Identification and functional analysis of NPR2 truncating mutations in two Chinese families with Short Stature

doi:10.21203/rs.3.rs-5264281/v1

Download PDF

Research Article

Identification and functional analysis of NPR2 truncating mutations in two Chinese families with Short Stature

https://doi.org/10.21203/rs.3.rs-5264281/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: The signaling pathway of C-type natriuretic peptide (CNP) and its receptor (natriuretic peptide receptor 2, NPR2) is implicated in the process of endochondral ossification, which is crucial for the linear growth of long bones. Loss-of-function mutations in the NPR2 gene cause short stature. This study aimed to identify and characterize truncating mutations in NPR2 among Chinese families with short stature.

Methods: Whole-exome sequencing and Sanger sequencing were conducted to identify potential mutations. Bioinformatic analysis was utilized to assess the pathogenicity of two mutations. The effects of candidate mutation on gene expression, subcellular localization, protein stability, and protein function were further assessed through in vitro assays.

Results: In this study, A novel mutation, c.2629_2630delAG, p.S877Hfs*10 and a previously reported mutation, c.1162C>T, p.R388* (ClinVar database) in NPR2, were identified in the individuals, and these variants were inherited from the mother and father, respectively. Both mutations were predicted to be deleterious and have a significant impact on protein structure based on bioinformatics analysis. In vitro experiments demonstrated that mutant mRNAs evaded nonsense-mediated mRNA decay (NMD) to produce truncated NPR2 proteins with reduced stability and increased degradation. Furthermore, two truncated NPR2 proteins exhibited impaired localization at the cell membrane and almost completely lost their ability to stimulate cyclic guanosine monophosphate (cGMP) production in HEK293T cells compared to wild-type (WT) NPR2 (p <0.05).

Conclusion: Our study identified two loss-of-function mutations of the NPR2 gene in two Chinese families and offered new insights on the pathogenesis of short stature caused by NPR2 truncating mutations.

short stature

NPR2 gene

truncating mutations

truncated proteins

loss-of-function

Short stature (SS) is defined as a height that is at least two standard deviations (SD) below the mean for a specific population after adjusting for age and gender [1]. Approximately 80% of the variation in human height is explained by heritable factors and relatively rare single-gene mutations are involved with larger effects on stature [2, 3]. With the advancement of genetic testing technology, more and more genetic mutations associated with short stature have been detected. In a large short stature cohort, 361 mutations distributed across 111 genes were identified in 814 patients through next-generation sequencing (NGS) [4]. Moreover, in another similar study, 135 single-gene mutations were found in 561 patients with short stature by exome sequencing (ES) [5]. These mutated genes mainly affect four principal physiological processes related to short stature, namely endochondral ossification-related signaling pathways, including hormonal signaling, paracrine signaling, regulation of the cartilage extracellular matrix, and essential cellular processes [6]. Notably, the natriuretic peptide receptor 2 (NPR2) plays a significant role in the paracrine signaling pathway, and mutation within this gene exerts an important impact on stature.

The NPR2 gene is located at 9p13.3, including 22 exons, with a total length of approximately 16.5kb and a full mRNA length of about 3000bp. The NPR2, encoded by the NPR2 gene, acts as a transmembrane guanylyl cyclases and comprises four essential domains: an extracellular ligand-binding domain (ECD), a transmembrane domain, an intracellular kinase homology domain (KHD), and a guanylyl cyclase (GC) domain [7]. Physiologically active NPR2 exists as a homodimer that increases the expression of cyclic guanosine monophosphate (cGMP) upon binding to its ligand, C-type natriuretic peptide (CNP). The CNP/NPR2/cGMP signaling pathway plays a crucial role in the proliferation and differentiation of chondrocytes, thereby facilitating the endochondral ossification process, which is accountable for the longitudinal growth in limbs and vertebrae [8, 9]. Takehito et al demonstrated that NPR2 gene mouse knockout displays decreased body size, reduced chondrocyte population, and diminished chondrocyte proliferation activity [10]. In humans, the biallelic loss-of-function mutations in NPR2 result in acromesomelic dysplasia Maroteaux type (AMDM), while heterozygous mutations may account for 2–6% of idiopathic short stature [11]. The mechanism by which NPR2 mutations result in short stature is not entirely clear [12]. Some short stature associated NPR2 mutations may result in abnormal protein trafficking to the cell membrane, reduced CNP binding affinity for receptors, or inhibition of NPR2 activity [9]. However, these few studies have almost exclusively focussed on NPR2 missense mutation and very few have investigated truncating mutations of NPR2.

