Characterization of green Synthesis of cucumber extract -Derived Zinc-Copper Oxide Nanocomposite Antibacterial Activity and Effects on MexA Gene Expression on Efflux Pumps in Pseudomonas aeruginosa.

doi:10.21203/rs.3.rs-5267244/v1

Download PDF

Research Article

Characterization of green Synthesis of cucumber extract -Derived Zinc-Copper Oxide Nanocomposite Antibacterial Activity and Effects on MexA Gene Expression on Efflux Pumps in Pseudomonas aeruginosa.

https://doi.org/10.21203/rs.3.rs-5267244/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The investigation of heavy metal-containing materials synthesized with plant extracts' antibacterial properties remains ongoing. In this study, zinc oxide and copper nanoparticles (ZnONPs and CuONPs) were produced with cucumber aerial part extract. The antibacterial effect of cucumber nanoparticles, in particular, demonstrated promising potential in combating microbial infections.

Material and methods: Green production of selenium nanoparticles. Atomic force microscopy (AFM), field emission scanning electron microscope (FESEM), X-ray diffraction (XDR), UV visible spectroscopy, and physical characteristics were used to characterize the samples. XRD confirmed the spherical structure, while AFM examination revealed the roughness and distribution of nanoparticles.

Results: the oxide nanoparticles were characterized using X-ray diffraction (XRD), UV-Vis spectrometer, Fourier-transformed infrared spectrometer, and transmission electron microscopy (TEM). The particle size was less than 33 nm, approximately. The diameter inhibitory zone showed that all of the strains had more sensitivity against nanocomposite. The novel composite showed antimicrobial activity against several human pathogens, such as Staphylococcus aureus, Staphylococcus haemolyticus, Staphylococcus epidermidis, Staphylococcus lentus, and Staphylococcus warneri. The effective antibacterial activity and size-dependent characteristics of nano-scale antibacterial substances have attracted considerable attention. This effect is evidenced by the utilization of cucumber extract in the synthesis of nanoparticles, namely ZnONPs, and CuONPs, which exhibited significant antibacterial properties. For molecular procedure, detection of the MexA gene in 10 isolates of MDR Pseudomonas aeruginosa using real-time polymerase chain reaction (RT-PCR). The effect of nanocomposite on MexA gene expression revealed fold changes in expression (downregulation) in two isolates of MDR P. aeruginosa and upregulation in only one isolate. The biologically synthesized NPs exhibit great antimicrobial activity and can down-regulate the expression of the efflux pump MexA gene. In addition, treating bacteria with the nanocomposite caused a significant reduction of MexA genes, which can improve the efficacy against P. aeruginosa by reducing the expression of MexA efflux pump genes.

Conclusions: This work used cucumber extract as an environmentally friendly and green biosynthesis of selenium nanoparticles (ZnO-CuO NPs) and their antibacterial applications. In conclusion, Nanocomposite were successfully biosynthesized using Cucumber extract, derived from fresh cucumber fruits (Cucumis sativus) through the green method and had promising activity against antibacterial multidrug-resistant bacteria. The expression of the MexA gene was significantly downregulated in the isolates treated with Nanocomposite.

Efflux pump

MexA

Pseudomonas aeruginosa

cucumber

The harmful effects of nanoparticles of copper (CuO NPs) on crops and their possible uses in agriculture have drawn a lot of attention. Two diameters of CuO NPs (510 nm, µCuO, and 43 nm, nCuO) were used on cucumber (Cucumis sativus) to investigate the biological impact of CuO NPs on plants.[ 1‏] Investigate the effects of Ag-NP-containing alginate gels on the growth of cucumber (Cucumis sativus L.) seeds and the early stages of seedling development. The process of chemical synthesis was used to produce composites including Ag-NPs. [2]

The need for diesel fuel is growing around the world, but burning it directly has several negative effects on human health and the environment. The generation of biofuel is currently a viable alternative to commercial diesel. Vegetable oils, either edible or not edible, are usually employed to make biodiesel. [3]

Although they are readily available, reasonably priced, and have a high concentration of chemicals that are useful in ecologically sustainable nanoparticle biosynthesis, vegetable and fruit waste extracts are growing more and more popular.[ 4]. Components found in fruit and vegetable waste extract and how they work to generate nanostructures. These environmentally friendly carefully produced nanoparticles have demonstrated potential uses across different sectors. [5].Alternatively, biosynthesis nanoparticles of silver It is discovered that a sizable amount of oxides of zinc and silver nanoparticles are produced by the extract obtained from lemon fruit and remaining peels from lemons and mandarins.[6]

