Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function

doi:10.21203/rs.3.rs-5258943/v1

Download PDF

Research Article

Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function

https://doi.org/10.21203/rs.3.rs-5258943/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

Aortic dissection (AD) represents a critical medical condition characterized by a high mortality rate and limited therapeutic options. The pathogenesis of AD is associated with the extracellular matrix degradation, phenotypic switching and the loss of vascular smooth muscle cells (VSMCs). Berberine (BBR) has demonstrated promising protective effects in various cardiovascular diseases, but its impact on AD and the underlying mechanisms remains unexplored. This study aims to investigate the potential of BBR in reducing the development of AD and preventing the phenotypic transformation of VSMCs, thereby proposing a novel therapeutic strategy for this life-threatening condition.

Methods

C57BL/6J mice and isolated VSMCs were used as in vivo and in vitro models, respectively. An AD mouse model was established through intragastric administration of β-aminopropionitrile monofumarate (BAPN), and VSMC phenotypic transformation was induced by angiotensin II (Ang-II) to assess the preventative effects of BBR.

Results

BBR significantly mitigates AD in a BAPN-induced mouse model by reducing AD incidence from 80–45% and increasing survival rates from 50–70%. BBR treatment alleviates aortic dilation and improves aortic morphology, while also attenuating extracellular matrix degradation, as evidenced by reduced collagen type I and fibronectin degradation. Histological and immunohistochemical analyses reveal that BBR diminishes inflammation, as indicated by reduced IL-6 and HIF-1α expression, and mitigates oxidative stress by lowering MDA levels and enhancing SOD activity. Additionally, BBR counteracts VSMC phenotypic transformation and apoptosis, demonstrated by restored contractile protein levels and reduced caspase-3, AKT, and PI3K levels. It also inhibits VSMC proliferation, migration, and MMP expression in vitro, highlighting its protective role against AD progression.

Conclusion

BBR exhibits protective effects against BAPN-induced AD in C57BL/6J mice, highlighting its potential as a viable and innovative therapeutic option for preventing AD progression.

aortic dissection

BAPN

Berberine

inflammation

oxidative stress

VSMC

Aortic dissection (AD) is among the most prevalent aortic disease, characterized by a tear in the intima layer of the aorta, which leads to the formation of an intramural hematoma and subsequent vessel wall splitting. The aorta comprises three layers: the intima (inner), media (middle), and adventitia (outer)[1]. Currently, emergency surgery is the recommended treatment for AD; however, the mortality rate remains significant. Although the prognosis of AD has improved with new instruments and technologies, no specific early diagnostic tools or effective therapeutic drugs are available[2]. Therefore, preventing AD and elucidating its molecular mechanism are of paramount importance.

The primary pathological change in vascular remodeling associated with AD is medial degeneration, characterized by vascular smooth muscle cell (VSMC) depletion and extracellular matrix (ECM) degradation [3]. VSMCs are crucial for maintaining vessel integrity and controlling the vascular tone, essential for normal function and maintenance of aortic walls. Under pathological conditions, contractile VSMCs transform into an active synthetic state, leading to increased VSMC migration and an increase in bulk ECM deposition and/or dysregulated expression of certain ECM components. Matrix metalloproteinases (MMPs), a group of proteolytic enzymes, degrade various ECM components and hence play a critical role in vascular remodeling[4]. Elevated MMP expression is observed in AD model, linking MMPs to development through ECM degradation [5]. Collagen and elastin are key structural proteins that maintain aortic wall integrity[6]. Inflammation is another significant mechanism in AD pathogenesis and is often interdependent with hypoxia [7]. Hypoxia-inducible factors (HIFs), particularly HIF-1, are activated in response to the hypoxic and inflammatory microenvironment [8]. Additionally, oxidative stress contributes to AD occurrence and progression [9]. Therefore, VSMC phenotypic transformation, oxidative stress, inflammation and structural remodeling of the aortic wall are crucial factors in AD development.

Berberine (BBR), the principal bioactive ingredient of Rhizoma coptidis (also named 'Huang Lian' in Chinese), is a natural alkaloid with numerous medicinal properties [10]. Its antioxidant, anti-proliferative, and anti-inflammatory actions inhibit aberrant cell behaviors [11, 12]. BBR has demonstrated various beneficial effects on the cardiovascular system, including normalizing endothelial function, anti-apoptotic effects, and inhibition of autophagy activation [10]. Studies have also shown that BBR inhibits human aortic smooth muscle cell (HASMC) migration by down-regulating MMP-2 and MMP-9 [13]. These pathogenic factors are closely related to AD pathogenesis. Therefore, BBR may be an endogenous protective molecule that maintains aortic homeostasis. However, its role in aortic diseases is not fully understood. This study aims to investigate berberine’s role in aortic dissection.