This study identified two heterozygous truncating mutations (c.1162C > T, p.R388* and c.2629_2630delAG, p.S877Hfs*10) in the NPR2 gene within two families through whole exome sequencing (WES). To further understand the pathogenesis of short stature caused by NPR2 truncating mutations, the bioinformatics analysis and in vitro functional approaches were performed to investigate the impact of truncating mutations on the expression, stability, subcellular localization and function of NPR2 protein.

2.1 Patients

The patients, who originated from the Department of Endocrinology, Genetics and Metabolism at the Affiliated Hospital of Jining Medical University, sought medical attention because of their short stature. The Affiliated Hospital of Economics and Medical Sciences Ethics Committee approved the study. Written informed consent was obtained from all participants or their guardians.

2.2 Clinical evaluations

Clinical evaluation encompassed anthropometric, laboratory, and imaging assessments. Height and weight were precisely measured using a stadiometer (± 0.1 cm) and an electronic scale (± 0.1 kg). Height and weight SDS were derived from standard Chinese children's data [13]. Body mass index (BMI) was calculated as weight in kilograms divided by the square of height in meters. Genetic target height was calculated as follows: genetic target height = (paternal height + maternal height)/2 + 6.5 cm [14]. Peak growth hormone (GH) was identified through levodopa and insulin hypoglycemic tests. Serum GH was quantified by chemiluminescence (Beckman Coulter, USA; sensitivity: 0.010µg/L). IGF-1 levels, determined by chemiluminescence immunoassay (SIEMENS, Germany; CVs: 3.0% internal, 6.2% external), were normalized to SDS based on healthy peers' data [15]. Bone age (BA) was assessed using the Greulich-Pyle (GP) method on non-dominant hand X-rays [16].

2.3 Genetic Testing

Two milliliters of peripheral blood were collected from the patient and other family members, and genomic DNA was extracted using the Blood DNA Midi Kit (D3494-04, Omega BioTek, GA, USA). Whole exome sequencing (WES) was conducted with AgilentSureSelect V6 for coding exonic sequence enrichment (Agilent Technologies, CA, USA), followed by sequencing on BGISEQ-500 (BGI, Shenzhen, China) achieving 100 × coverage via paired-end sequencing. Post-sequencing, clean reads were aligned to the GRCh37/hg19 genome assembly using BWA (v0.7.15). Variant calling identified SNPs and InDels via GATK's HaplotypeCaller (v3.7), with data annotated using ANNOVAR. Target bases had a median coverage of 147x, with 99% ≥10x. Rare nonsynonymous variants were selected, excluding common polymorphisms with MAF ≥ 0.1% in populations, referencing 1000 Genomes Project, gnomAD, and ExAC. Mutations' pathogenicity was classified per ACMG-AMP guidelines[17].

2.4 Bioinformatic Analysis

Multiple sequence alignment was performed to confirm the conservation of mutated amino acid residues. The schematic diagram of the NPR2 protein structure was constructed using Adobe Illustrator (AI) to understand the mutations’ location, and the approximate mutation site was identified in red. Furthermore, three-dimensional (3D) modeling of wild-type (WT) and mutant NPR2 proteins was achieved from the AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/), and PyMOL Viewer was used to visualize the effect of the mutation on the spatial configuration of the NPR2 protein.

2.5 Construction of NPR2 lentivirus

WT and mutant NPR2-overexpression lentivirus and empty vector (EV) lentivirus were obtained from Shanghai GeneChem Co., Ltd. The human WT and mutant NPR2 gene sequences were inserted into the GV208-Flag expression vector. The vector carries the Green fluorescent protein (GFP) gene for visualization and the puromycin resistance gene for selection. The constructs were transfected into the HEK293T packaging cells to produce NPR2 lentivirus.

2.6 Transfection and Generation of Stable Cell Lines

HEK293T cell line was obtained from Shanghai Chinese Academy of Sciences cell bank (Shanghai, China). The cells were cultured in high-glucose DMEM (Gibco, USA) with 10% FBS (ExCell, China) at 37°C in a humidified atmosphere containing 5% CO2. Before transfection, the cells were seeded in six-well plates and transfected with empty vector and NPR2 (WT and mutant) lentivirus at a MOI = 5 when they reached approximately 60%-80% confluency. Empty vector lentivirus was used as a negative control for the experiments. Transfection was performed using HitransG P (GeneChem, China) as recommended. After 8 hours, the transfection medium was replaced with a complete medium. Stable cell lines were generated by selecting all stable cells using puromycin (MCE, USA) at a final concentration of 5µg/mL after 48 h.