The results by [7] suggest that Ag-Fe2O3 nanoparticles with bimetallics made from cabbage peels have the potential to serve as efficient antioxidant and catalytic agents, especially when it comes to difficulties with wastewater tainted with dyes. Cucumber (Cucumis sativus L.), a low-calorie vegetable that is crucial to the agricultural sector, is eaten in salads. Its nutrient-dense seeds contain phytonutrients fiber, and antioxidants which promote weight loss, immunity, softening skin, eye care, and cancer prevention. [8]

The Gram-negative bacillus P. aeruginosa is frequently found in several settings, most notably soil and water that have seen a high level of human activity (e.g., wastewater-, hydrocarbon-, and pesticide-contaminated soil, P. aeruginosa generally displays extensive drug resistance (XDR), which happens when the bacteria are only susceptible to one or two antimicrobial categories, as well as multidrug resistance (MDR), which occurs when the bacteria are resistant to at least one agent in three or more antimicrobial categories.[9] The successful treatment of infections that arise from multidrug-resistant organisms presents serious difficulties for physicians (MDR). Pseudomonas aeruginosa is thought to be an opportunistic bacteria that causes a variety of diseases linked to healthcare (HAIs). The goals we had were to find efflux-pump mexA genes, analyze the rate of MDR and PDR in P. aeruginosa in our area, and analyze the suggested binding interactions among the MexB pump and five different kinds of antimicrobial drugs. [10].The results suggested that NPs had direct antibacterial activity, reduced efflux pump in multidrug resistance, and decreased illness in cucumber plants. The research will provide new insights into nanotechnology and offer novel remedies for the most difficult disease problem in cucumber farming.

Identification of P. aeruginosa in this investigation, from patients at the Baghdad Medical City Hospital in Baghdad, Iraq, suffering from P. aeruginosa wound infections were gathered between September 2023 and December 2023. Following the manufacturer's instructions, were identified and used the Vitek 2 compact system (BioMe~rieux/France). [11]

Indicator strains:

The Ibn Sina College of Medicine at Iraqi University provided the pathogenic bacteria isolates of urine infection (S. aureus, S. haemolyticus, S. epidermidis, S. lentus, and S. warneri) that were used once they were discovered and isolated.

Collection of Plant material

Fresh cucumbers were obtained from gathered from a nearby vegetable store before thoroughly washing twice and three times with distilled water, and were cut off with a knife. Afresh cucumbers were used to prepare an aqueous extract placed in a beaker and then extracted in a hot water bath at 80 °C for 3 h. After extraction, the extract was cooled to room temperature and filtered to obtain gelatinized extract Fig 1 [12]

Biosynthesis of Zn-Cu Nanocomposite: -

Before having been added to 200 ml of cucumber extraction filtrate, 10 g of copper (II) acetate as well as 10 g of zinc acetate were added at room temperature (37 °C), sealed, and covered with a dark plastic container [13]. The resulting mixture was then incubated in a solution of 100 ml of deionized water. Copper (II) acetate Cu (CH3COO) 2⋅H2O) and zinc acetate (Zn (O2CCH3)2) were utilized as precursors in this study Fig 2. [14]

Characterization of biosynthesized Selenium Nanoparticles: FT-IR spectral analysis revealed that it was functioning as a reducing agent for produced nanoparticles (NPs). The XRD examination was performed to verify the NPs' crystal nature, and their morphology was assessed with TEM and SEM. A Shimadzu UV-1800 UV-Vis spectrophotometer was used to conduct the first examination of the produced Zn-CuONPs in the 200–800 nm range. To characterize UV-Vis [15]

Minimum Inhibitory Concentration of Zn-CuO NPs:

The MIC of synthesized Zinc-Copper Oxide Nanocomposite against P. aeruginosa strains was determined using the Broth microdilution method in culture broth via making serial dilutions (1000, 500,250,125, and 62 µg/ml) as follows:

1- one ml of stock solution (1000 mg/ml) of Nanocomposite was prepared, Transfer 100 microliter of diluted test material to the first line of wells.

2- Add 100 microliter of Müller Hinton broth in each well from 1 to 10, Two-fold dilution: by transferring 100 microliter from the first to the 10th well, well G was positive control and well H was used as negative control.