2.1. Murine aortic dissection models and dosing regimen

Wildtype C57BL/6J mice were purchased from the GemPharmatech Co., Ltd (Chengdu, China). This study was approved by the Academic Committee of Southwest Minzu University (2023MDLS059). The AD model was induced using β-aminopropionitrile (BAPN), obtained from Macklin (Shanghai, China). Male C57BL/6J mice (3 weeks old, weighing 8–10 g) were fed a normal diet. The sample size was determined based on previous experiments and experimental strategy. Sixty experimental mice were used and randomly categorized into three groups: control group (n = 20), BAPN group (n = 20), and BAPN + BBR group (n = 20). The control group received 0.2 ml of pure water via gavage. The BAPN group received 0.2 ml of BAPN (gavage, diluted in pure water, 1 g/kg/day). The BAPN + BBR group received 0.2 ml of BAPN and BBR (gavage, 100mg/kg/d, diluted in pure water). All experimental mice were diagnosed with AD based on the following criteria: at autopsy, tearing of the aortic wall with blood intrusion resulting in the separation of the aortic wall layers and the formation of a false lumen or mass of blood clot. Aortic rupture was defined as hemorrhage into the adjacent body cavity resulting in premature death [14].

2.2. Survival rates, incidence of AD and body weights of mice

Body weight was measured weekly for all mice. During the experimental periods, animal survival status, time of death, and cause of death were recorded. All mice were euthanized at the end of experiment (day 28). The mice were anesthetized, and the thoracic cavity was opened by careful dissection. After removing the surrounding tissues under sterile conditions, the extracted aortas were washed several times with sterile saline to remove residual blood. The aortic tissue was then measured and harvested for subsequent experiments.

2.3. Determination of plasma superoxide dismutase (SOD) activity and malondialdehyde (MDA) levels

Blood samples were centrifuged at 3000 g for 20 minutes, and the supernatant was collected and kept at 4°C until the experiments began. Plasma SOD activity was determined using a SOD assay kit (Solarbio, Beijing, China) according to the manufacturer’s instructions. Absorbance at 560 nm was measured to calculate protein concentration as U per ml. Plasma MDA levels were determined using an MDA assay kit (Solarbio, Beijing, China) according to the manufacturer's instructions. Absorbance of the supernatant was measured at 450nm, expressed in nmol per ml of protein.

2.4. Histology, immunohistochemistry, and immunofluorescence

Whole mouse aorta tissue samples were fixed in 4% paraformaldehyde for 48 hours, embedded in paraffin, and sliced into 4 µm thick sections. Hematoxylin and eosin (H&E) staining was used to determine the tissue morphology. The integrity of the aortic wall elastin was evaluated by elastic Verhoeff-Van Gieson (EVG) staining. Degradation of medial elastic lamina was scored based on an elastin degradation-grading system. Immunohistochemistry was performed to observe IL-6 and HIF-1 staining, and the number of IL-6 and HIF-1 positive cells was analyzed using the ImageJ (Version 1.46). Immunofluorescence was performed to observe staining with SM22α, α-SMA, Collagen type 1(COL1a1) and fibronectin (FN).

2.5. In vitro cell viability assay

After trypsin digestion, vascular smooth muscle cells (MOVAS, jennio-bio, China) in suspension were seeded into a 96-well plate at a density of 7×10⁴ cells/ml. After 24 hours of incubation, different doses of BBR (150µM, 200µM, 300µM) and angiotensin-II (Ang-II, 1µM) were added. Cell proliferation was detected using a cell counting kit-8 (CCK-8, Dojindo, Shanghai, China) after 24 hours of culture at 37°C, 5% CO₂. VSMCs were treated with CCK-8 solution at a final concentration of 10% for 1 − 2 hours at 37°C, and absorbance was measured at 450 nm using a microplate reader (SPARK, TECAN).

2.6 In vitro cell migration assays

VSMCs migration was evaluated using scratch wound healing assays[15]. VSMCs were inoculated in 6-well plastic plate and cultured to 80–90% confluence. The monolayer cells were wounded by 1 ml pipette tips to produce “scratches” and washed 3 times with PBS to remove the non-adherent cells. The scratched VSMCs were treated with Ang-II (1µM), with or without BBR (150µM, 200µM, 300µM), for 48 hours. The conformation of cells was recorded at 48 hours by photographing. The distance between two edges of “scratches” was measured using ImageJ, and the reduction in distance indicated cell migration.

2.7. Cell apoptosis detection

The terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) assay was employed to analyze apoptosis[16]. Cells were cultured with or without BBR (150µM、200µM、300µM) for 24 hours and then challenged with Ang-II (1µM) for one day. After incubation, the cells samples were washed twice with PBS and fixed with 4% paraformaldehyde for 0.5 hours. Slides were then stained using a Colorimetric TUNEL Apoptosis Assay Kit (Keygen, KGA7063, Jiangsu, China) according to the manufacturer’s protocol. Light microscopy was used to observe the cover slips. Three randomly selected fields from each cover slip were analyzed to determine the percentage of TUNEL-positive cells.