2.7 RNA extraction and Quantitative real-time PCR (qPCR) analyses

Total RNA was isolated using TRIzol (Ambion, USA), and then subjected to reverse transcription to generate cDNA employing HiScript III RT SuperMix for qPCR (Vazyme, China). Quantitative PCRs were prepared with Taq Pro Universal SYBR qPCR Master Mix (Vazyme, China) and performed on an ABI QuantStudio5 Q5 detection system. Relative mRNA expression levels were quantified by the 2^−∆∆CT method. Experiments were performed in triplicate and GAPDH was used as an internal control. Primers were designed by Primer Premier 6, synthesized by the Sangon Biotech Company (Shanghai, China), and listed in Table 1.

Table 1

Primer sequences for amplifying *NPR2* and *GAPDH* gene
Target gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
Human NPR2	ACCTCATCGCTGGCTGCTTCTA	CCCGTCCACCAAATCTGCTTCT
Human GAPDH	ACAACTTTGGTATCGTGGAAGG	GCCATCACGCCACAGTTTC

2.8 Western Blot and Protein Stability Analysis

Stably transfected HEK293T cells were seeded in six-well plates and cultured for 24 hours. Total cell proteins were extracted using Radioimmunoprecipitation assay (RIPA) buffer. For the NPR2 protein stability test, stably transfected cells were treated with 20µM MG132 (MCE, USA), and whole cell proteins were collected and extracted at different time points (0, 12, 24 hours) post-MG132 treatment. The BCA Protein Assay kit (Beyotime, China) was utilized to measure protein concentration. The proteins (40µg) were separated by 7.5% sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). The membranes were blocked with TBS-T containing 5% non-fat milk for 1 hour at room temperature, followed by overnight incubation with primary antibodies against Flag (1:1000, Sigma), actin (1:7500, ProteinTech), and GAPDH (1: 5000, Cell Signaling Technology) at 4°C. After three washes with TBS-T, the membranes were incubated with secondary antibodies for 1 hour at room temperature. Finally, the membranes were subjected to three additional washes and developed using the SuperPico ECL chemiluminescence Kit (Vazyme, China) and Tanon 5800 Imaging System (Tanon, China).

2.9 Subcellular Localization analysis of mutant NPR2 protein

Immunofluorescence and western blot determined the location of the corresponding proteins. Stably transfected HEK293T cells were seeded in six-well plates and fixed with 4% paraformaldehyde for 20 minutes. Subsequently, the cells were permeabilized with 0.5% Triton X-100 for 10 minutes, followed by blocking in 5% BSA (Solarbio, China) for 1 hour. Immunostaining was performed using an Anti-Flag primary antibody (1:100, Proteintech, China) at 37°C for 2 hours. CoraLite594-conjugated Goat Anti-Mouse IgG (H + L) secondary antibodies (Proteintech, China) were applied at a dilution of 1:500 at room temperature for 1 hour. Finally, the cells were counterstained with DAPI (Beyotime, China) to visualize the nucleus before observing protein localization using a confocal microscope (LSM800, Carl Zeiss, Germany).

The plasma membrane protein isolation kit (Beyotime, China) was employed to obtain cell membrane and cytoplasmic proteins. Protein extracts were subjected to electrophoresis and subsequent blotting as previously described. Actin (1:7500, ProteinTech) was used as an internal control for cytoplasmic proteins, while ATP1A1 (1:1000, Affinity) was used as an internal control for cell surface membrane proteins.

2.10 Enzyme-Linked Immunosorbent Assay (ELISA)

Stably transfected HEK293T cells were seeded into 6-well plates, and incubated with 100 nM CNP (CNP-22, MCE, USA) in serum-free DMEM for 30 min at 37^◦C. Subsequently, the endogenous phosphodiesterase activity was inhibited by adding 0.1 M HCl to stabilize cGMP. The cGMP levels in cell lysates were measured using the cGMP Complete ELISA kit (ENZO Life Sciences, Madison Avenue, NY, USA).

2.11 Statistical Analysis

The values are expressed as the mean ± standard deviation (SD). All data were analyzed using GraphPad Prism 9.0 software. Statistical analysis was performed by one-way ANOVA when more than two groups were compared. A statistical difference was considered when the p-value was less than 0.05.

