HEK293F cells (ATCC) lacking N-acetylglucosaminyltransferase I (Gnti⁻) were grown in Union-293 Medium (Union-Biotech) in a shaker incubator set at 37 ℃, 110 rpm, 30% humidity, and 5% CO₂. The indicated plasmids were transfected to HEK293F cells for 4 days using PEI (Polysciences). The transfected cells were collected and lysed in the lysis buffer containing 50 mM HEPES, 200 mM KCl, 1 mM DTT, 1 mM PMSF, 1 µg/mL Aprotinin, 1 µg/mL Pepstatin, and 1 µg/mL Leupeptin at pH 7.3. The lysate was centrifuged at 37,000 g for 40 min at 4 ℃. The supernatant was collected and incubated with anti-FLAG beads (GenScript) for 2 h at 4 ℃. The beads were washed four times with cold buffer containing 50 mM HEPES, 200 mM KCl and 1 mM DTT at pH 7.3, and then incubated with HRV 3C protease overnight at 4 ℃ to remove the 3×FLAG-6×His tag. The flow-through and 4 mL of wash were collected and concentrated using Amicon Ultra 15 ml 100 kDa cut-off centrifugal filters (Millipore Sigma). Concentrated proteins were loaded onto a Superose 6 10/300 GL column (GE Healthcare) for further purification.

For expression of IpaH1.4 C368A mutant and IpaH1.4 NEL in HEK293F The transfected cells were collected and lysed in the lysis buffer containing 20 mM Tris, 200 mM NaCl, 2 mM MgCl₂, 1 mM dithiothreitol (DTT), 1% Trxion-100, 500 µM PMSF, 1 µg/mL Aprotinin, 1 µg/mL Pepstatin, and 1 µg/mL Leupeptin at pH 7.5. The lysate was centrifuged at 16,000 g for 20 min at 4 ℃. The supernatant was collected and incubated with anti-FLAG beads (GenScript) for 2 h at 4 ℃. The beads were washed four times with a cold buffer containing 20 mM Tris, 100 mM NaCl, 1 mM dithiothreitol (DTT), 5% Glycerol at pH 7.5, and then incubated with TEV protease overnight at 4 ℃ to remove the 3×FLAG tag. The supernatant was used for the further mass spectrometric analysis.

GST pull-down assay

Direct interaction of the wild type IpaH1.4 with FLAG-tagged full length RNF213 was analyzed in the buffer containing 20 mM Tris, 100 mM NaCl, 1 mM DTT, 0.5% NP-40, and 1% Glycerol, at pH 7.5. 100 µg GST-tagged IpaH1.4 or GST tag were pelleted by adding 20 µL of fresh glutathione sepharose 4B beads (GE Healthcare). The pellets were washed three times with 1 mL of the assay buffer and subsequently added 2 mL cell lysis containing overexpressed FLAG-tagged RNF213, which incubated on ice for 1.5 hour. Then, the pellets were washed four times with 1 mL of the assay buffer. Finally, the pellets were boiled with 30 µL SDS-PAGE sample buffer. The samples were detected by western blot using specific GST antibody (1:2,000 dilution; Proteintech, 10000-0-AP) and FLAG antibody (1:2,000 dilution; Proteintech, 20543-1-AP)

Analytical ultracentrifugation

Sedimentation velocity experiments in this study were performed on a Beckman XL-I 21 analytical ultracentrifuge equipped with an eight-cell rotor under 15000 rpm at 20 °C. The partial specific volumes of different protein samples and the relevant buffer densities were calculated using the software SEDNTERP (http://www.rasmb.org/). The final sedimentation velocity data were analyzed and fitted to a continuous sedimentation coefficient distribution model using the program SEDFIT⁵⁹. The fitting results were further output to the Origin 9 software and aligned with each other.

Size exclusion chromatography

All size exclusion chromatography assays were monitoring the absorbance at 280 nm by an AKTA FPLC system (GE Healthcare). Individual and mixed protein samples (500 µL) were loaded on to a Superose 6 10/300 GL or Superdex 75 10/300 GL column (GE Healthcare) equilibrated with the same column buffer. The fitting results were further output to the Origin 9 software and aligned with each other.

Multi-angle light scattering analysis

For multi-angle light-scattering (MALS) measurement, RNF213(371–5207) sample was injected into an AKTA FPLC system (GE Healthcare) with a Superose 6 10/300 GL column (GE Healthcare) with the buffer containing 50 mM HEPES (pH 7.3), 200 mM KCl and 1 mM DTT. The chromatography system was coupled to a static light scattering detector (miniDawn, Wyatt Technology) and a differential refractive index detector (Optilab, Wyatt Technology). Data were collected every 0.5 s with a flow rate of 0.5 mL/min. Data were analyzed using the ASTRA 6 software (Wyatt Technology) and drawn on the Origin 9 software.

Isothermal titration calorimetry (ITC) assay

ITC experiments were performed using an automated ITC calorimeter (Malvern) at 25 ℃. All protein samples used in ITC experiments were prepared in the same buffer containing 20 mM Tris-HCl (pH 7.5), 100 mM NaCl and 1 mM DTT. The titration data were analyzed using the Malvern MicroCal PEAQ-ITC analysis program and fitted using the one-site or the two-sites binding mode.