2.8. Western blotting analysis

Total protein was isolated from VSMC or mouse aortic tissue using RIPA lysis buffer. Lysates with the same protein content (determined by the BCA method; Keygen, KGA902) were prepared. Proteins were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore). After blocking for 1.5 hours in 5% skim milk powder, the bands were incubated overnight at 4°C with primary antibodies, followed by incubation with secondary antibodies (1:5000) for 2 hours at room temperature. The bands were scanned and detected by a chemiluminescence instrument (bio-rad ChemiDoc Touch) with Chemiluminescent HRP Substrate (Keygen, KGP116). ImageJ was used to quantify the intensity of the bands. The following primary antibodies were used: anti-MMP9 (Abcam, ab283575), anti- MMP2 (Abcam, ab181286), anti-OPN (Proteintech, 25715-1-AP), anti-Bax (Proteintech, 50599-2-AP), anti-Bcl2 (Abcam, ab182858), anti-AKT (servicebio, GB111114), anti-Caspase3 (servicebio, Servicebio), anti-HIF-1 (servicebio, GB111339), β-actin (servicebio, GB11001), anti-GAPDH (Keygen, KGAA002).

2.9. Quantitative real-time PCR (RT-qPCR)

Total RNA was isolated using TRIzol (Invitrogen, 15596-026), and cDNA was synthesized using a commercial kit (TaKaRa, RR036B) following the instructional manual. RT-qPCR was performed using the Takara kit (TaKaRa, RR820A) on the ABI StepOne Plus Real-Time PCR system. The relative expression of each gene was normalized to the GAPDH gene and analyzed with 2-ΔΔCT method. Primers used in the study are shown in Table 1.

Table 1

Primers for real-time PCR GAPDH gene forward and reverse
Gene	Forward	Reverse
MMP2	CAAGTTCCCCGGCGATGTC	TTCTGGTCAAGGTCACCTGTC
MMP9	CTGGACAGCCAGACACTAAAG	CTCGCGGCAAGTCTTCAGAG

2.10. Statistical analysis

Data were analyzed using GraphPad Prism version 8.0 (GraphPad Software, San Diego, CA). Results are presented as mean ± standard deviation (SD). Groups comparisons were based on the analysis of variance (ANOVA) and Student’s t-test or one-way ANOVA followed by Dunnett's post hoc test, with p values less than 0.05 considered statistically significant.

3.1. Berberine suppresses AD formation following BAPN induction

We utilized a BAPN-induced AD model to investigate the role of BBR in aortic degeneration. Three-week-old male C57BL/6 mice were pretreated with BBR (gavage, 100mg/kg/d, diluted in pure water) and BAPN (gavage, 1 g/kg/day, diluted in pure water) for four weeks. During this period, the incidence of AD was 80% (16/20) during 4-week BAPN administration period, whereas BBR treatment reduced the incidence to 45% (9/20) (Fig. 1A). By the fourth experimental week, the control group had gained significant weight, while the BAPN group experienced significant weight loss compared to the control group (Fig. 1B). A significant difference in survival rates was observed between the BAPN and BAPN + BBR groups, with BBR treatment increasing the survival rate (70% vs. 50%) (Fig. 1C). Additionally, BAPN induction significantly increased the maximum internal diameter of the thoracic aorta compared to the control group. BBR notably improved the aortic morphology of BAPN-treated mice and reduced aortic dilation (Fig. 1D-E). Histologic examination revealed false lumen formation, destruction of the media, and marked thickening of the adventitia in the BAPN group (Fig. 1F). However, these changes were significantly attenuated by BBR treatment. The elastin score of the experimental mice increased significantly after BAPN administration, and BBR treatment mitigated the breakage of elastic fibers (Fig. 1F-G).

3.2. BBR blunts extracellular matrix degradation of the aorta

Elastic fibers and collagen fibers are the main components of the ECM, which are essential for the development and structural integrity of the blood vessel wall [17]. Degradation of ECM under pathological conditions can lead to aortic dissection and aneurysm. To assess collagen type I (COL1a1) and fibronectin (FN) deposits in the aorta, immunofluorescence staining was performed. Compared to the control group, the degradation of COL1a1 and FN was intensified in the BAPN group, while BBR treatment reduced their degradation (Fig. 2A-B).