3.1 Clinical features

Patient 1, a 10.3-year-old boy, was admitted to the hospital due to short stature. On admission, his height and weight were 125.0 cm (-2.71 SDS) and 25.0 kg (-1.30 SDS), respectively, with a sitting height/height ratio of 0.58 and an arm span/ height ratio of 1.0. His bone age (BA) was 9.9 years. The patient was born at full term with a birth weight of 3.4kg and a birth length of 50 cm. The patient’s father was 160.0 cm (-2.12 SDS) and his mother was 151 cm (-1.68 SDS) in height and his genetic target height is 162.0 cm (-1.78 SDS). Additionally, the serum IGF-1 level of the patient was low (-3.83 SDS), and peak GH levels on two stimulation tests were below 10.0 ng/mL. The patient underwent recombinant human growth hormone (rhGH) for up to 5 months following the initial visit. Approximately 2 years later, he received rhGH therapy once again for up to 6 months. At the end of treatment, the patient's height was 139.9 cm (-3.08 SDS), an increase of 12.1 cm from the first visit. The patient has not received rhGH therapy since then and was followed up to adulthood, with a final height of 156.0 cm (-2.78 SDS) (Table 2).

Patient 2 was admitted to the hospital at 4.7 years old for short stature. At that time, his height was 97.7cm (-2.38 SDS) and his weight was 15.0 kg (-1.23 SDS). He has severely delayed bone age (2.5 years). The patient was born at full-term and had a normal birth weight (3.1 kg) and birth length (50.0 cm). The patient’s sitting height/height ratio is 0.56 and arm span/height ratio is 0.94. His father's and mother's height were 168.0 cm (-0.78 SDS) and 149.0 cm (-2.06 SDS), respectively. The genetic target height of the patient is 165.0 cm (-1.28 SDS). The patient's GH Peak, serum IGF-1, and IGFBP-3 levels were normal. The patient did not receive rhGH treatment and was monitored until 15 when his height was recorded as 153.0 cm (-2.58 SDS) (Table 2).

Table 2

Clinical characteristic of patients with *NPR2* gene mutation
Variable	Patient 1	Patient 2
Age (years)	10.3	4.7
BA (years)	9.9	2.5
Birth length (cm)	50.0	50.0
Birth weight (kg)	3.4	3.1
Height (cm/SDS)	125.0/-2.71	97.7/-2.38
weight (kg/SDS)	25.0/-1.30	15.0/-1.23
BMI (kg/m²)	16	15.71
Sitting height/height (ratio)	0.58	0.56
arm span /Height (ratio)	1.00	0.94
Father's height (cm/SDS)	160.0/-2.12	168.0/-1.68
Mother's height (cm/SDS)	151.0/-0.78	149.0/-2.06
Genetic target height (cm/SDS)	162.0/-1.78	165.0/-1.28
GH peak (ng/mL) [Levodopa test]	8.60	10.31
GH peak (ng/mL) [Insulin test]	8.56	-
IGF-1 (ng/mL)	25.0	117.6
IGF-1 SDS	-3.83	0.25
IGFBP-3 (µg/mL)	2.52	3.10
Final adult height (cm/SDS)	156.0/-2.78	-/-

BA, bone age; SDS, standard deviation score; BMI, Body mass index; GH, growth hormone; IGF-1, insulin-like growth factor 1; IGFBP-3, insulin-like growth factor binding protein 3

3.2 Genetic analysis

Whole exome sequencing (WES) and Sanger sequencing revealed that patient 1 carried a heterozygous nonsense mutation (c.1162C > T, p.R388*) in the NPR2 gene, which was inherited from the father (Fig. 1A). A heterozygous frameshift mutation of the NPR2 gene (c.2629_2630delAG, p.S877Hfs*10) was identified in patient 2 and was inherited from the mother (Fig. 1B). Both mutations result in premature termination of protein translation and form truncated NPR2 proteins, and they were referred to as truncating mutations. In addition, the p.R388* mutation has been reported to the ClinVar database (accession number VCV000017787.9, http://www.ncbi.nlm.nih.gov/clinvar/), but the p.S877Hfs*10 mutation has not been previously reported. Both mutations were classified as potentially pathogenic based on the guidelines of the ACMG-AMP.

3.3 Bioinformatic Analysis

The two mutations, p.R388* and p.S877Hfs*10, occur in the ligand-binding domain (ECD) and guanylyl cyclase (GC) domains of the NPR2 protein, respectively (Fig. 2A). Conservation analysis showed that the target amino acid for mutation is highly conserved among different species (Fig. 2B). Three-dimensional (3D) structure prediction of the wild-type (WT) and mutant NPR2 proteins using Alphafold and Pymol software, revealed that the NPR2 mutant proteins were truncated with an altered spatial conformation (Fig. 2C, D).