In vitro ubiquitination assay

Recombinant murine UBA1 (E1), human E2s and ubiquitin proteins (wild type ubiquitin or ubiquitin variants) expressed in E. coli cells were used for the assay. The Cy5-labelled ubiquitin was generated by labelling the purified 6×His-Cys-ubiquitin with Cy5-Maleimide Mono-Reactive Dye (GE Healthcare). A typical reaction system used for the in vitro ubiquitination assays containing 1 µM UBA1, 4 µM E2, 4 µM IpaH1.4, 25 µM ubiquitin and 0.2 µM RNF213 in 20 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 10 mM ATP and 10 mM MgCl₂ at pH 7.5. Reaction mixtures were incubated at 37 ℃ for the desired time, and aliquots of sample were immediately denatured by mixing with 2× SDS-PAGE sample buffer with 100 mM DTT and boiled for 10 min at 65 ℃. For in vitro ubiquitination assay using fluorescent Cy5-labelled ubiquitin, 5 µM Cy5-labelled ubiquitin was used to replace equivalent normal ubiquitin. Finally, samples were analyzed by SDS-PAGE followed by fluorescence imaging or Coomassie blue staining.

LC/tandem MS (MS/MS) analysis of peptide

The Coomassie Brilliant Blue stained gel band was excised into small pieces and washed in order with water, 50 mM NH₄HCO₃ in 50% acetonitrile and 100% acetonitrile. The protein was reduced with 10 mM TCEP (Thermo Scientific) in 100 mM NH₄HCO₃ at room temperature for 30 min and alkylated with 55 mM N-ethylmaleimide (Sigma) in 100 mM NH₄HCO₃ in the dark for 30 min. After that, the gel pieces were washed with 100 mM NH₄HCO₃ and 100% acetonitrile, and then dried using a SpeedVac. Finally, they were digested with 12.5 ng/µL trypsin (Promega) in 50 mM NH₄HCO₃ for 16 h at 37 ℃, and the tryptic peptides were extracted twice with 50% acetonitrile/5% formic acid and dried using a SpeedVac. The sample was reconstituted with 0.1% formic acid, desalted using a MonoSpinTM C18 column (GL Science, Tokyo, Japan), and then dried with a SpeedVac.

The peptide mixture was analyzed by a home-made 30 cm-long pulled-tip analytical column (75 µm ID packed with ReproSil-Pur C18-AQ 1.9 µm resin, Dr. Maisch GmbH, Germany), the column was then placed in-line with an Easy-nLC 1200 nano HPLC (Thermo Scientific, San Jose, CA) for mass spectrometry analysis. The analytical column temperature was set at 55 ℃ during the experiments. The mobile phase and elution gradient used for peptide separation were as follows: 0.1% formic acid in water as buffer A and 0.1% formic acid in 80% acetonitrile as buffer B, 0–1 min, 2%-10% B; 1–81 min, 10–35% B; 81–96 min, 35%-60% B, 96–111 min, 60%-100% B, 111–120 min, 100% B. The flow rate was set as 300 nL/min.

Data-dependent tandem mass spectrometry (MS/MS) analysis was performed with a Q Exactive Orbitrap mass spectrometer (Thermo Scientific, San Jose, CA). Peptides eluted from the LC column were directly electrosprayed into the mass spectrometer. A cycle of one full-scan MS spectrum (m/z 300–1800) was acquired followed by top 20 MS/MS events, sequentially generated on the first to the twentieth most intense ions selected from the full MS spectrum at a 28% normalized collision energy. Full scan resolution was set to 70,000 with automated gain control (AGC) target of 3e6. MS/MS scan resolution was set to 17,500 with isolation window of 1.8 m/z and AGC target of 1e5. The number of microscans was one for both MS and MS/MS scans and the maximum ion injection time was 50 and 100 ms, respectively. The dynamic exclusion settings used were as follows: charge exclusion, 1, and > 7; exclude isotopes, on; and exclusion duration, 15 seconds. MS scan functions and LC solvent gradients were controlled by the Xcalibur data system (Thermo Scientific).

The acquired MS/MS data were analyzed against a Swiss-Prot Homo Sapiens database using PEAKS Studio X+ (Bioinformatics Solutions, Waterloo, Ontario, Canada). The database search parameters were set as the followings: MS and MS/MS tolerance of 20 ppm and 0.1 Da, respectively, FDR was set as 1% and protein identification threshold was set as (-10 logP) ≧ 20. Oxidation (M) and ubiquitin (K) were specified as variable modifications, and N-ethylmaleimide (C) was specified as

EM sample preparation and data collection

Initial validation of sample homogeneity was conducted through negative staining with 0.2% (w/v) uranyl acetate using a Tecnai T12 Transmission Electron Microscope (Thermo Fisher Scientific). Subsequently, for cryo-EM, the sample was adjusted to 0.4 mg/mL and aliquots of 4 microliters were applied to glow-discharged 200 mesh 2/1 Au grids (Quantifoil). Following a 5-second incubation period, grids were blotted for 2 seconds with a blot force of -2 within a Vitrobot Mark IV chamber (Thermo Fisher Scientific) set at 4 ℃ and 100% humidity, then rapidly plunged into pre-cooled liquid ethane.