3.3. BBR inhibits the accumulation of inflammatory cells and HIF-1α expression and oxidative stress in BAPN induced AD mice aorta

To investigate the impact of inflammatory cell infiltration (IL-6) on aortic tissue, we examined the expression of IL-6 in proximal aortic tissue from BAPN group and nondissected controls. Immunohistochemical analysis of aortic cross-sections revealed that IL-6 was predominantly localized to the adventitia and media-adventitia border in the BAPN group, with lesser expression in the intima (Fig. 3A-B). Consistent with previous findings, the adventitia represents the source of the most abundant local IL-6 cytokine production in vascular inflammation[18]. After BBR treatment, the positive expression of IL-6 in BAPN + BBR group decreased significantly (Fig. 3A-B). In most cardiovascular diseases, local lesions are hypoxic. Therefore, we evaluated HIF-1α expression in the medial region of the thoracic aorta in mice with aortic dissection. The BAPN group had significantly more HIF-1α positive cells than the control group, whereas BBR significantly reduced the number of HIF-1α positive cells (Fig. 3C-D). Similarly, significantly increased HIF-1α expression in BAPN group was also observed. However, BAPN + BBR group significantly reduced HIF-1α protein expression compared with the BAPN group (Fig. 3E-F). Oxidative stress is involved in the occurrence and development of AD. To assess whether BBR acts as an antioxidant in the aorta during AD, we measured the levels of SOD and MDA. Compared with the control group, the antioxidant enzyme SOD activity in the aorta of the BAPN group decreased, while the oxidative stress marker MDA level increased. BBR reduced MDA levels and upregulated SOD activity in BAPN-induced mice (Fig. 3G-H).

3.4. BBR regulate contractile protein degradation and mitigates cell death of aortic dissection

VSMCs in the aorta’s media are the main cell types that provide the structure and function of the aortic wall integrity. In response to external environmental stimulus and pathological conditions, VSMCs can switch between contractile and synthetic phenotypes and participate in the occurrence of AAD/AAA. Immunofluorescence staining was performed on the aorta of mice to detect contractile markers (α-SMA and SM22α). α-SMA and SM22α levels were significantly decreased in the BAPN group compared to the control group. However, treatment with BBR partially reversed the synthetic phenotypic transformation of BAPN-induced VSMCs, as indicated by the upregulation of SM22α and α-SMA (Fig. 4A). Furthermore, WB analysis was conducted to measure levels of caspase-3, AKT and PI3K in the aorta. The WB results demonstrated that, compared to the control group, the BAPN group showed a significant increase in the level of caspase-3, AKT and PI3K. In contrast, the BAPN + BBR group exhibited a decrease in caspase-3, AKT and PI3K levels compared to the BAPN group (Fig. 4B-4F). Additionally, a marked decrease in the expression of p-AKT and p-PI3K was observed in the BAPN group, while substantial restoration of both p-AKT and p-PI3K levels was noted in the BAPN + BBR group, bringing them closer to the levels observed in the control group (Fig. 4G-4I).

3.5. BBR Inhibited the proliferation and migration in Ang-II induced VSMCs

To investigate the functional impacts of BBR on VSMC proliferation and migration, different concentrations of BBR were used to stimulate VSMCs. Both VSMC proliferation and migration play important roles in the progression of AD. For this assay, Ang-II was administered to vascular smooth muscle cells to promote the phenotype transformation, which has been described in many studies[3]. The results in our study showed that Ang-II treatment significantly promoted the proliferation of VSMCs. However, BBR pretreatment significantly attenuated the effect of Ang-II on VSMC proliferation (Fig. 5A). We performed in vitro scratch wound healing assays on cultured VSMC. The test results showed a significant increase in VSMC migration after treatment with Ang-II compared to the control group. However, BBR’s group significantly inhibited Ang-II induced VSMC migration distance (Fig. 5B-C).

3.6. BBR ameliorates phenotypic switch and MMP expression in Ang-II induced VSMC

To determine whether BBR contributes to phenotypic transformation of aortic smooth muscle cells in vitro, we examined phenotypic transformation markers of OPN (synthetic phenotype). It was found that BBR decreased OPN in Ang II- treated VSMC (Fig. 6A-B). Additionally, MMPs are major enzymes involved in extracellular matrix degradation. Elevated levels of MMP-2 and MMP-9 suggest extracellular matrix degradation. WB analysis revealed increased MMP-2 and MMP-9 protein expression in Ang-II treatment, which was rescued by BBR administration (Fig. 6C-E). Meanwhile, RT-PCR analysis also concluded that BBR treatment significantly inhibited Ang-II-induced levels of MMP2 and MMP9 (Fig. 6F-G).

3.7. BBR inhibited the apoptosis of VSMCs

VSMC apoptosis is another major contributor to vascular disease. TUNEL assay was conducted in VSMCs to determine whether BBR plays a role in VSMC apoptosis. The results showed that Ang II treatment significantly increased apoptosis, while BBR significantly decreased Ang II-induced apoptosis (Fig. 7A-B). Additionally, the expression levels of Bax and Bcl2 molecules in VSMCs treated with Ang-II were also examined. The results showed that Ang-II significantly down-regulated the expression of Bcl2 protein and up-regulated the expression of Bax protein, which was altered after BBR administration (Fig. 7C-E).