3.4 Expression and protein stability of wild type (WT) and mutant NPR2 proteins

The qRT-PCR results revealed a significant increase in mRNA levels of mutant NPR2 compared to the WT (Fig. 3A). The Western blot analysis showed that the WT NPR2 protein band was approximately 115 kD, whereas two mutations (p.R388* and p.S877Hfs*10) produced two truncated NPR2 protein bands at approximately 43 kD and 98 kD, respectively. Notably, the expression of the truncated NPR2 proteins was significantly lower than that of the WT (Fig. 3B).

The high transcript levels and low protein expression suggest that both mutant proteins may be degraded in HEK293T cells. To study further, the stability of both WT and mutant NPR2 proteins were investigate using MG132. MG132 is an inhibitor of the proteasome and was used to inhibit protein degradation. After 12 hours of MG132 treatment, we observed that the level of WT NPR2 protein remained unchanged, whereas the level of mutant NPR2 protein increased (Fig. 3C). These findings indicate reduced stability and increased degradation of the truncated NPR2 proteins.

3.5 Subcellular Localization of Wild-Type (WT) and Mutant NPR2

Immunofluorescence analysis revealed that the WT NPR2 protein displayed a dense distribution on the cell surface with well-defined cell boundaries. In contrast, mutant NPR2 proteins were predominantly localized in the cytoplasm rather than on the cell membrane (Fig. 4A). To further confirm the subcellular localization of mutant NPR2 proteins, distinct fractions of the cell membrane and cytoplasmic proteins were isolated and subjected to western blot analysis. The results indicated that mutant NPR2 proteins were detected primarily in the cytoplasmic fraction and minimally in the cell membrane fraction (Fig. 4B). These findings indicate that the p.R388* and p.S877Hfs*10 mutations result in impaired localization of the NPR2 protein to the cell membrane.

3.6 Functional analysis of Wild-Type (WT) and Mutant NPR2

To evaluate the impact of mutations on NPR2 protein function, we measured cGMP levels in HEK293T cells after 100nM CNP-22 stimulation. The production of cGMP was significantly lower in cells expressing mutant NPR2 compared to those expressing WT NPR2, and similar to cells expressing an empty vector (Fig. 5). These findings indicate that both p.R388* and p.S877Hfs*10 mutations result in an almost complete loss of function for NPR2 proteins in generating cGMP upon CNP stimulation.

In the present study, we identified two NPR2 truncating mutations (c.1162C > T, p.R388* and c.2629_2630delAG, p.S877Hfs*10) in two Chinese boys that co-segregated with short stature in the family. Our cellular assays revealed that the truncating mutations escaped nonsense-mediated mRNA decay (NMD), producing a truncated protein but with reduced stability. Furthermore, the truncated NPR2 protein exhibited abnormal intracellular localization, and could not be transferred to the cell membrane, resulting in a near loss of signal transduction function. These findings contribute valuable insights into the pathogenic mechanism underlying short stature resulting from NPR2 truncating mutations.

As a key gene in the paracrine signaling pathway, NPR2 regulates skeletal growth by stimulating cyclic guanosine monophosphate (cGMP) production upon binding to its ligand (CNP)[18]. This study identified two truncating mutations in the NPR2 gene, inherited from the father and the mother, respectively. The p.R388* mutation may cause the NPR2 polypeptide to terminate at the codon 388 amino acid, causing truncated protein to form. Another mutation, p.S877Hfs*10, causes an amino acid substitution at position 877 (p.S877H) followed by 10 new amino acids before a stop codon occurs to terminate the NPR2 protein prematurely. Bioinformatics approaches were performed to predict the potential impacts of these two mutations on the structure and function of the NPR2 protein. Both mutations affect amino acids that are highly conserved across different species, indicating that the mutations of those amino acids have more significant impacts on the structure and function of the NPR2 protein[19]. The p.R388* mutation was located in the extracellular ligand-binding domain (ECD) of the NPR2 protein, not only potentially influencing its binding to the receptor CNP but also resulting in the deletion of the remaining three domains (the transmembrane domain, the KHD, and the GC domain). We hypothesize that CNP hardly stimulates this mutant NPR2 to generate cGMP. Another mutation, p.S877Hfs*10, emerges in the GC domain, undermining the integrity of this crucial domain and guanylate cyclase activity. This mutation might confer normal binding affinity with CNP, yet will severely impact cGMP production[20].