Cryo-EM data acquisition was performed using a 300 kV Titan Krios G4 microscope (Thermo Fisher Scientific) equipped with a Biocontinuum K3 Direct Electron Detector and a GIF filter (Gatan). Movies were recorded at a nominal magnification of ×81,000, corresponding to a calibrated pixel size of 0.5275 Å per pixel in super-resolution mode, with defocus ranging from − 1.2 to -2.4 µm. Beam image-shift was used to accelerate the data collection in EPU software package with a defocus range from − 1.4 to -2.4 µm. Exposures of 2.2 s were dose-fractionated into 40 frames (55 ms per frame) with a dose rate of 25 e⁻ per pixel/s (roughly 1.235 e⁻/Å² per frame), resulting in a total dose of 49.41 e⁻/Å².

Image processing

The collected movie stacks were gain-normalized, binned, dose-weighted, and motion-corrected in Motioncor2⁶⁰. The CTF parameters were determined with CTFFIND4⁶¹. Particles were automatically picked using Gautomatch (https://www2.mrc-lmb.cam.ac.uk/download/gautomatch-053/). Subsequently, particles were extracted and subjected to 2D classification in RELION-3.1⁶². Those particles showing secondary structure features in the 2D classes were selected and subjected to CryoSPARC⁶³ heterogeneous refinement using the map EMD-10429⁵⁰ as initial reference. The 3D classes showing clear structural features were selected and refined using CryoSPARC non-uniform refinement. To improve the map quality of the density of IpaH1.4, the density in the cyan mask (Supplementary Fig. 7b) was subjected to CryoSPARC local refinement and then subtracted. The remained density (RNF213 E3 module and IpaH1.4) was first subjected to local refinement with the purple mask (Supplementary Fig. 7b). Then particles were subjected to focus 3D classification with a purple solvent mask and an orange focus mask (Supplementary Fig. 7b). The particles in the 3D classes with clearer IpaH1.4 density were combined and used for local refinement.

Model building

The AlphaFold2⁶⁴ predicted structures of human RNF213 and S. flexneri IpaH1.4 served as initial models. These models were initially fitted into cryo-EM density maps using UCSF Chimera⁶⁵, and subsequently refined through manual adjustments in Coot⁶⁶. Iterative cycles of real_space_refine in PHENIX⁶⁷, and further manual adjustments in Coot were employed to optimize the models. Detailed statistical data regarding the model building process can be found in Supplementary Table 1.

Protein crystallization and structural elucidation

Crystals of the RNF213 RING/IpaH1.4 LRR complex were obtained using the hanging- drop vapor-diffusion method at 16 ℃. The crystal-growing condition of the RNF213 RING/IpaH1.4 LRR complex (20.0 mg/mL) was 0.1 M HEPES (pH 7.8), 0.2 M Ammonium acetate and 20% (w/v) polyethylene glycol 3,350. A 1.7 Å resolution X-ray data set for the RNF213 RING/IpaH1.4 LRR complex was collected at the beamline BL02U1 of the Shanghai Synchrotron Radiation Facility⁶⁸. The diffraction data were processed and scaled using autoPROC⁶⁹.

The phase problem of the RNF213 RING/IpaH1.4 LRR complex was solved by molecular replacement method using the IpaH1.4 LRR structure (PDB ID: 7V8H) as the search model with PHASER⁷⁰. The initial structural models were rebuilt manually using COOT⁶⁶, and then refined using PHENIX⁶⁷. Further manual model building and adjustments were completed using COOT⁶⁶. The qualities of the final models were validated by MolProbity⁷¹. The final refinement statistics of solved structure in this study were listed in Supplementary Table 2. All the structural diagrams were prepared using the program PyMOL (http://www.pymol.org/) or UCSF ChimeraX⁷².

Cell culture, transfection and co-immunoprecipitation assays

All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific) at 37 ℃ in humidified 5% CO₂ atmosphere. All cell lines were tested negative for Mycoplasma by using standard PCR method. Co-transfections of AcGFP-RNF213 and FLAG-mCherry-IpaH1.4 or related mutant plasmids were performed with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. After 24 hours, the HEK293T cells transiently expressing proteins were harvested, washed with the PBS buffer, and lysed at 4 ℃ in a lysis buffer containing 50 mM HEPES (pH 7.3), 200 mM KCl, 1 mM PMSF and 1% protease inhibitor cocktail (AMRESCO). Lysates were centrifuged at 16,000 g for 20 min at 4 ℃, and then the supernatants were incubated with anti-GFP monoclonal antibody-agarose (Medical & Biological Laboratories) for 1 h at 4 ℃. Precipitated proteins were washed with the cold lysis buffer for 5 times, and collected by centrifugation at 800 g for 20 min at 4 °C. Then, the beads were resuspended with 2× SDS-PAGE sample buffer containing 100 mM DTT and boiled for 10 min at 65 ℃. Subsequently, the precipitated proteins were resolved in SDS-PAGE gel and the GFP-tagged RNF213 and FLAG-mCherry-tagged IpaH1.4 were detected by western blot using specific GFP antibody (1:2,000 dilution; Proteintech, 50430-2-AP) and mCherry antibody (1:4,000 dilution; abcam, ab183628), respectively.