This study is the first to explore the potential of BBR in mitigating the development of AD in a mouse model. Due to the increasing use of endovascular approaches, surgical thoracic aortic dissection (TAD) specimens have become rare [19], with most available data limited to advanced disease stages, with no comparable normal controls. Consequently, animal models are indispensable for clinical research into AD pathology. BAPN is widely used in immature and fast-growing animals to induce AD, mimicking clinical AD development, including intimal injury, hematoma, and aortic rupture [20]. BAPN-induced AD models include[21]: 1) BAPN alone inducing TAD, 2) sequential BAPN and Ang-II administration inducing TAD, and 3) co-administration of BAPN and Ang-II inducing TAD. While BAPN is commonly administered via drinking water, variability in this method led us to develop an improved protocol by administering BAPN via gavage to three-week-old C57BL/6J mice, ensuring accurate daily dosing. Our results showed that BAPN enlarged the aortic diameter from the root to the thoracic segment, resulting in hematoma and affecting the growth and development. This method proved reliable and simple, with a high success rate in experimental verification.

BBR, an alkaloid with strong pharmacological activity, shows promise in preventing and treating cardiovascular diseases [11]. Although its effects on conditions such as atherosclerosis, hypertension and heart failure are well-documented, its impact on AD remains unclear. Our study provides the first evidence of BBR’s inhibitory effects on AD progression. Specifically, BBR reduced AD incidence, inhibited aortic dilatation, improved aortic morphology and increased survival in BAPN-induced AD model mice. These findings suggest BBR therapy could be a novel therapeutic option for AD prevention.

ECM abnormalities play a critical role in AD pathology [3]. Abnormal ECM remodeling leads to unregulated cell proliferation, differentiation, and adhesion, causing developmental defects[22]. Elastin and collagen crosslinking are crucial for maintaining arterial structural integrity [23]. Previous studies found increased collagen deposition and elastin degradation in both TAD patients and TAD mouse models[24, 25]. Our findings revealed that BBR prevented elastin degradation, preserved collagen type I (COL1a1) and fibronectin (FN), inhibited false lumens formation, thereby maintaining aortic structure and function. Furthermore, BBR significantly inhibited Ang-II-induced expression of MMP2 and MMP9 in smooth muscle cells, which are associated with maladaptive ECM remodeling. These results suggest that BBR exerts a protective role by preventing excessive MMP secretion and ECM degradation [26], thus attenuating AD progression.

Clinical data indicate increased inflammatory cell recruitment, including macrophages, in aortic samples from patients with ascending aortic aneurysm and dissection [27]. Our results showed a significant increase IL-6 inflammatory cytokines following BAPN administration. BBR intervention reduced IL-6 levels, alleviating vascular inflammation, likely due to its anti-inflammatory activity. Previous studies linked oxidative stress to vascular damage and AD pathomechanisms [28], with increased MDA and decreased SOD expression in AD patients’ aortic tissues [29]. BBR treatment reduced MDA levels and increased SOD activity in BAPN-induced mice. Additionally, our study showed increased HIF-1α expression in the BAPN group, which BBR reduced, indicating BBR’s potential to modulate macrophage infiltration. WB results further confirmed BBR’s effect in reversing HIF-1α protein expression. These findings suggest BBR ameliorates inflammatory cell infiltration, oxidative stress, and HIF-1α expression, contributing to AD prevention.

VSMCs are the primary cellular components of the aorta [30], and pathological changes in VSMCs are closely related to various aortic diseases [31]. VSMC loss leads to pathological aortic remodeling, with phenotypic changes in response to vascular injury or disease [32]. Our study observed significant VSMC reduction in BAPN-treated mice, with decreased α-SMA and SM22α levels. BBR effectively maintained VSMCs content and inhibited the phenotypic switch from contractile to synthetic type, as indicated by decreased OPN level. Increased VSMC proliferation and migration contribute to TAD development [33], and our data showed that BBR suppressed Ang-II-induced VSMC conditions, thereby potentially ameliorating the development of TAD. Apoptosis, regulated by extrinsic or intrinsic apoptotic pathways, is crucial in various cellular processes [34, 35], with the Bax/Bcl2 ratio serving as a key indicator [36]. Our TUNEL assay results demonstrated that BBR regulates VSMC apoptosis, effectively attenuating Ang-II-induced apoptosis, by downregulating Bax and upregulating Bcl2. These results suggest BBR plays a protective role in AD development by inhibiting VSMC phenotypic switching and loss.

