Patients and follow-up
Human breast cancer samples were collected from consecutive patients with TNBC who underwent surgery from 2009 to 2012 at the Comprehensive Breast Health Center, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine (Shanghai, China). All patients were histologically diagnosed by expert pathologists. A total of 120 patients diagnosed with TNBC were included in the study (Ruijin cohort), with a median follow-up of 84.6 months (range: 44.3-121.3 months). Overall survival (OS) was defined as the interval between the surgery date and the date of death or the last follow-up. Disease-free survival (DFS) was defined as the interval between the surgery date and the date of a reported event such as death, locoregional recurrence, contralateral breast cancer, distant metastasis, or second malignancy, or the date of the last follow-up. Patients’ clinical characteristics are shown in Tables 1 and 2.
Table 1
Baseline clinical characteristics of TNBC patients.
Characteristics | Number (%) |
Age at diagnosis, years | |
≤ 50 | 45 (37.5%) |
> 50 | 75 (62.5%) |
Menopausal status | |
Pre/Peri-menopausal | 48 (40.0%) |
Post-menopausal | 72 (60.0%) |
Location | |
Left | 64 (53.3%) |
Right | 56 (46.7%) |
Tumor size, cm | |
≤ 2 | 56 (46.7%) |
> 2 | 64 (53.3%) |
Regional Lymph node | |
Negative | 83 (69.2%) |
Positive | 37 (30.8%) |
Histologic type | |
IDC | 103 (85.8%) |
Non-IDC | 17 (14.2%) |
Histological grade | |
I-II | 30 (25.0%) |
III | 71 (59.2%) |
Unknown | 19 (15.8%) |
Ki67, % | |
≤ 14 | 17 (14.2%) |
> 14 | 101 (84.2%) |
Unknown | 2 (16.7%) |
Breast surgery | |
BCS | 32 (26.7%) |
Mastectomy | 88 (73.3%) |
Neoadjuvant chemotherapy | |
No | 106 (88.3%) |
Yes | 14 (11.7%) |
Adjuvant chemotherapy | |
No | 6 (5.0%) |
Yes | 114 (95.0%) |
Radiotherapy | |
No | 60 (50.0%) |
Yes | 60 (50.0%) |
BCS: breast-conserving surgery; IDC: invasive ductal carcinoma; TNBC: triple-negative breast cancer. |
Table 2
Clinicopathological variables correlated with TAZ expression in TNBC patients.
Variable | TAZ low expression (n = 53) | TAZ high expression (n = 67) | P |
Age at diagnosis, years | | | 0.184 |
≤ 50 | 16 (30.2%) | 29 (43.3%) | |
> 50 | 37 (69.8%) | 38 (56.7%) | |
Menopausal status | | | 0.456 |
Pre/Peri-menopausal | 19 (35.8%) | 29 (43.3%) | |
Post-menopausal | 34 (64.2%) | 38 (56.7%) | |
Location | | | 0.583 |
Left | 30 (56.6%) | 34 (50.7%) | |
Right | 23 (43.4%) | 33 (49.3%) | |
Tumor size, cm | | | 0.855 |
≤ 2 | 24 (45.3%) | 32 (47.8%) | |
> 2 | 29 (54.7%) | 35 (52.2%) | |
Regional Lymph node | | | 0.427 |
Negative | 39 (73.6%) | 44 (65.7%) | |
Positive | 14 (26.4%) | 23 (34.3%) | |
Histologic type | | | 0.444 |
IDC | 44 (83.0%) | 59 (88.1%) | |
Non-IDC | 9 (17.0%) | 8 (11.9%) | |
Histological grade | | | 0.022 |
I-II | 18 (33.9%) | 12 (17.9%) | |
III | 24 (45.3%) | 47 (70.2%) | |
Unknown | 11 (20.8%) | 8 (11.9%) | |
Ki67, % | | | 0.031 |
≤ 14 | 12 (22.6%) | 5 (7.4%) | |
> 14 | 41 (77.4%) | 60 (89.6%) | |
Unknown | 0 (0%) | 2 (3.0%) | |
Breast surgery | | | 0.099 |
BCS | 10 (18.9%) | 22 (32.8%) | |
Mastectomy | 43 (81.1%) | 45 (67.2%) | |
Neoadjuvant chemotherapy | | | 0.152 |
No | 44 (83.0%) | 62 (92.5%) | |
Yes | 9 (17.0%) | 5 (7.5%) | |
Adjuvant chemotherapy | | | 0.404 |
No | 4 (7.5%) | 2 (3.0%) | |
Yes | 49 (92.5%) | 65 (97.0%) | |
Radiotherapy | | | 0.066 |
No | 32 (60.4%) | 28 (41.8%) | |
Yes | 21 (39.6%) | 39 (58.2%) | |
BCS: breast-conserving surgery; IDC: invasive ductal carcinoma; TAZ: transcriptional coactivator with PDZ-binding motif; TNBC: triple-negative breast cancer. |
The present study was performed in accordance with the Declaration of Helsinki. Approval for the use of human subjects was obtained from the research ethics committee of Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, and informed consent was obtained from each patient.