Immunoblot analyses

Post-nuclear supernatants from HeLa cells were lysed in a lysis buffer containing 50 mM HEPES pH 7.3, 200 mM KCl, 1 mM DTT, 1 mM PMSF, 1 µg/mL Aprotinin, 1 µg/mL Pepstatin, and 1 µg/mL Leupeptin. Cleared supernatants were mixed with 2× SDS-PAGE sample buffer with 100 mM DTT and boiled for 10 min at 65 ℃. An overnight wet transfer was used to transfer RNF213 proteins onto methanol-activated PVDF membranes (Millipore). The samples were detected by western blot using specific GFP antibody (1:2000 dilution; Proteintech, 50430-2-AP), mCherry antibody (1:4,000 dilution; abcam, ab183628), and GADPH antibody (1:400,000; sangon, D110016) respectively.

Fluorescence imaging

OA (Beyotimne) was conjugated to 10% BSA (fatty acid and endotoxin free; Beyotimne) at a final concentration of 10 mM in PBS before use. HeLa cells were fixed with 4% paraformaldehyde for 15 min and punched with 0.2% Triton X-100 in PBS for another 15 min at room temperature, and the nuclei were visualized by staining with 4′, 6-diamidino-2- phenylindole (DAPI). The cell images were captured and analyzed using the TCS SP5 confocal microscope equipped with LAS X software (Leica Inc., Thornwood, NY, USA). In particular, ubiquitinylated substrates were stained by incubating UBCJ2 antibody (1:100; Enzo, ENZ-ABS840) overnight at 4 ℃ and goat anti-rabbit Alexa Fluor 555 (1:500; Thermo Fisher Scientific, A-21422) for 40 min at room temperature. The statistical data represent means ± SEM of > 30 analyzed cells (selected regions). Statistical analyses were performed in GraphPad Prism 9 by two-tailed unpaired Student’s t test analysis and P value style is GraphPad (GP): not significant (ns), P ≥ 0.05; ****, P < 0.0001.

Generation of RNF213-knockout cells

The RNF213 gene was knocked out in HeLa cells using the CRISPR-Cas9 system. Oligonucleotides for the single guide RNA (sgRNA) (sequence: CAGTTGGCAAGAAAACCCCG) were phosphorylated with T4 PNK (New England Biolabs) and cloned into the LentiCRISPR v2 vector and co-transfected into HEK293T cells with pMD2.G and psPAX2 vectors using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific). In order to increase the virus titer, the virus-containing medium was filtered using a 0.45 µm-pore syringe filter and concentrated by using Lentiviral concentration reagent (Biodragon). HeLa cells were then incubated with polybrene (Sigma-Aldrich) and virus-containing medium. Transfected HeLa cells were treated with puromycin (1.0 µg/ml; InvivoGen), and single cells were sorted into a 96-well plate. Expanded single colonies were screened for lack of RNF213 expression by immunoblotting and further confirmed by DNA sequencing.

Generation of AcGFP-RNF213 stable cell lines

An modified passer transposon system was used in this work to generate AcGFP-RNF213 stable cell lines⁷³. The AcGFP-tagged RNF213 was cloned into the pJL-NeoR vector and was co-transfected into RNF213-knockout cells with pJL-SB vector using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific). Notably, the sgRNA-targeting region of RNF213 at pJL-NeoR vector was synonymously mutated to avoid being targeted again by Cas9 enzyme. After 2 days, cells were treated with G418 (600.0 µg/mL; Beyotime), and further confirmed by DNA sequencing.

Bacterial strain generation and infection

S. flexneri 2a strain M90T was used in this work. Double knockout of the ipaH1.4/ipaH2.5 gene was constructed by λ red recombinase–mediated replacement by homologous recombination with a kanamycin resistance cassette, followed by flippase recombinase-catalyzed removal of the cassette. To rescue the ipaH1.4/ipaH2.5-knockout strain, the wild-type or mutant ipaH1.4 gene, which have a C-terminal 6×His tag gene sequence, were introduced back into the ipaH1.4 locus on the chromosome in the knockout strain by a CRISPR-Cas12a-assisted recombination method. Successful rescues of different ipaH1.4 genes were verified by DNA sequencing.