3- All wells were inculcated with 10 microliters of bacterial suspension adjusted to McFarland (1.5 * 10 ⁸ CFU\ml) using densicheck except for the negative control

4- The microtitre plate was incubated at 37 C for 24 h. Then the growth was measured by determining OD450 using a microtiter plate reader.

5- Wells that appeared turbid indicated bacterial growth while wells that remained clear indicated no growth. The MIC of the - Nanocomposite is the lowest concentration that does not show any growth. [16]

Screening of antimicrobial activities by Agar Well Diffusion Method (AWD)

The AWD method was used to evaluate the noncompaction against Indicator strains of fungal follows: preparation of Zn-Cu ONPs serial dilutions (1000, 500,250,125, and 62.5 µg/ml) then Bacteria were spread on the surface of MHA plates. Wells cut into the pour plates with 5 mm diameter by sterile cork borer. Pours were filled with 80μl of nanoparticles. The plates were kept at room temperature for 2 hr and then incubated for 18-24 hr. After incubation, measuring the zones of Inhibition in cm to determine antimicrobial activity [17]

Detection of MexA gene: DNA Extraction: Genomic DNA was isolated from bacterial growth according to the protocol of ABIO pure Extraction table 1.

Table (1): Primers Sequence [18]

Primer Name	Sequence 5`-3`	Annealing Temp. (^°C)	Product Size (bp)
MexA-F	GTGTTCGGCTCGCAGTACTC	60	244
MexA-R	AACCGTCGGGATTGACCTTG	60	244

Microgen Company supplied these primers in lyophilized form. To prepare a stock solution, lyophilized primers were dissolved in nuclease-free water at a concentration of 100pmol/μl. To make a workable primer solution of 10pmol/μl, combine 10μl of primer stock solution (frozen at -20 C) with 90μl of nuclease-free water.

Agarose Gel Electrophoresis

Following PCR amplification, agarose gel electrophoresis was performed to validate the existence of amplification. PCR was entirely dependent on the extracted DNA criteria.

The PCR products were loaded immediately. 5μl of PCR product was put straight into the well. Electrical power was turned on @ 100v/mAmp for 60 minutes. DNA flows from the cathode to the (+) anode poles. The Ethidium bromide-stained bands in the gel were observed using gel imaging equipment.

RNA Purification: RNA was isolated from the sample according to the protocol of TRIzol™ Reagent as the following steps:

Determine RNA, cDNA yield Fluorescence Method

A Quintus Fluorimeter was used to determine the concentration of extracted RNA to assess sample quality for subsequent applications. To 1 µl of RNA, 200 µl of diluted Quantic Fluor Dye was added. After 5 minutes of incubation at room temperature in a dark environment, RNA concentration measurements were determined.

Primer preparation

Microgen Company delivered the primers in lyophilized form. To prepare a stock solution, lyophilized primers were dissolved in nuclease-free water at a concentration of 100pmol/μl. To make a workable primer solution of 10pmol/μl, combine 10μl of primer stock solution (frozen at -20 C) with 90μl of nuclease-free water.

Molecular measurement of MexA Gene Expression of P. aeruginosa by reverse transcriptase polymerase chain reaction:

The influence of Zinc-Copper Oxide Nanocomposite suspension on investigated gene expression of MexA was carried out for six isolates of P. aeruginosa Measurements were made of the gene expression levels after receiving sub-MIC treatment

Analysis Gene Expression Using Livak Method

Relative Quantification

The levels of expression have been determined using relative quantitation, which required determining the fold changes and variations in cycle thresholds (ΔCT) between the groups that were treated and their corresponding gene calibrating devices (Livak and Schmittgen, 2001). As a housekeeping gene, the level of expression of the fbp gene was used to standardize the data. [19]

Ethical Statement This research was approved by the Committee of Ethical Standards in the College of Sciences / Baghdad University. The study protocol, subject information, and permission form were reviewed and approved by a local ethics committee the document number FM.SA/308 dated December 25/2023.