In this study, the pathogenicity and pathogenesis of the two truncating mutations were investigated in HEK293T cells. Both mutations lead to premature termination of the mRNA sequences, resulting in the production of truncated proteins. Normally, prematurely terminated mRNAs are subject to degradation by nonsense-mediated decay (NMD)[21]. This study found that both mutations can evade the NMD mechanism and synthesize truncated NPR2 proteins, but the expression level of truncated proteins is lower than that of WT NPR2. This result is inconsistent with a previous result obtained from Mustafa et al[22]. They reported a nonsense mutation (c.613 C > T, p.R205X) of the NPR2 gene that generated a truncated NPR2 protein (25kD) showing higher expression as compared to WT NPR2. This suggests that truncating mutations in the ECD of NPR2 may exert diverse impacts on protein expression. Moreover, the ability of the two truncated NPR2 proteins to stimulate cGMP production was nearly completely lost, which was similar to the truncated mutation (p.H948Pfs*5, p.His840*) studied by Chen et al[23]. Our study further demonstrated that the stability of the truncated protein was poor, which may explain the mechanism of the loss-of-function truncating mutations in NPR2.

In addition, several previous studies[12, 24–27] have revealed that approximately 58% (15/26) of NPR2 missense mutations impact the protein’s normal transport to the cell membrane independent of the mutation position. However, much less NPR2 truncated protein subcellular localization analysis has been carried out. Li and others[12] reported that both truncating mutations of NPR2 result in the failure of protein localization on the cell membrane and retention in the cytoplasm, leading to the loss of function of the mutant protein, which is consistent with our findings. Therefore, defective cellular trafficking to the cell membrane is likely a major molecular mechanism of the truncating NPR2 mutations. Protein folding in the endoplasmic reticulum (ER) is monitored by ER quality control mechanisms, and misfolding proteins are retained and degraded in the ER by an ER-associated degradation pathway[28]. We speculate that a change in conformation of the truncated NPR2 receptor promotes protein misfolding and degradation in the ER, and defects in the normal intracellular trafficking from the ER to the cell membrane.

Heterozygous mutations in NPR2 could be an important cause of short stature and may be associated with diverse phenotypes[26, 29]. A previous study reported 46 patients with NPR2 heterozygous mutations all presented with short stature, half with skeletal deformities, and 1/5 with facial abnormalities[30]. However, another study reported two patients carrying heterozygous missense mutations in the NPR2 gene who showed only a short stature and no other skeletal dysplasia[31]. In addition, two patients with NPR2 truncating mutations in this study exhibited short stature without other notable deformities or skeletal abnormalities. Therefore, the relationship between the genotype and phenotype of patients with NPR2 heterozygous mutations is still unclear, and more cases are needed to determine whether the complexity of the phenotype is related to the mutation type or mutation location. Patients carrying heterozygous NPR2 mutations display a progressive decline of age-adjusted height z -scores eventually leading to severe short stature[32], suggesting that short stature due to NPR2 mutations should be treated early. Recombinant human growth hormone (rhGH) appears beneficial in treating short stature due to NPR2 gene heterozygous mutations[33]. However, there are significant differences in response to rhGH treatment between patients, which may be related to the location of the mutation, such as patients with mutations in the ECD of NPR2 typically respond poorly to rhGH[30]. In this study, patient 1 showed a poor respond to rhGH treatment and the height changed from 125.0 cm (-2.71SDS) to 139.9 cm (-3.08SDS) after treatment. This might be associated with poor continuity of rhGH treatment and the fact that the mutation in this patient emerged in the ECD of NPR2. Unfortunately, patient 2 in this study was not treated with rhGH and remains short at -2.58 SDS of height when reaching the age of 15 years. Therefore, the efficacy of rhGH treatment in patients with NPR2 heterozygous mutations still needs to be investigated in a larger population with long-term follow-up.

In conclusion, our study has identified two truncating mutations in the NPR2 gene in two Chinese families with short stature. The two mutations could potentially impact the expression, subcellular localization, stability, and function of NPR2 proteins. These findings not only expand the mutational spectrum of the NPR2 gene but also provide new insights into the pathogenesis of short stature resulting from heterozygous NPR2 truncating mutations.

CNP

C-type natriuretic peptide

NPR2

natriuretic peptide receptor 2

cGMP

cyclic guanosine monophosphate

ECD

extracellular ligand-binding domain

KHD

kinase homology domain

guanylyl cyclase

AMDM

acromesomelic dysplasia Maroteaux type

WES

Whole-Exome Sequencing

NMD

Nonsense-mediated mRNA Decay

BMI

Body Mass Index

growth hormone

IGF-1

Insulin-like Growth Factor-1

IGFBP-3

Insulin-like Growth Factor Binding Protein-3

Bone age

Greulich-Pyle

ACMG-AMP

American College of Medical Genetics and Genomics and Association for Molecular Pathology

Adobe Illustrator

Three-Dimensional

empty vector

GFP

Green fluorescent protein

qPCR

quantitative real-time PCR

RIPA

Radioimmunoprecipitation assay

SDS

Standard Deviation Score

ELISA

Enzyme-Linked Immunosorbent Assay

wild type

endoplasmic reticulum

Ethics approval and consent to participate

The study was approved by the Affiliated Hospital of Economics and Medical Sciences Ethics Committee. Written informed consent was obtained from the patient’s parents for publication.