To enumerate intracellular bacteria, HeLa cells were seeded in 24-well plates 24 h before infection. Bacteria were diluted in DMEM to achieve the desired multiplicity of infection (MOI) of 100. Infection was accelerated by centrifugation at 500 g for 10 min at room temperature followed by incubation at 37 ºC in a 5% CO₂ incubator. After 1 h of infection, the infected cells were washed three times with PBS. To kill extracellular bacteria, the medium was then replaced with DMEM supplemented with 100 µg/mL gentamycin and incubated for an additional 1 h or 5 h. To determine intracellular S. flexneri colony-forming units (CFUs), cells were lysed in 1 mL of the PBS buffer containing 0.1% Triton X-100. Serial dilutions were plated in duplicate on LB agar and grown overnight. The data are presented as means ± SEM from three independent experiments. Statistical analyses were performed in GraphPad Prism 9 by two-tailed unpaired Student’s t-test analysis and P value style is GraphPad (GP): not significant (ns), P ≥ 0.05; *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

RNA isolation and quantitative RT-PCR

Total cellular RNA was extracted using RNA Isolation Kit (Vazyme). The cDNA was synthesized using the HiScript III RT SuperMix kit (Vazyme). The following primers were used for quantitative RT-PCR: RNF213 (forword) (GGAAAGGAAACCTCTGAA

CTCGG); RNF213 (reverse) (CTCGTTCTGGTCTCTGAGCATG). GAPDH gene was used as an internal control for quantitative gene expression analyses.

Data availability.

The cryo-EM density maps and models in this study have been deposited in the Electron Microscopy Data Bank (EMDB) and the PDB under the following accession numbers: J79 (RNF213): EMDB EMD-61848, PDB 9JW1; J368 (RNF213_E3_module-IpaH1.4_LRR_domain): EMDB EMD-61852, PDB 9JWG. The atomic coordinate and structure factors of the crystal structure of the RNF213 RING/IpaH1.4 LRR complex have been deposited in the Protein Data Bank under the accession code 9JTA.

Acknowledgements

We thank SSRF BL02U1, and BL10U2 for X-ray beam time. We thank Yue Yin of the Mass Spectrometry System at the National Facility for Protein Science in Shanghai (NFPS), Shanghai Advanced Research Institute, China for MS data collection and analysis. We thank the Cryo-Electron Microscopy center at the Interdisciplinary Research Center on Biology and Chemistry, Shanghai Institute of Organic Chemistry for help with data collection. This work was supported in part by grants from the National Natural Science Foundation of China (32071219, 92253301, 21822705 for L.P., 81830068 for Y-F.Y., 82472285 for D.W., and 32071297 for J.L.), the National Basic Research Program of China (2022YFC2303102 for L.P.), the CAS Youth Interdisciplinary Team (JCTD-2022-10 for L.P.), the STI2030-Major Projects (2022ZD0207400 for Y.Z.), Shanghai Key Laboratory of Aging Studies (19DZ2260400 for Y.Z.), the Basic Research Pioneer Project by the Science and Technology Commission of Shanghai Municipality (STCSM for Y.Z.), and the Foundation of Key Laboratory of Veterinary Biotechnology, Shanghai, P.R. China (No. BD1500010 for D.W).

Author contributions

X.Z., H.Z., Y.W., D.W., Y-F.Y., Yixiao Zhang, and L.P. designed research; X.Z., H.Z., Y.W., D.W., Z.L., Yuchao Zhang, Y.T., J.L., performed research; X.Z., H.Z., Y.W., D.W., Yixiao Zhang, and L.P. analyzed data; X.Z., H.Z., D.W., Y-F.Y., Yixiao Zhang and L.P. wrote the paper.

Competing interests

The authors declare no competing interests.