Isolation of Acinetobacter. baumannii in this study fifty Specimens of A. baumannii from wound infection samples as shown in (Table 2) A. baumannii is non-fastidious and appears as creamy or white and mucoid or smooth colonies, non-hemolytic after 18–24 hours on blood agar and non-lactose formative on MacConkey agar and colonies are appear as slight lavender color Fig(3)

Table (2): Prevalence of Acinetobacter baumannii isolates among clinical Samples

No. of Acinetobacter baumannii (%)	Other gram-negative bacteria No. Isolates	Source of Samples
50 (33.3%)	100 (66.6)%	Wounds
	150	Total

Biosynthesis of Zno-Cuo Nanocomposite:

The addition of apple peel extracts to the sodium selenite salt solution caused the color to change from red to reddish brown after 48 hours of incubation at room temperature. Figure 4 depicts a small color shift that occurred within half an hour of adding fruit peel extracts.

Characterization of biosynthesized Nanocomposite: Biosynthesized ZnCuONPs had the largest absorption peak between 200 and 600 nm. There are minute variances in absorbance values across the three extracts, showing that the changes are caused by particle size or shape Figure 5-a. As indicated in Figure 5-b.AFM was utilized to identify and characterize nanoparticle distributions in SeNPs, which have an average diameter of 33.23 nm.

Figure 6 shows the FTIR spectra of the synthesis and the apple zest extract. To verify the nanocomposition, FT-IR spectra were collected. The frequency of aliphatic C-O bond stretching was noticed at 1157 cm−1, while the frequency of C-H bond bending was found at 1458 cm−1. Furthermore, the O = C = O of CO2 is attributed to the peak at 2360 cm−1, and the stretching rate of O–H is responsible for the peaks in the 3600–3800 cm−1 range.

SEM and TEM Analysis

SEM pictures were gathered to examine the macroscale morphology of the produced nanomaterials. The SEM picture of pure nanocomposite showed structures like flowers. Figure 7-A TEM images indicated the successful production of nano-size particles of Zn-CuO. In the TEM image. It should be noted that most of the time, instead of a single particle, agglomerated NPs. Therefore, the average primary size of NPs may increase to about 18-22 nm. Fig 8- B

X-ray diffraction method (XRD) The figure depicts the composition of NPs' XRD patterns. Every peak can be properly related to the copper phase and agrees with the values found on the standard card (JCPDS 36–1451). There are no peaks from impurities or other ZnO phases can be seen. This indicates that the Zn-CuO NPs obtained were quite pure Fig 9.

Antimicrobial activity of Zno-Cuo Nanocomposite against clinical isolates of P. aeruginosa: MIC tests were carried out using microdilution broth in a sterile 96-well microplate. As shown in figure (10). The 24-hour bacterial culture was made specifically for this use. The 0.5 McFarland bacterial suspension was prepared in Müller Hinton broth and then added to each plate well. The minimum inhibitory concentration, or MIC, of the Nanocomposite, is the lowest concentration at which no growth is seen. For the ten isolates of the multidrug-resistant strain of P. aeruginosa, the MIC was 500 µg/ml.

Antibacterial studies

The growth of All Staphylococcus species as well as was significantly inhibited by the Zno-Cuo Nanocomposite, as determined by the MIC method and the diameters of the zones of inhibition. Among the Staphylococcus spp., S. epidermidis was the most influential when it was treated with SeNPs. Further evidence of a statistically significant difference (p < 0.05) in the disseminated mean zone of bacterial inhibition following treatment with varying concentrations of SeNPs (1000, 500, 250, 125, and 62.5 μg/mL) is shown in Fig. 14. There are significant distinctions between the many Staphylococcus species. did not significantly differ between S. haemolyticus, S. epidermidis, and S. lentus but did significantly (p <0.0001) affect the zone of bacterial inhibition (mm) of S. warneri and S. aureus. Fig. 11

Polymerase Chain Reaction (PCR) Technique

Five P. aeruginosa isolates containing the MexA gene were found by the PCR results; these isolates were chosen due to their resistance to multiple drugs (MDR). Electrophoresis on a 1.5% agarose gel stained with ethidium bromide, electrophoresed at 75 volts for 50 minutes and seen under an ultraviolet (UV) transilluminator was the next step used to confirm the positive gene result. The results of this investigation showed that the 244 bp MexA gene band was clear, unique, and non-dispersed and that it could be easily identified from the DNA ladder (Figure 12). Notably, the absence of any obscuring of the gene band indicated that there was no indication of DNA degradation.