Immunohistochemistry
Immunohistochemistry (IHC) staining was applied using the avidin-biotin-peroxidase complex method, as previously described[14]. Briefly, after deparaffinization, rehydration, and antigen retrieval, the slides were incubated with the primary antibodies overnight at 4°C. The slides were then incubated with horseradish peroxidase-conjugated secondary antibodies (Abcam, UK) for 1 h at 37°C. After rinsing with phosphate buffer saline (PBS), the slides were stained with 3,3′-diaminobenzidine and counterstained with hematoxylin. The primary antibodies used are listed in Table 3.
Table 3
Primary antibodies for western blot, immunohistochemistry, immunofluorescence, and flow cytometry.
Protein | Concentra-tion for WB | Concentrati-on for IHC | Concentra-tion for IF | Concentration for flow cytometry | Specificity | Company |
TAZ | 1:1000 | 1:200 | / | / | Rabbit | CST |
IL-34 | 1:1000 | 1:50 | / | / | Mouse | Abcam |
PD-L1 | 1:1000 | 1:30 | / | / | Rabbit | Abcam |
PD-L1 | / | / | / | 1:100 | Rabbit | CST |
p38 | 1:1000 | / | / | / | Rabbit | CST |
p-p38 | 1:1000 | / | / | / | Rabbit | CST |
mTOR | 1:1000 | / | / | / | Rabbit | CST |
p-mTOR | 1:1000 | / | / | / | Rabbit | CST |
F4/80 | / | 1:2400 | / | / | Rabbit | CST |
F4/80 | / | / | / | 1:100 | Rat | BD Biosciences |
CD206 | / | 1:2000 | / | / | Rabbit | Abcam |
CD206 | / | / | / | 1:100 | Rat | BD Biosciences |
CD68 | / | 1:2400 | / | / | Rabbit | CST |
CD4 | / | 1:1000 | / | / | Rabbit | Abcam |
CD4 | / | / | / | 1:100 | Rat | BD Biosciences |
CD8 | / | 1:800 | 1:200 | / | Mouse | Thermo Scientific |
CD8 | / | / | / | 1:100 | Rat | BD Biosciences |
CD45 | / | / | / | 1:100 | Rat | BD Biosciences |
CD11b | / | / | / | 1:100 | Rat | BD Biosciences |
Ly6G | / | 1:900 | / | / | Rat | BioLegend |
MPO | / | 1:600 | / | / | Rabbit | Abcam |
Foxp3 | / | 1:6000 | / | / | Mouse | Abcam |
Ki-67 | / | 1:100 | / | / | Rabbit | Abcam |
Caspase-3 | / | 1:600 | / | / | Rabbit | CST |
CD31 | / | 1:600 | / | / | Rabbit | CST |
α-tubulin | 1:1000 | / | / | / | Rabbit | Abclonal |
CST: Cell Signaling Technology; Foxp3: forkhead box protein P3; IF: immunofluorescence; IHC: immunohistochemistry; IL-34: interleukin 34; Ly6G: lymphocyte antigen 6 complex locus G6D; MPO: myeloperoxidase; PD-1: programmed death 1; PD-L1: programmed death ligand 1; TAZ: transcriptional coactivator with PDZ-binding motif; WB: western blot. |
IHC staining was independently and blindly evaluated by two researchers (including one expert pathologist). Under 200× magnification, photographs of three representative fields were captured under a microscope (Leica, Germany). For TAZ, IL-34, and PD-L1 staining in the tissue microarray detection, the scores were calculated as the percentage score multiplied by the staining intensity score. The percentage score of positive staining cells was defined as follows: 0, < 1%; 1, 1–25%; 2, 26–50%; 3, 51–75%; and 4, > 75%. Meanwhile, the staining intensity score was determined as follows: 0, negative; 1, weak positive; 2, moderate positive; and 3, strong positive. For CD8 and CD68 staining, the number of positive cells was calculated in a 0.5 mm diameter cylinder and expressed as the mean value of the triplicates (cells per spot). Median scores or values were used for correlation and survival analyses. Quantifications of F4/80, CD206, CD8, Ly6G, MPO, Foxp3, Ki-67, caspase-3, and CD31 staining in xenograft tumors were calculated as positive cells per field at 200× magnification in five areas of each slide.