The PI3K/AKT signaling pathway is critical in blocking VSMC apoptosis [37]. In the presence of increased AKT and PI3K expression induced by BAPN, but with inhibited activation, BBR may counteract the adverse effects by decreasing PI3K and AKT expression while promoting their phosphorylation, thereby stabilizing the vascular wall and reducing the risk of aortic dissection formation. Additionally, the PI3K/AKT pathway is closely linked to inflammatory responses and oxidative stress[38, 39]. BBR may exert a protective effect against AD by mitigating vascular inflammation and oxidative stress through the activation of PI3K/AKT pathway.

Overall, the present work provides a comprehensive mechanism of BBR preventing AD progression through multiple targets and complex pathway. However, this study raises several issues for future investigation. The roles of VSMCs, endothelial dysfunction, and macrophage and inflammatory cell infiltration into the injured arterial wall are critical contributors to AD formation and development, warranting further research. Additionally, while we focus on the PI3K/AKT pathway, other mechanisms involved in BBR’s protective effects require exploration. Finally, the impact of BBR on other AD models, such as Marfan syndrom and Loeys-Dietz syndrome, should be investigated, despite these being beyond the scope of the current study.

BBR treatment significantly prevents the progression of AD, largely through PI3K/AKT pathway activation, reduction of oxidative stress, decreased inflammation and apoptosis, inhibition of phenotypic transformation, and improvement of ECM degradation. These results provide new insights for early medical intervention in AD patients.

Aortic Dissection

TAD

thoracic aortic dissection

ECM

Extracellular Matrix

BBR

Berberine

VSMCs

Vascular Smooth Muscle Cells

MMPs

Matrix Metalloproteinases

SOD

Superoxide Dismutase

MDA

Malondialdehyde

COL-I

Collagen Type I

COL-III

Collagen Type III

α-SMA

Alpha-Smooth Muscle Actin

SM22α

Smooth Muscle 22 Alpha

BAPN

β-Aminopropionitrile

Immunofluorescence

Hematoxylin and Eosin

EVG

Elastic Van Gieson

fibronectin

Ang-II

angiotensin-II

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Ethics approval

This study was approved by the Academic Committee of Southwest Minzu University(2023MDLS059).

Author Contributions

Tongyi Wu: Writing-original draft, Software, Methodology, Investigation, Formal analysis, Data curation. Ru Chen: Writing-original draft, Writing – review & editing, Investigation, Conceptualization. Wuyi Ban:Investigation. Chang Ren:Data curation.

Siwei Bi: Writing-review&editing. Jun Gu: Formal analysis. Zangjia Geng: Formal analysis. Lei Song:Writing-review & editing, Supervision, Conceptualization.

Data Availability

Not applicable.

Code Availability

Not applicable.

Declarations

Ethics Approval

Not applicable.

Consent to Participate

Not applicable.

Consent for Publication

Not applicable.

Competing Interests

The authors declare no competing interests.