Expression of P. aeruginosa MexA gene

To evaluate the expression levels of the mexA gene involving six MDR P. aeruginosa two isolates (P1 and P2 ) from burn before and after treatment with Nanocomposite suspension was studied using the RT-qPCR technique at sub-MIC 250 µg/ml concentration for each isolate

Effect of Nanocomposite on MexA Gene Expression

To estimate the effect of NPs at concentrations of 250 μg/ml, Two Real-time PCR reveals a major downregulation in MexA expression after the exposure to Zn Cu ONPs compared to normal gene expression in bacteria. Fold change in gene expression reveals that MexA was downregulated in response to nanocomposite in 5 isolates of P. aeruginosa, as entailed in Table (3) and demonstrated in Figure (13)

Table (3): Gene Expression in Wound Isolates Before and After Treatment with Zn Cu ONPs

samples Isolate From Wound	housekeeping (fbp1)	*MexB*	DCT	DDCT	folding
1 Before treatment	27.67	27.08	-0.59	0	1
1 After treatment	24.68	22.65	-2.02	-1.44	2.71
2 Before treatment	21.76	17.07	-4.69	0	1
2 After treatment	19.76	15.15	-4.61	0.08	0.95

The degree of microbial sensitivity to different nanoparticles of metal oxide varies depending on the type of bacteria. It is important to comprehend the variances between the cell walls of Gram-positive and Gram-negative bacteria since interaction with the cell surface of bacteria is the primary source of toxicity from antimicrobial drugs.N-acetyl glucosamine (NAG) and NAM (N-acetylmuramic acid) residues alternate in linear chains that make up the peptidoglycan layer of gram-positive bacteria. Three to five amino acid pairs are arranged in these chains such that they cross-link to create a cohesive mesh. In addition, the majority of Gram-positive bacteria have large phosphate groups within their negatively charged teichoic acids, which extend from the cell wall to the surface. [20]

Positively charged nanoparticles attract to the surface of negatively charged bacterial cell walls through electrostatic interactions. On the other hand, positively charged metal-based nanoparticles firmly attach themselves to membranes, breaking down cell walls and therefore boosting porosity. In addition, extracellular metal ions generated by nanoparticles can enter cells and impair biological functions61. Cell actions are affected when metal ions are free to interact with biological parts such as proteins, membranes, and DNA [21].To interact with and hinder the growth of bacteria, either the nanoparticles or their metal ions should diffuse through the solid agar media. The size and accompanying steric barrier of ZnO and CuO rods make it difficult to presume that the flower-like structure is diffusing through a solid medium. Cu2+ ions have an effect on bacterial cells, which inhibits the development of microbial cells. Cu or CuO nanoparticles have been investigated recently for their potential as antibacterial substances [22].‏ the synthesized compounds' minimum inhibitory and maximum bactericidal concentration values were ascertained. To further clarify the nature of the overall inhibitory effect against the aforementioned bacterial species, a time-lapse synergy kill test was carried out [23,24]. Through the use of certain primers, a PCR technique was used to evaluate the presence of mexB efflux pump genes. Before examining the gene expression, the existence of MexB genes in nine MDR P. aeruginosa specimens was assessed. Nine isolates all showed positive results for the MexB gene.

[25,26] .Three components compose the complex known as the MexAB-OprM efflux pump, which is an element of the resistance–nodulation–cell division family: an exterior membrane pore (open), a membrane fusion protein (MexA), and a membrane of the cytoplasm transporter (MexB). Antimicrobials and other contaminants can be transported through the cytoplasm to the external environment thanks to this system. Gene expression reveals that MexB was down regulated in response to nanocomposites in two isolates of P. aeruginosa. Another result by [27]. All strains of P. aeruginosa are carriers of the mexB and mexA genes, and a significant decrease in the level of expression of these genes was observed in the samples treated with gold nanoparticles as compared to the non-treated samples. This study examined the impact that gold nanoparticles on the expression of efflux pump mexA and mexB genes of P. aeruginosa strains by real-time PCR. [28].‏ It is plausible that the affected isolate exhibited down-regulated gene expression due to regulatory variables that were more susceptible to the inhibitory agent. On the other hand, likely, the other isolate's regulatory processes were not as impacted by the inhibitory substance, which prevented a noticeable alteration in gene expression.