Consent for publication

Not applicable.

Availability of data and material

The datasets for this article are not publicly available due to concerns regarding participant/patient anonymity. Requests to access the datasets should be directed to the corresponding author.

Competing interests

The authors declare no competing interests.

Funding

This study was supported by the Natural Science Foundation of Shandong Province (No. ZR2022MH284).

Authors' contributions

SSW drafted the first versions of the manuscript. BB and QQZ were responsible for the design of the project and revised the manuscript. RL, MZ and YYL made the clinical evaluation and collected clinical information of the patients in detail. CPZ and FPL provided software support. SSW, DYH, SXC and FPL performed the experiments and data analysis.

Acknowledgements

We are grateful to the patients and their parents for participating in this study.

Jee, Y.H., et al., Genetics of Short Stature. Endocrinol Metab Clin North Am, 2017. 46(2): p. 259-281.
Lui, J.C., O. Nilsson, and J. Baron, Recent research on the growth plate: Recent insights into the regulation of the growth plate. J Mol Endocrinol, 2014. 53(1): p. T1-9.
Wit, J.M., et al., MECHANISMS IN ENDOCRINOLOGY: Novel genetic causes of short stature. Eur J Endocrinol, 2016. 174(4): p. R145-73.
Li, X., et al., Clinical Profiles and Genetic Spectra of 814 Chinese Children With Short Stature. J Clin Endocrinol Metab, 2022. 107(4): p. 972-985.
Fan, X., et al., Exome sequencing reveals genetic architecture in patients with isolated or syndromic short stature. J Genet Genomics, 2021. 48(5): p. 396-402.
Zhao, Q., et al., Molecular diagnosis is an important indicator for response to growth hormone therapy in children with short stature. Clin Chim Acta, 2024. 554: p. 117779.
Vasques, G.A., I.J. Arnhold, and A.A. Jorge, Role of the natriuretic peptide system in normal growth and growth disorders. Horm Res Paediatr, 2014. 82(4): p. 222-9.
Langenickel, T., et al., Forced homodimerization by site-directed mutagenesis alters guanylyl cyclase activity of natriuretic peptide receptor B. Hypertension, 2004. 43(2): p. 460-5.
Wu, J., et al., Novel Loss-of-Function Mutations in NPR2 Cause Acromesomelic Dysplasia, Maroteaux Type. Front Genet, 2022. 13: p. 823861.
Tsuji, T. and T. Kunieda, A loss-of-function mutation in natriuretic peptide receptor 2 (Npr2) gene is responsible for disproportionate dwarfism in cn/cn mouse. J Biol Chem, 2005. 280(14): p. 14288-92.
Stavber, L., et al., Heterozygous NPR2 Variants in Idiopathic Short Stature. Genes (Basel), 2022. 13(6).
Li, Q., et al., Novel NPR2 Gene Mutations Affect Chondrocytes Function via ER Stress in Short Stature. Cells, 2022. 11(8).
Li, H., et al., [Height and weight standardized growth charts for Chinese children and adolescents aged 0 to 18 years]. Zhonghua Er Ke Za Zhi, 2009. 47(7): p. 487-92.
Boogers, L.S., et al., Transgender Girls Grow Tall: Adult Height Is Unaffected by GnRH Analogue and Estradiol Treatment. J Clin Endocrinol Metab, 2022. 107(9): p. e3805-e3815.
Cao, B., et al., Pediatric Continuous Reference Intervals of Serum Insulin-like Growth Factor 1 Levels in a Healthy Chinese Children Population - Based on PRINCE Study. Endocr Pract, 2022. 28(7): p. 696-702.
Hojreh, A., et al., Hand MRI and the Greulich-Pyle atlas in skeletal age estimation in adolescents. Skeletal Radiol, 2018. 47(7): p. 963-971.
Richards, S., et al., Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, 2015. 17(5): p. 405-24.
Brown, K.M. and L.D. Sibley, Essential cGMP Signaling in Toxoplasma Is Initiated by a Hybrid P-Type ATPase-Guanylate Cyclase. Cell Host Microbe, 2018. 24(6): p. 804-816.e6.
Hirata, H., et al., ZC4H2 mutations are associated with arthrogryposis multiplex congenita and intellectual disability through impairment of central and peripheral synaptic plasticity. Am J Hum Genet, 2013. 92(5): p. 681-95.
Hachiya, R., et al., Intact kinase homology domain of natriuretic peptide receptor-B is essential for skeletal development. J Clin Endocrinol Metab, 2007. 92(10): p. 4009-14.
Hu, W., et al., Nonsense-mediated mRNA decapping occurs on polyribosomes in Saccharomyces cerevisiae. Nat Struct Mol Biol, 2010. 17(2): p. 244-7.
Mustafa, S., et al., A novel nonsense mutation in NPR2 gene causing Acromesomelic dysplasia, type Maroteaux in a consanguineous family in Southern Punjab (Pakistan). Genes Genomics, 2020. 42(8): p. 847-854.
Chen, H., et al., Novel pathogenic NPR2 variants in short stature patients and the therapeutic response to rhGH. Orphanet J Rare Dis, 2023. 18(1): p. 221.
Hisado-Oliva, A., et al., Heterozygous NPR2 Mutations Cause Disproportionate Short Stature, Similar to Léri-Weill Dyschondrosteosis. J Clin Endocrinol Metab, 2015. 100(8): p. E1133-42.
Badawi, S., et al., Unveiling the pathogenic mechanisms of NPR2 missense variants: insights into the genotype-associated severity in acromesomelic dysplasia and short stature. Front Cell Dev Biol, 2023. 11: p. 1294748.
Vasques, G.A., et al., Heterozygous mutations in natriuretic peptide receptor-B (NPR2) gene as a cause of short stature in patients initially classified as idiopathic short stature. J Clin Endocrinol Metab, 2013. 98(10): p. E1636-44.
Amano, N., et al., Identification and functional characterization of two novel NPR2 mutations in Japanese patients with short stature. J Clin Endocrinol Metab, 2014. 99(4): p. E713-8.
Hume, A.N., et al., Defective cellular trafficking of missense NPR-B mutants is the major mechanism underlying acromesomelic dysplasia-type Maroteaux. Hum Mol Genet, 2009. 18(2): p. 267-77.
Estrada, K., et al., Identifying therapeutic drug targets using bidirectional effect genes. Nat Commun, 2021. 12(1): p. 2224.
Ke, X., et al., Clinical Characteristics of Short-Stature Patients With an NPR2 Mutation and the Therapeutic Response to rhGH. J Clin Endocrinol Metab, 2021. 106(2): p. 431-441.
Hwang, I.T., et al., Role of NPR2 mutation in idiopathic short stature: Identification of two novel mutations. Mol Genet Genomic Med, 2020. 8(3): p. e1146.
Kanai, Y., et al., Circulating osteocrin stimulates bone growth by limiting C-type natriuretic peptide clearance. J Clin Invest, 2017. 127(11): p. 4136-4147.
Plachy, L., et al., NPR2 Variants Are Frequent among Children with Familiar Short Stature and Respond Well to Growth Hormone Therapy. J Clin Endocrinol Metab, 2020. 105(3).