Ciechanover, A. The unravelling of the ubiquitin system. Nature reviews. Molecular cell biology 16, 322-324, doi:10.1038/nrm3982 (2015).
Pickart, C. M. & Eddins, M. J. Ubiquitin: structures, functions, mechanisms. Biochimica et biophysica acta 1695, 55-72, doi:10.1016/j.bbamcr.2004.09.019 (2004).
Weissman, A. M. Themes and variations on ubiquitylation. Nature reviews. Molecular cell biology 2, 169-178, doi:10.1038/35056563 (2001).
Komander, D. & Rape, M. The ubiquitin code. Annual review of biochemistry 81, 203-229, doi:10.1146/annurev-biochem-060310-170328 (2012).
Otten, E. G. et al. Ubiquitylation of lipopolysaccharide by RNF213 during bacterial infection. Nature 594, 111-116, doi:10.1038/s41586-021-03566-4 (2021).
Kelsall, I. R. et al. HOIL-1 ubiquitin ligase activity targets unbranched glucosaccharides and is required to prevent polyglucosan accumulation. Embo J 41, e109700, doi:10.15252/embj.2021109700 (2022).
Yang, C. S. et al. Ubiquitin Modification by the E3 Ligase/ADP-Ribosyltransferase Dtx3L/Parp9. Mol Cell 66, 503-516 e505, doi:10.1016/j.molcel.2017.04.028 (2017).
Popovic, D., Vucic, D. & Dikic, I. Ubiquitination in disease pathogenesis and treatment. Nature medicine 20, 1242-1253, doi:10.1038/nm.3739 (2014).
Mukherjee, R. & Dikic, I. Regulation of Host-Pathogen Interactions via the Ubiquitin System. Annual review of microbiology 76, 211-233, doi:10.1146/annurev-micro-041020-025803 (2022).
Shaid, S., Brandts, C. H., Serve, H. & Dikic, I. Ubiquitination and selective autophagy. Cell death and differentiation 20, 21-30, doi:10.1038/cdd.2012.72 (2013).
Vargas, J. N. S., Hamasaki, M., Kawabata, T., Youle, R. J. & Yoshimori, T. The mechanisms and roles of selective autophagy in mammals. Nature reviews. Molecular cell biology 24, 167-185, doi:10.1038/s41580-022-00542-2 (2023).
Wild, P. et al. Phosphorylation of the autophagy receptor optineurin restricts Salmonella growth. Science 333, 228-233, doi:10.1126/science.1205405 (2011).
Zheng, Y. T. et al. The adaptor protein p62/SQSTM1 targets invading bacteria to the autophagy pathway. Journal of immunology 183, 5909-5916, doi:10.4049/jimmunol.0900441 (2009).
Li, F. X. et al. Structural insights into the ubiquitin recognition by OPTN (optineurin) and its regulation by TBK1-mediated phosphorylation. Autophagy 14, 66-79, doi:10.1080/15548627.2017.1391970 (2018).
Thurston, T. L., Ryzhakov, G., Bloor, S., von Muhlinen, N. & Randow, F. The TBK1 adaptor and autophagy receptor NDP52 restricts the proliferation of ubiquitin-coated bacteria. Nat Immunol 10, 1215-1221, doi:10.1038/ni.1800 (2009).
Xie, X. Q. et al. Molecular basis of ubiquitin recognition by the autophagy receptor CALCOCO2. Autophagy 11, 1775-1789, doi:10.1080/15548627.2015.1082025 (2015).
Rogov, V., Dotsch, V., Johansen, T. & Kirkin, V. Interactions between Autophagy Receptors and Ubiquitin-like Proteins Form the Molecular Basis for Selective Autophagy. Mol Cell 53, 167-178, doi:DOI 10.1016/j.molcel.2013.12.014 (2014).
Gomes, L. C. & Dikic, I. Autophagy in antimicrobial immunity. Mol Cell 54, 224-233, doi:10.1016/j.molcel.2014.03.009 (2014).
Levine, B., Mizushima, N. & Virgin, H. W. Autophagy in immunity and inflammation. Nature 469, 323-335, doi:Doi 10.1038/Nature09782 (2011).
Yamamoto, H., Zhang, S. D. & Mizushima, N. Autophagy genes in biology and disease. Nat Rev Genet 24, 382-400, doi:10.1038/s41576-022-00562-w (2023).
Liu, S. & Chen, Z. J. Expanding role of ubiquitination in NF-kappaB signaling. Cell Res 21, 6-21, doi:10.1038/cr.2010.170 (2011).
Iwai, K., Fujita, H. & Sasaki, Y. Linear ubiquitin chains: NF-kappa B signalling, cell death and beyond. Nat Rev Mol Cell Bio 15, 503-508, doi:Doi 10.1038/Nrm3836 (2014).
van Wijk, S. J. L. et al. Linear ubiquitination of cytosolic Salmonella Typhimurium activates NF-kappaB and restricts bacterial proliferation. Nature microbiology 2, 17066, doi:10.1038/nmicrobiol.2017.66 (2017).
Randow, F. & Youle, R. J. Self and Nonself: How Autophagy Targets Mitochondria and Bacteria. Cell host & microbe 15, 404-412, doi:DOI 10.1016/j.chom.2014.03.012 (2014).
Pollaci, G. et al. Novel Multifaceted Roles for RNF213 Protein. International journal of molecular sciences 23, doi:10.3390/ijms23094492 (2022).
Morito, D. Molecular structure and function of mysterin/RNF213. Journal of biochemistry 175, 495-505, doi:10.1093/jb/mvae020 (2024).
Kamada, F. et al. A genome-wide association study identifies RNF213 as the first Moyamoya disease gene. J Hum Genet 56, 34-40, doi:10.1038/jhg.2010.132 (2011).
Liu, W. Y. et al. Identification of RNF213 as a Susceptibility Gene for Moyamoya Disease and Its Possible Role in Vascular Development. PloS one 6, doi:ARTN e2254210.1371/journal.pone.0022542 (2011).
Kobayashi, H. et al. Biochemical and Functional Characterization of RNF213 (Mysterin) R4810K, a Susceptibility Mutation of Moyamoya Disease, in Angiogenesis In Vitro and In Vivo. Journal of the American Heart Association 4, doi:10.1161/JAHA.115.002146 (2015).