Cell lines and animals
Mouse breast cancer cell lines 4T1 (ATCC, USA) and E0771 (CH3 BioSystems, USA) and human TNBC lines SUM1315 (Asterand, UK) and BT549 (ATCC) were used in this research. Human cell line HEK 293T and mouse macrophage cell line RAW264.7 (ATCC) were also used, as previously described[15]. These cell lines were routinely maintained in our laboratory.
Female BALB/c and C57BL/6 mice (5–6 weeks old; Shanghai SLAC Laboratory Animal Company, China) were used and housed under pathogen-free conditions. All animal experiments were approved by the Animal Ethics Committee of Ruijin Hospital and performed according to the “Guide for the Care and Use of Laboratory Animals” by the National Academy of Sciences (Washington, DC, USA).
Vectors and transfection
For stable expression of short hairpin RNAs (shRNAs), pLKO.1-shTAZ and pLKO.1-shIL-34 lentiviral vectors (Addgene, USA) were transfected into 4T1, E0771, SUM1315, and BT549 cells. A pCDH-IL-34 lentiviral vector (Addgene) was also transfected into TAZ-silenced 4T1 and E0771 cells to restore IL-34 expression. Moreover, an HA-TAZ-S89A lentiviral vector (Addgene) was used for overexpressing TAZ, as previously described[16]. Stably transfected clones were validated by real-time quantitative polymerase chain reaction (RT-qPCR) and western blot (WB). The targeting sequences of shRNAs, IL-34 overexpression, and TAZ S89A are listed in Table 4.
Table 4
shRNA, IL-34 overexpression and TAZ S89A primer sequences.
Gene | Sequences (5' → 3') |
sh-TAZ 1# | CAGCCGAATCTCGCAATGAAT |
sh-TAZ 2# | CCTGCATTTCTGTGGCAGATA |
sh-TAZ 3# | GTGATGAATCAGCCTCTGAAT |
sh-IL-34 1# | ACCGGCTTCAGTACATGAAAC |
sh-IL-34 2# | CTCACGTGGAAGCTGTGTTAT |
sh-IL-34 3# | AGCCCATGGGCCAGATCATTT |
IL-34 | Forward | ATGCCCTGGGGACTCGCCTGG |
| Reverse | TCAGGGCAACGAGCCATGGCTT |
TAZ S89A | Forward | ATGCCCCTCCATGTGAAGTG |
| Reverse | CTATCTTCCAGGCTGGAAATGA |
IL-34: interleukin 34; shRNA: short hairpin RNA; TAZ: transcriptional coactivator with PDZ-binding motif. |
Protein extraction and WB
The cells and tissues were lysed with radioimmunoprecipitation assay buffer (RIPA) (Beyotime, China), and the protein level in the lysates was quantified using an enhanced bicinchoninic acid assay (BCA) kit (Thermo Scientific, USA). WB was performed as described previously[17]. The primary antibodies used are listed in Table 3.
RT-qPCR and RT2 profiler PCR array
Xenograft tumors and cultured cells were lysed with TRIzolTM reagent (Invitrogen, USA), and RNA was isolated according to the manufacturer’s instructions. RT-qPCR was performed using SYBR Green Realtime PCR Master Mix (Takara, Japan) in the ABI PRISM 7900 Sequence Detection System (Applied Biosystems, USA). Primer sequences for RT-qPCR analysis are shown in Table 5.
Table 5
Primers for RT-qPCR used in this study.