No competing interests reported.

originalwesternblotfigures.docx

Download PDF

Editorial decision: Revision requested
22 Oct, 2024
Editor assigned by journal
18 Oct, 2024
Submission checks completed at journal
18 Oct, 2024
First submitted to journal
14 Oct, 2024

You are reading this latest preprint version

Identification and functional analysis of NPR2 truncating mutations in two Chinese families with Short Stature

Status:

Version 1

Abstract

Figures

1. Introduction

2. Patients and Methods

2.1 Patients

2.2 Clinical evaluations

2.3 Genetic Testing

2.4 Bioinformatic Analysis

2.5 Construction of NPR2 lentivirus

2.6 Transfection and Generation of Stable Cell Lines

2.7 RNA extraction and Quantitative real-time PCR (qPCR) analyses

2.8 Western Blot and Protein Stability Analysis

2.9 Subcellular Localization analysis of mutant NPR2 protein

2.10 Enzyme-Linked Immunosorbent Assay (ELISA)

2.11 Statistical Analysis

3. Results

3.1 Clinical features

3.2 Genetic analysis

3.3 Bioinformatic Analysis

3.4 Expression and protein stability of wild type (WT) and mutant NPR2 proteins

3.5 Subcellular Localization of Wild-Type (WT) and Mutant NPR2

3.6 Functional analysis of Wild-Type (WT) and Mutant NPR2

4. Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1