Sugihara, M. et al. The AAA+ ATPase/ubiquitin ligase mysterin stabilizes cytoplasmic lipid droplets. The Journal of cell biology 218, 949-960, doi:10.1083/jcb.201712120 (2019).
Pol, A., Gross, S. P. & Parton, R. G. Review: biogenesis of the multifunctional lipid droplet: lipids, proteins, and sites. The Journal of cell biology 204, 635-646, doi:10.1083/jcb.201311051 (2014).
Bosch, M. et al. Mammalian lipid droplets are innate immune hubs integrating cell metabolism and host defense. Science 370, doi:10.1126/science.aay8085 (2020).
Houzelstein, D. et al. The ring finger protein 213 gene (Rnf213) contributes to Rift Valley fever resistance in mice. Mammalian genome : official journal of the International Mammalian Genome Society 32, 30-37, doi:10.1007/s00335-020-09856-y (2021).
Thery, F. et al. Ring finger protein 213 assembles into a sensor for ISGylated proteins with antimicrobial activity. Nat Commun 12, 5772, doi:10.1038/s41467-021-26061-w (2021).
Tian, H. et al. RNF213 modulates gamma-herpesvirus infection and reactivation via targeting the viral Replication and Transcription Activator. Proceedings of the National Academy of Sciences of the United States of America 120, e2218825120, doi:10.1073/pnas.2218825120 (2023).
Hernandez, D., Walsh, S., Saavedra Sanchez, L., Dickinson, M. S. & Coers, J. Interferon-Inducible E3 Ligase RNF213 Facilitates Host-Protective Linear and K63-Linked Ubiquitylation of Toxoplasma gondii Parasitophorous Vacuoles. mBio 13, e0188822, doi:10.1128/mbio.01888-22 (2022).
Walsh, S. C. et al. The bacterial effector GarD shields Chlamydia trachomatis inclusions from RNF213-mediated ubiquitylation and destruction. Cell host & microbe 30, 1671-1684 e1679, doi:10.1016/j.chom.2022.08.008 (2022).
Jennison, A. V. & Verma, N. K. S. flexneri infection: pathogenesis and vaccine development. FEMS microbiology reviews 28, 43-58, doi:10.1016/j.femsre.2003.07.002 (2004).
Khalil, I. A. et al. Morbidity and mortality due to shigella and enterotoxigenic Escherichia coli diarrhoea: the Global Burden of Disease Study 1990-2016. Lancet Infect Dis 18, 1229-1240, doi:10.1016/S1473-3099(18)30475-4 (2018).
Tanner, K., Brzovic, P. & Rohde, J. R. The bacterial pathogen-ubiquitin interface: lessons learned from Shigella. Cellular microbiology 17, 35-44, doi:10.1111/cmi.12390 (2015).
Xian, W. et al. The Shigella kinase effector OspG modulates host ubiquitin signaling to escape septin-cage entrapment. Nat Commun 15, 3890, doi:10.1038/s41467-024-48205-4 (2024).
Ashida, H. et al. A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO/IKKgamma to dampen the host NF-kappaB-mediated inflammatory response. Nature cell biology 12, 66-73; sup pp 61-69, doi:10.1038/ncb2006 (2010).
Sanada, T. et al. The S. flexneri effector OspI deamidates UBC13 to dampen the inflammatory response. Nature 483, 623-626, doi:10.1038/nature10894 (2012).
de Jong, M. F., Liu, Z., Chen, D. & Alto, N. M. S. flexneri suppresses NF-kappaB activation by inhibiting linear ubiquitin chain ligation. Nature microbiology 1, 16084, doi:10.1038/nmicrobiol.2016.84 (2016).
Pruneda, J. N. et al. The Molecular Basis for Ubiquitin and Ubiquitin-like Specificities in Bacterial Effector Proteases. Mol Cell 63, 261-276, doi:10.1016/j.molcel.2016.06.015 (2016).
Ashida, H. & Sasakawa, C. IpaH Family Effectors as a Versatile Model for Studying Pathogenic Bacteria. Front Cell Infect Mi 5, doi:Artn 100 10.3389/Fcimb.2015.00100 (2016).
Bullones-Bolanos, A., Bernal-Bayard, J. & Ramos-Morales, F. The NEL Family of Bacterial E3 Ubiquitin Ligases. International journal of molecular sciences 23, doi:10.3390/ijms23147725 (2022).
Zhu, Y. et al. Structure of a Shigella effector reveals a new class of ubiquitin ligases. Nat Struct Mol Biol 15, 1302-1308, doi:10.1038/nsmb.1517 (2008).
Liu, J. P. et al. Mechanistic insights into the subversion of the linear ubiquitin chain assembly complex by the E3 ligase IpaH1.4 of S. flexneri. Proceedings of the National Academy of Sciences of the United States of America 119, doi:ARTN e2116776119 10.1073/pnas.2116776119 (2022).
Ahel, J. et al. Moyamoya disease factor RNF213 is a giant E3 ligase with a dynein-like core and a distinct ubiquitin-transfer mechanism. Elife 9, doi:ARTN e56185 10.7554/eLife.56185 (2020).
Habu, T. & Harada, K. H. UBC13 is an RNF213-associated E2 ubiquitin-conjugating enzyme, and Lysine 63-linked ubiquitination by the RNF213-UBC13 axis is responsible for angiogenic activity. FASEB bioAdvances 3, 243-258, doi:10.1096/fba.2019-00092 (2021).
Takeda, M. et al. Moyamoya disease patient mutations in the RING domain of RNF213 reduce its ubiquitin ligase activity and enhance NFκB activation and apoptosis in an AAA+ domain-dependent manner. Biochemical and Biophysical Research Communications 525, 668-674, doi:10.1016/j.bbrc.2020.02.024 (2020).