Gene | Sequences (5' → 3') |
mTAZ | Forward | CATGGCGGAAAAAGATCCTCC |
| Reverse | GTCGGTCACGTCATAGGACTG |
mIL-34 | Forward | TTGCTGTAAACAAAGCCCCAT |
| Reverse | CCGAGACAAAGGGTACACATTT |
mPD-1 | Forward | ACCCTGGTCATTCACTTGGG |
| Reverse | CATTTGCTCCCTCTGACACTG |
mPD-L1 | Forward | GCTCCAAAGGACTTGTACGTG |
| Reverse | TGATCTGAAGGGCAGCATTTC |
mPD-L2 | Forward | CTGCCGATACTGAACCTGAGC |
| Reverse | GCGGTCAAAATCGCACTCC |
mCTLA-4 | Forward | GCTTCCTAGATTACCCCTTCTGC |
| Reverse | CGGGCATGGTTCTGGATCA |
mTIM-3 | Forward | TCAGGTCTTACCCTCAACTGTG |
| Reverse | GGGCAGATAGGCATTTTTACCA |
mLAG-3 | Forward | CTGGGACTGCTTTGGGAAG |
| Reverse | GGTTGATGTTGCCAGATAACCC |
mIL-1B | Forward | GCAACTGTTCCTGAACTCAACT |
| Reverse | ATCTTTTGGGGTCCGTCAACT |
mIL-12B | Forward | TGGTTTGCCATCGTTTTGCTG |
| Reverse | ACAGGTGAGGTTCACTGTTTCT |
miNOS | Forward | GTTCTCAGCCCAACAATACAAGA |
| Reverse | GTGGACGGGTCGATGTCAC |
mArg1 | Forward | CTCCAAGCCAAAGTCCTTAGAG |
| Reverse | AGGAGCTGTCATTAGGGACATC |
mIL-10 | Forward | GCTCTTACTGACTGGCATGAG |
| Reverse | CGCAGCTCTAGGAGCATGTG |
mCD206 | Forward | CTCTGTTCAGCTATTGGACGC |
| Reverse | CGGAATTTCTGGGATTCAGCTTC |
mTGF-β1 | Forward | CTCCCGTGGCTTCTAGTGC |
| Reverse | GCCTTAGTTTGGACAGGATCTG |
hTAZ | Forward | GATCCTGCCGGAGTCTTTCTT |
| Reverse | CACGTCGTAGGACTGCTGG |
hIL-34 | Forward | CCTGGCTGCGCTATCTTGG |
| Reverse | AGTGTTTCATGTACTGAAGTCGG |
hPD-L1 | Forward | TGGCATTTGCTGAACGCATTT |
| Reverse | TGCAGCCAGGTCTAATTGTTTT |
Arg1: arginase 1; CTLA-4: cytotoxic T-lymphocyte associated protein 4; IL-1B: interleukin 1B; IL-10: interleukin 10; IL-12B: interleukin 12B; IL-34: interleukin 34; iNOS: inducible nitric oxide synthase; LAG-3: lymphocytes activation gene 3; PD-1: programmed death 1; PD-L1: programmed death ligand 1; PD-L2: programmed death ligand 2; TAZ: transcriptional coactivator with PDZ-binding motif; TGF-β1: transforming growth factor beta 1; TIM-3: T-cell immunoglobulin and mucin domain-containing protein 3. |
Immune genes in xenograft tumors or TNBC cells with stable TAZ silencing and their control transfectants were screened using the RT2 Profiler PCR Array System (RayBiotech, USA) and SYBR Green Realtime PCR Master Mix (Takara) in the ABI PRISM 7900 Sequence Detection System (Applied Biosystems), according to the manufacturer’s instructions.
Macrophage proliferation assay
Macrophage proliferation was analyzed using Cell Counting Kit-8 (Dojindo, Japan). Cultured cells (RAW264.7) were dispensed into a 96-well plate at a density of 1000 cells/well, with or without a different level of IL-34 protein (Sino Biological, China) or conditioned medium (CM) from TNBC cells. To assess the IL-34-induced p38 and mTOR signaling pathways, the cells were treated with the CSF-1R inhibitor pexidartinib (AbMole, USA), the p38 inhibitor SB203580 (MedChemExpress, USA), or the mTOR inhibitor AZD8055 (MedChemExpress). At the indicated time points, the absorbance at 450 nm was measured to determine the number of viable cells in each well.