Wang K, Zhao J, Zhang W, et al. Resveratrol Attenuates Aortic Dissection by Increasing Endothelial Barrier Function Through the SIRT1 Pathway. J Cardiovasc Pharmacol. 2020;76(1):86–93. 10.1097/fjc.0000000000000837.
Pape LA, Awais M, Woznicki EM, et al. Presentation, Diagnosis, and Outcomes of Acute Aortic Dissection: 17-Year Trends From the International Registry of Acute Aortic Dissection. J Am Coll Cardiol. 2015;66(4):350–8. 10.1016/j.jacc.2015.05.029.
Wu D, Shen YH, Russell L, Coselli JS, LeMaire SA. Molecular mechanisms of thoracic aortic dissection. J Surg Res. 2013;184(2):907–24. 10.1016/j.jss.2013.06.007.
Cui N, Hu M, Khalil RA. Biochemical and Biological Attributes of Matrix Metalloproteinases. Prog Mol Biol Transl Sci. 2017;147:1–73. 10.1016/bs.pmbts.2017.02.005.
Manabe T, Imoto K, Uchida K, Doi C, Takanashi Y. Decreased tissue inhibitor of metalloproteinase-2/matrix metalloproteinase ratio in the acute phase of aortic dissection. Surg Today. 2004;34(3):220–5. 10.1007/s00595-003-2683-3.
Yang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates β-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000–10. 10.1016/j.ejvs.2019.10.014.
Colgan SP, Taylor CT. Hypoxia: an alarm signal during intestinal inflammation. Nat Rev Gastroenterol Hepatol. 2010;7(5):281–7. 10.1038/nrgastro.2010.39.
Zhang SY, Dong YQ, Wang P, et al. Adipocyte-derived Lysophosphatidylcholine Activates Adipocyte and Adipose Tissue Macrophage Nod-Like Receptor Protein 3 Inflammasomes Mediating Homocysteine-Induced Insulin Resistance. EBioMedicine. 2018;31:202–16. 10.1016/j.ebiom.2018.04.022.
Xiao T, Zhang L, Huang Y, et al. Sestrin2 increases in aortas and plasma from aortic dissection patients and alleviates angiotensin II-induced smooth muscle cell apoptosis via the Nrf2 pathway. Life Sci. 2019;218:132–8. 10.1016/j.lfs.2018.12.043.
Feng X, Sureda A, Jafari S, et al. Berberine in Cardiovascular and Metabolic Diseases: From Mechanisms to Therapeutics. Theranostics. 2019;9(7):1923–51. 10.7150/thno.30787.
Och A, Och M, Nowak R, Podgórska D, Podgórski R. Berberine, a Herbal Metabolite in the Metabolic Syndrome: The Risk Factors, Course, and Consequences of the Disease. Molecules. 2022;27(4). 10.3390/molecules27041351.
Ai X, Yu P, Peng L, et al. Berberine: A Review of its Pharmacokinetics Properties and Therapeutic Potentials in Diverse Vascular Diseases. Front Pharmacol. 2021;12:762654. 10.3389/fphar.2021.762654.
Liu SJ, Yin CX, Ding MC, et al. Berberine suppresses in vitro migration of human aortic smooth muscle cells through the inhibitions of MMP-2/9, u-PA, AP-1, and NF-κB. BMB Rep. 2014;47(7):388–92. 10.5483/bmbrep.2014.47.7.186.
Ren P, Wu D, Appel R, et al. Targeting the NLRP3 Inflammasome With Inhibitor MCC950 Prevents Aortic Aneurysms and Dissections in Mice. J Am Heart Assoc. 2020;9(7):e014044. 10.1161/jaha.119.014044.
Park HS, Quan KT, Han JH, et al. Rubiarbonone C inhibits platelet-derived growth factor-induced proliferation and migration of vascular smooth muscle cells through the focal adhesion kinase, MAPK and STAT3 Tyr(705) signalling pathways. Br J Pharmacol. 2017;174(22):4140–54. 10.1111/bph.13986.
Moore CL, Savenka AV, Basnakian AG. TUNEL Assay: A Powerful Tool for Kidney Injury Evaluation. Int J Mol Sci. 2021;22(1). 10.3390/ijms22010412.
Lin CJ, Lin CY, Stitziel NO. Genetics of the extracellular matrix in aortic aneurysmal diseases. Matrix Biol. 2018;71–72:128–43. 10.1016/j.matbio.2018.04.005.
Tieu BC, Lee C, Sun H, et al. An adventitial IL-6/MCP1 amplification loop accelerates macrophage-mediated vascular inflammation leading to aortic dissection in mice. J Clin Invest. 2009;119(12):3637–51. 10.1172/jci38308.
Zheng HQ, Rong JB, Ye FM, et al. Induction of thoracic aortic dissection: a mini-review of beta-aminopropionitrile-related mouse models. J Zhejiang Univ Sci B. 2020;21(8):603–10. 10.1631/jzus.B2000022.
Ren W, Liu Y, Wang X, et al. beta-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. 10.1038/srep28149.
Ren W, Liu Y, Wang X, et al. β-Aminopropionitrile monofumarate induces thoracic aortic dissection in C57BL/6 mice. Sci Rep. 2016;6:28149. 10.1038/srep28149.
Ye S, Yang N, Lu T, et al. Adamts18 modulates the development of the aortic arch and common carotid artery. iScience. 2021;24(6):102672. 10.1016/j.isci.2021.102672.
Yang YY, Li LY, Jiao XL, et al. Intermittent Hypoxia Alleviates beta-Aminopropionitrile Monofumarate Induced Thoracic Aortic Dissection in C57BL/6 Mice. Eur J Vasc Endovasc Surg. 2020;59(6):1000–10. 10.1016/j.ejvs.2019.10.014.
Karimi A, Milewicz DM. Structure of the Elastin-Contractile Units in the Thoracic Aorta and How Genes That Cause Thoracic Aortic Aneurysms and Dissections Disrupt This Structure. Can J Cardiol. 2016;32(1):26–34. 10.1016/j.cjca.2015.11.004.
Milewicz DM, Guo DC, Tran-Fadulu V, et al. Genetic basis of thoracic aortic aneurysms and dissections: focus on smooth muscle cell contractile dysfunction. Annu Rev Genomics Hum Genet. 2008;9:283–302. 10.1146/annurev.genom.8.080706.092303.
Amin M, Pushpakumar S, Muradashvili N, et al. Regulation and involvement of matrix metalloproteinases in vascular diseases. Front Biosci (Landmark Ed). 2016;21(1):89–118. 10.2741/4378.
He R, Guo DC, Estrera AL, et al. Characterization of the inflammatory and apoptotic cells in the aortas of patients with ascending thoracic aortic aneurysms and dissections. J Thorac Cardiovasc Surg. 2006;131(3):671–8. 10.1016/j.jtcvs.2005.09.018.
Gavazzi G, Deffert C, Trocme C, et al. NOX1 deficiency protects from aortic dissection in response to angiotensin II. Hypertension. 2007;50(1):189–96. 10.1161/HYPERTENSIONAHA.107.089706.
Liao M, Liu Z, Bao J, et al. A proteomic study of the aortic media in human thoracic aortic dissection: implication for oxidative stress. J Thorac Cardiovasc Surg. 2008;136(1):65–72. 10.1016/j.jtcvs.2007.11.017. e1-3.
Liao WL, Tan MW, Yuan Y, et al. Brahma-related gene 1 inhibits proliferation and migration of human aortic smooth muscle cells by directly up-regulating Ras-related associated with diabetes in the pathophysiologic processes of aortic dissection. J Thorac Cardiovasc Surg. 2015;150(5):1292–e3012. 10.1016/j.jtcvs.2015.08.010.
Lacolley P, Regnault V, Nicoletti A, Li Z, Michel JB. The vascular smooth muscle cell in arterial pathology: a cell that can take on multiple roles. Cardiovasc Res. 2012;95(2):194–204. 10.1093/cvr/cvs135.
Zhang Y, Qian X, Sun X, et al. Liuwei Dihuang, a traditional Chinese medicinal formula, inhibits proliferation and migration of vascular smooth muscle cells via modulation of estrogen receptors. Int J Mol Med. 2018;42(1):31–40. 10.3892/ijmm.2018.3622.
Ren K, Li B, Liu Z, et al. GDF11 prevents the formation of thoracic aortic dissection in mice: Promotion of contractile transition of aortic SMCs. J Cell Mol Med. 2021;25(10):4623–36. 10.1111/jcmm.16312.
Häcker G. The morphology of apoptosis. Cell Tissue Res. 2000;301(1):5–17. 10.1007/s004410000193.
Su Z, Yang Z, Xu Y, Chen Y, Yu Q. Apoptosis, autophagy, necroptosis, and cancer metastasis. Mol Cancer. 2015;14:48. 10.1186/s12943-015-0321-5.
Moldoveanu T, Czabotar PE, BAX, BAK. A Coming of Age for the BCL-2 Family Effector Proteins. Cold Spring Harb Perspect Biol. 2020;12(4). 10.1101/cshperspect.a036319.
White GE, Tan TC, John AE, et al. Fractalkine has anti-apoptotic and proliferative effects on human vascular smooth muscle cells via epidermal growth factor receptor signalling. Cardiovasc Res. 2010;85(4):825–35. 10.1093/cvr/cvp341.
Li X, Huang S, Zhuo B, et al. Comparison of Three Species of Rhubarb in Inhibiting Vascular Endothelial Injury via Regulation of PI3K/AKT/NF-κB Signaling Pathway. Oxid Med Cell Longev. 2022;2022:8979329. 10.1155/2022/8979329.
Liu Q, Shan P, Li H. Gambogic acid prevents angiotensin II–induced abdominal aortic aneurysm through inflammatory and oxidative stress dependent targeting the PI3K/Akt/mTOR and NF–κB signaling pathways. Mol Med Rep. 2019;19(2):1396–402. 10.3892/mmr.2018.9720.