Through the use of an indirect, low-cost, high-yield, green, and ecologically friendly technology, nanocomposite was effectively made. Zn-CuO NPs-derived nanoparticles shown exceptional antibacterial activity against a variety of microorganisms. Hence, Zn-CuO NPs nanoparticles can be used externally as antibacterial agents by coating surfaces on a variety of substrates to prevent biofilm-forming bacteria from attaching to and populating medical equipment. When all is said and done, our findings unequivocally demonstrate that Zn-CuO NPs can be utilized in biomedical settings as a safer alternative to treat common MDR and biofilm infections.

Acknowledgment: The authors would like to acknowledge the Departments of Biology, College of Science, University of Baghdad and Medical and Molecular Biotechnology Department, Biotechnology Research Center, Al-Nahrain University, for their great support in getting this work done in their laboratories.

Consent for publication: Not applicable.

Author Contributions: Mais E. Ahmed planned the research work performed the experiments and performed the data analysis.

Mais E. Ahmed: performed the experiments and contributed to the writing of the paper and publishing the paper as correspondence author. The research work was under her supervision. Contributed to the writing of the paper.

Funding: This work has been funded by Baghdad University Data Availability the data that support the findings of this study are available from the corresponding author, [Mais E. Ahmed], upon reasonable request.

Competing interests: Not found

Availability of data and materials

All data used in this study are made publicly available by University of Baghdad, Baghdad- Iraq

Declarations

Ethical Approval This case report was conducted according to the declaration of Helsinki. The collection and evaluation of data were confidential according to the health policy of the Iraqi Ministry of Health.

Competing Interests The authors declare no competing interests..