Macrophage chemotactic migration assay
Macrophage chemotactic migration assay was performed using a 24-well Transwell system, with upper and lower culture chambers separated by 8µm pore polycarbonate membranes (Corning, USA), as previously described[18]. The bottom chamber was filled with IL-34 protein in Dulbecco’s modified eagle’s medium (DMEM) (Hyclone, USA) containing 10% fetal bovine serum (Gibco, USA) or CM from TNBC cells. In the upper chambers, macrophages (RAW264.7, 5 × 104 cells/well) suspended in DMEM were seeded and then incubated for 24 h. Macrophages that migrated to the lower surface of the membrane were fixed in 4% paraformaldehyde, stained with Giemsa, and then photographed and counted with a light microscope (Leica). To assess the IL-34-induced p38 and mTOR signaling pathways, the cells were treated with selective inhibitors. The chemotactic index was calculated as the number of macrophages that migrated to IL-34 of the CM from TNBC cells divided by the number of macrophages that migrated to DMEM alone[19].
Macrophage isolation
For TAM isolation, xenograft tumors were collected and digested into single-cell suspensions as previously described[20], and macrophages were isolated using Anti-F4/80 MicroBeads (Miltenyi Biotec, Germany) according to the manufacturer’s instructions.
Co-culture assay
A 6-well Transwell system with 0.4µm pore polycarbonate membranes (Corning) was used for the co-culture assay. TAMs (1 × 105 cells/well) isolated from xenograft tumors were seeded in the upper chambers and co-cultured with 4T1 or E0771 cells (1 × 105 cells/well) in the lower chambers for 48 h. The 4T1 or E0771 cells were re-plated and cultured, and after 12 h, supernatants were collected for further analysis.
Flow cytometry analysis
Xenograft tumors were dissected into small pieces and further digested into single cell suspensions. Cells were stained with antibodies and analyzed by flow cytometry (Epics Altra, USA) according to the manufacturer’s instructions. The antibodies used are listed in Table 3.
Enzyme-linked immunosorbent assay and cytokine array analysis
IL-34 levels in cell culture supernatants were assessed using the mouse or human IL-34 enzyme-linked immunosorbent assay (ELISA) kit (RayBiotech) according to the manufacturer’s instructions. Briefly, a sample solution was added to each well and incubated with an IL-34 conjugate. A substrate solution was then added, and the absorbance was analyzed using a microplate spectrophotometer (Bio-Rad, USA). A curve of the absorbance according to the IL-34 level in the standard wells was formulated.
The sample solution was collected from the cell culture supernatants of TAMs and then incubated with a biotinylated detection antibody cocktail and Cy3 equivalent dye-conjugated streptavidin from a mouse cytokine array (RayBiotech). The signals were visualized with a microarray laser scanning system (GenePix, USA).
Phospho-kinase array analysis
The IL-34-induced downstream signaling pathways were analyzed using the mouse phosphorylation pathway array (RayBiotech). The protein lysate was incubated with the array membrane, and signaling proteins were visualized using a chemical fluorescence detection system (Bio-Rad) according to the manufacturer’s instructions.
In vivo tumor growth and metastasis assay
For the xenograft tumor growth model, 4T1 or E0771 cells were orthotopically implanted into the mammary fat pad of BALB/c or C57BL/6 mice (1 × 105 cells/mouse). Tumor growth was monitored every 3 days, and tumor volume was calculated using the following formula: volume = (width)2 × length ÷ 2. Tumor growth was visualized with a bioluminescence-based IVIS imaging system (Caliper Life Sciences, USA). Mice were sacrificed after 4 weeks, and tumor weight was then assessed and fixed in 4% paraformaldehyde solution for hematoxylin-eosin (H&E) and IHC staining.
For the metastatic model, 4T1 or E0771 cells were injected into the tail veins of BALB/c or C57BL/6 mice (5 × 104 cells/mouse). Four weeks later, the mice were sacrificed and the lungs were fixed in 4% paraformaldehyde solution for H&E staining. The number and the largest size of lung metastatic nodules were evaluated under a microscope (Leica).
For drug treatment, mice were randomly divided into four groups: immunoglobulin G (IgG) (Bio X Cell, USA) group (control), pexidartinib group, anti-PD-L1 group, and pexidartinib plus anti-PD-L1 group. Pexidartinib (40 mg/kg, AbMole) was given orally for 5 days every week, and anti-PD-L1 antibody (200µg/mouse, Bio X Cell) was injected intraperitoneally every 3 days.
Immunofluorescence
Briefly, slides were fixed in 4% paraformaldehyde for 15 min and then blocked with PBS containing 1% bovine serum albumin and 0.15% glycine for 1 h at room temperature. The slides were incubated with primary antibodies overnight at 4°C, and then incubated with Alexa Fluor secondary antibodies (Thermo Scientific) for 2 h. After rinsing with PBS, the slides were counterstained with 4′,6-diamidino-2-phenylindole and evaluated by fluorescence microscopy (Leica).