Hansen, J. M. et al. Pathogenic ubiquitination of GSDMB inhibits NK cell bactericidal functions. Cell 184, 3178-3191 e3118, doi:10.1016/j.cell.2021.04.036 (2021).
Bosch, M. et al. Mammalian lipid droplets are innate immune hubs integrating cell metabolism and host defense. Science 370, doi:10.1126/science.aay8085 (2020).
Hinson, E. R. & Cresswell, P. The antiviral protein, viperin, localizes to lipid droplets via its N-terminal amphipathic α-helix. Proceedings of the National Academy of Sciences 106, 20452-20457, doi:doi:10.1073/pnas.0911679106 (2009).
Sugihara, M. et al. The AAA+ ATPase/ubiquitin ligase mysterin stabilizes cytoplasmic lipid droplets. Journal of Cell Biology 218, 949-960, doi:10.1083/jcb.201712120 (2019).
Branigan, E., Plechanovova, A., Jaffray, E. G., Naismith, J. H. & Hay, R. T. Structural basis for the RING-catalyzed synthesis of K63-linked ubiquitin chains. Nat Struct Mol Biol 22, 597-602, doi:10.1038/nsmb.3052 (2015).
Giogha, C. & Pearson, J. S. Shigella shuts down the pyrop-technic show. Cell Host & Microbe 29, 1473-1476, doi:10.1016/j.chom.2021.09.012 (2021).
Schuck, P. Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and lamm equation modeling. Biophysical journal 78, 1606-1619, doi:10.1016/S0006-3495(00)76713-0 (2000).
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat Methods 14, 331-332, doi:10.1038/nmeth.4193 (2017).
Rohou, A. & Grigorieff, N. CTFFIND4: Fast and accurate defocus estimation from electron micrographs. Journal of structural biology 192, 216-221, doi:10.1016/j.jsb.2015.08.008 (2015).
Zivanov, J. et al. New tools for automated high-resolution cryo-EM structure determination in RELION-3. Elife 7, doi:10.7554/eLife.42166 (2018).
Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nature Methods 14, 290-296, doi:10.1038/nmeth.4169 (2017).
Jumper, J. et al. Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589, doi:10.1038/s41586-021-03819-2 (2021).
Pettersen, E. F. et al. UCSF Chimera--a visualization system for exploratory research and analysis. Journal of computational chemistry 25, 1605-1612, doi:10.1002/jcc.20084 (2004).
Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta crystallographica. Section D, Biological crystallography 60, 2126-2132, doi:10.1107/s0907444904019158 (2004).
Adams, P. D. et al. PHENIX: building new software for automated crystallographic structure determination. Acta crystallographica. Section D, Biological crystallography 58, 1948-1954, doi:10.1107/s0907444902016657 (2002).
Wang, Z. et al. Automatic crystal centring procedure at the SSRF macromolecular crystallography beamline. Journal of synchrotron radiation 23, 1323-1332, doi:10.1107/S160057751601451X (2016).
Vonrhein, C. et al. Data processing and analysis with the autoPROC toolbox. Acta crystallographica. Section D, Biological crystallography 67, 293-302, doi:10.1107/S0907444911007773 (2011).
Storoni, L. C., McCoy, A. J. & Read, R. J. Likelihood-enhanced fast rotation functions. Acta Crystallogr D 60, 432-438, doi:Doi 10.1107/S0907444903028956 (2004).
Davis, I. W. et al. MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res 35, W375-W383, doi:Doi 10.1093/Nar/Gkm216 (2007).
Meng, E. C. et al. UCSF ChimeraX: Tools for structure building and analysis. Protein science : a publication of the Protein Society 32, e4792, doi:10.1002/pro.4792 (2023).
Wang, S. et al. Passer, a highly active transposon from a fish genome, as a potential new robust genetic manipulation tool. Nucleic acids research 51, 1843-1858, doi:10.1093/nar/gkad005 (2023).

There is NO Competing Interest.

SupplementalMaterialsRNF213NMV9.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

The discovery and molecular mechanism of the subversion of human E3 ligase RNF213 by the Shigella effector IpaH1.4

Status:

Version 1

Abstract

Figures

Introduction

Results

The ubiquitination and proteasomal degradation of RNF213 mediated by IpaH1.4

The cryo-EM structure of human RNF213

IpaH1.4 recognizes the RING domain of RNF213 through its LRR domain

The crystal structure of RNF213 RING in complex with the LRR domain of IpaH1.4

Discussion

Materials and Methods

Protein expression and purification

GST pull-down assay

Analytical ultracentrifugation

Size exclusion chromatography

Multi-angle light scattering analysis

Isothermal titration calorimetry (ITC) assay

LC/tandem MS (MS/MS) analysis of peptide

EM sample preparation and data collection

Image processing

Model building

Protein crystallization and structural elucidation

Cell culture, transfection and co-immunoprecipitation assays

Immunoblot analyses

Fluorescence imaging

Generation of AcGFP-RNF213 stable cell lines

Bacterial strain generation and infection

RNA isolation and quantitative RT-PCR

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1