Download PDF

Reviewers agreed at journal
01 Nov, 2024
Reviewers invited by journal
22 Oct, 2024
Editor invited by journal
15 Oct, 2024
Editor assigned by journal
15 Oct, 2024
First submitted to journal
14 Oct, 2024

You are reading this latest preprint version

Berberine prevents the formation of aortic dissection in C57BL/6 mice through the regulation of vascular smooth muscle cell function

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials and methods

2.1. Murine aortic dissection models and dosing regimen

2.2. Survival rates, incidence of AD and body weights of mice

2.3. Determination of plasma superoxide dismutase (SOD) activity and malondialdehyde (MDA) levels

2.4. Histology, immunohistochemistry, and immunofluorescence

2.5. In vitro cell viability assay

2.6 In vitro cell migration assays

2.7. Cell apoptosis detection

2.8. Western blotting analysis

2.9. Quantitative real-time PCR (RT-qPCR)

2.10. Statistical analysis

3. Results

3.1. Berberine suppresses AD formation following BAPN induction

3.2. BBR blunts extracellular matrix degradation of the aorta

3.4. BBR regulate contractile protein degradation and mitigates cell death of aortic dissection

3.5. BBR Inhibited the proliferation and migration in Ang-II induced VSMCs

3.6. BBR ameliorates phenotypic switch and MMP expression in Ang-II induced VSMC

3.7. BBR inhibited the apoptosis of VSMCs

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Status:

Version 1