Luciferase reporter assay
Cells with a stable knockdown of TAZ or S89A mutant TAZ and their control transfectants were plated into 24-well plates and transfected with pGL3-luciferase reporter plasmid and SV40 Renilla luciferase plasmid (Promega, USA). Cells were lysed and the luciferase activity was detected with a dual luciferase assay (Promega) according to the manufacturer’s instructions.
Chromatin immunoprecipitation
Cells were crosslinked with 1% formaldehyde and incubated for 10 min at room temperature. Glycine was added into the medium for 10 min at room temperature to stop the crosslinking. After that, the cells were washed, lysed, resuspended, and sonicated to an average length of 500 base pairs. After centrifugation, the samples were incubated with primary antibodies (anti-TAZ, #4883, Cell Signaling Technology, UK; IgG-coated Dynabeads Protein A, #10001D, Invitrogen) overnight at 4°C, and then incubated with protein A/G beads at 4°C for 2 h. Magnetic beads were washed with lysis buffer twice, high salt buffer twice, LiCl buffer once, and TE buffer once successively on ice, and eluted with elution buffer. The eluents were reverse-crosslinked by adding 2 µL of 10 mg/mL RNase A at 37 for 1 h and 2 µL of 20 mg/mL protease K at 50°C for 1 h. De-crosslinked DNA was purified with a DNA purification kit (Qiagen, Germany) and eluted in nucleic acid-free water. RT-qPCR analysis was used to measure the enrichment of specific promoter regions. The RT-qPCR primers used for chromatin immunoprecipitation (ChIP) are shown in Table 6.
Table 6
Primer sequences for IL-34 and PD-L1 promoter used for ChIP.
ChIP primers | Sequences (5' → 3') |
Primers for IL-34 promoter ChIP |
Primer 1 (-1053 ~ -804) | Forward | GCTTTTGTGGAGGGCCTTTG |
| Reverse | GTAAAGGGCCACTCAAGGGA |
Primer 2 (-509 ~ -352) | Forward | GCACAGGGCCTTGTCACTAT |
| Reverse | CGCAGGGAGGTAGTTTACCC |
Primers for PD-L1 promoter ChIP |
Primer 1 (-660 ~ -414) | Forward | ATGGCCCATTTCTGAGACCC |
| Reverse | TTTTGGGTGGGAGTGGAACC |
Primer 2 (-1324 ~ -1142) | Forward | CAGCGGACACCCCAGTATTC |
| Reverse | TGCGAACTGGAAGTGTGGAC |
ChIP: chromatin immuno-precipitation assay; IL-34: interleukin 34; PD-L1: programmed death ligand 1. |
Bioinformatics and statistical analysis
RNA-seq data for TNBC patients and corresponding clinical information were downloaded from The Cancer Genome Atlas (TCGA) dataset. Meanwhile, the immune scores and the abundance of immune cells were estimated by Immune Cell Abundance Identifier (ImmuCellAI)[21]. According to the immune infiltration score, TNBC samples were divided into high- and low- infiltration group to analyze the activity of conserved YAP signature by GSVA algorithm[22].The cBioPortal for Cancer Genomics, a web-based tool for analyzing RNA-Seq data from The Cancer Genome Atlas (TCGA), was used to evaluate the correlation between the mRNA expression of TAZ and cytokines/chemokines in the TCGA cohort[23]. The Kaplan-Meier Plotter, a web-based application, was used to assess the impact of TAZ expression on the prognosis of TNBC patients[24].
Statistical analysis was performed using GraphPad Prism 7 (GraphPad, USA) and SPSS 22.0 (SPSS Inc., USA). Quantitative data were presented as means and standard errors of the mean, and qualitative values were shown as numbers. Unpaired Student’s t test, one-way analysis of variance (ANOVA), or two-way ANOVA was performed for quantitative data as appropriate. The chi-squared test or Fisher’s exact test was applied to analyze the correlation between qualitative variables, and Pearson’s correlation test to analyze the correlation between quantitative variables. Kaplan-Meier curves were used to assess the impact of prognostic factors on patient survival. Two-sided P < 0.05 was considered statistically significant and was marked as * P < 0.05, ** P < 0.01, *** P < 0.001.