Informed Consent None

Zong, X., Wu, D., Zhang, J., Tong, X., Yin, Y., Sun, Y., & Guo, H. (2022). Size-dependent biological effect of copper oxide nanoparticles exposure on cucumber (Cucumis sativus). Environmental Science and Pollution Research, 29(46), 69517-69526.
Rutkowski, M., Krzemińska-Fiedorowicz, L., Khachatryan, K., Khachatryan, G., Kalisz, A., & Sękara, A. (2024). Impact of silver nanoparticles in alginate gels on seed germination, growth and stress biochemical parameters of cucumber seedlings. Plant Stress, 10049
Devabalan, I., Nambiar, A., & Yadav, A. (2024). Synthesis and Characterization of Nanoparticle Enhanced Biodiesel using Azadirachta Indica (Neem) leaf extract. In E3S Web of Conferences (Vol. 511, p. 01022). EDP Sciences
Bhatt, S., Saraswat, S. A review on phytochemical mediated synthesis of nanoparticles through fruits and vegetables extract and their potential applications. Nanotechnol. Environ. Eng. (2024). https://doi.org/10.1007/s41204-024-00370-z
Seddiq, S. H., Zyara, A. M., & Ahmed, M. E. (2023). Evaluation of the Antimicrobial Action of Kiwifruit Zinc Oxide Nanoparticles Against Staphylococcus aureus Isolated from Cosmetics Tools. BioNanoScience, 1-10.‏https://doi.org/10.1007/s12668-023-01142-
Emad, M., & Salama, K. (2020). A comparison of the effects of lemon peel-silver nanoparticles versus brand toothpastes and mouthwashes on staphylococcus spp. isolated from teeth caries. Iraqi Journal of Science, 61(8), 1894-1901.‏https://doi.org/10.24996/ijs.2020.61.8.6
Idris, D. S., & Roy, A. (2024). Antioxidant and dye degradation activity of green synthesized silver-iron oxide (Ag-Fe2O3) bimetallic nanoparticles. Nano-Structures & Nano-Objects, 38, 101142
Gupta, N.; Jain, S.K.; Tomar, B.S.; Anand, A.; Singh, J.; Singh, A.K. Influence of Fruit Load per Vine on Seed Quality in Cucumber (Cucumis Sativus L.) Grown under Open Fields and Protected Environments. Indian J. Hortic. 2021, 78, 93–100
Crone, S.; Vives-Flórez, M.; Kvich, L.; Saunders, A.M.; Malone, M.; Nicolaisen, M.H.; Martínez-García, E.; Rojas-Acosta, C.; Catalina Gomez-Puerto, M.; Calum, H.; et al. The Environmental Occurrence of Pseudomonas Aeruginosa. APMIS Acta Pathol. Microbiol. Immunol. Scand.2020, 128, 220–231
Kishk RM, Abdalla MO, Hashish AA, Nemr NA, El Nahhas N, Alkahtani S, Abdel-Daim MM, Kishk SM. Efflux MexAB-Mediated Resistance in P. aeruginosa Isolated from Patients with Healthcare-Associated Infections. Pathogens. 2020; 9(6):471. https://doi.org/10.3390/pathogens9060471
Ahmed, M. E. (2018). The study of bacteriocin of Pseudomonas fluorescens and Citrus limon effects against Propionibacterium acnes and Staphylococcus epidermidis in acne patients. In Journal of Physics: Conference Series (Vol. 1003, No. 1, p. 012004). IOP Publishing.‏ https://doi.org/10.1088/1742-6596/1003/1/012004
Chen, S., Huang, H., & Huang, G. (2019). Extraction, derivatization, and antioxidant activity of cucumber polysaccharide. International journal of biological macromolecules, 140, 1047-1053.‏
Faiq, N. H., & Ahmed, M. E. (2024). Inhibitory Effects of Biosynthesized Copper Nanoparticles on Biofilm Formation of Proteus mirabilis. Iraqi Journal of Science, 65-78.‏
Abu-Elsaad, N. I., & Abdel hameed, R. E. (2019). Copper ferrite nanoparticles as nutritive supplement for cucumber plants grown under the hydroponic system. Journal of plant nutrition, 42(14), 1645-1659
Ahmed, M. E., Khalaf, Z. Z., Ghafil, J. A., & Al-Awadi, A. Q. (2018). Effects of Silver Nanoparticles on Biofilms of Streptococcus Spps. Exec. Ed, 9, 1216.‏‏
Kadhim, Zahraa H., Mais E. Ahmed, and Ilker Şimşek. "Biologically synthesized Copper Nanoparticles from S. epidermidis on resistant S. aureus and cytotoxic assay."‏ Bionatura Issue 1 Vol 8 No 1 2023.
Rashid, A.E., Ahmed, M.E., Hamid M.K., Evaluation of Antibacterial and Cytotoxicity Properties of Zinc Oxide Nanoparticles Synthesized by Precipitation Method against Methicillin-resistant Staphylococcus aureus. International Journal of Drug Delivery Technology. 2022;12(3):985-989
Ahmed, M. E., & Al-Awadi, A. Q. (2024). Enterococcus faecium BACTERIOCIN EFFLUX PUMP MexA GENE AND PROMOTE SKIN WOUND HEALING IN MICE. Journal of microbiology, biotechnology, and food sciences, e10711-e10711.‏ DOI: https://doi.org/10.55251/jmbfs.10711
Livak, K. J. and Schmittgen, T. D. 2001. Analysis Of Relative Gene Expression Data Using Real-Time Quantitative Pcr and the 2− Δδct Method. Methods, 25, 402-408
Jayanetti, M., Thambiliyagodage, C., Liyanaarachchi, H. et al. In vitro, the influence of PEG functionalized ZnO–CuO nanocomposites on bacterial growth. Sci Rep14, 1293 (2024). https://doi.org/10.1038/s41598-024-52014-6
Faiq NH, Ahmed ME. Effect of Biosynthesized Zinc oxide Nanoparticles on Phenotypic and Genotypic Biofilm Formation of Proteus mirabilis. Published Online First: August 2023; Baghdad Science Journal .https://dx.doi.org/10.21123/bsj.2023.8067
Faiq, N. H. H., & Ahmed, M. E. (2024). Synergistic Inhibitory Effect of Biosynthesized ZnO-CuO Nanocomposite on Biofilm Formation of Proteus Mirabilis. Ibn AL-Haitham Journal For Pure and Applied Sciences, 37(2), 51-66
Jayanetti, M., Thambiliyagodage, C., Liyanaarachchi, H. et al. In vitro, influence of PEG functionalized ZnO–CuO nanocomposites on bacterial growth. Sci Rep 14, 1293 (2024). https://doi.org/10.1038/s41598-024-52014-6
Mahdi S. M, Ahmed M. E, Abbas A. F, Effect of Enterococin – Zinc Oxide Nanoparticles on Gene Expression of rsbA Swarming Genes in Proteus mirabilis isolation Catheter Urine. Biomed Pharmacol J 2024;17(2).: https://bit.ly/44Rv7Ec
Anwer, A. W., Saleh, G. M., & Ahmed, M. E. A. E. (2024). Antimicrobial Susceptibility of Enterococcus faecium Isolated from Bee-gut on PhzM Gene of Pseudomonas aeruginosa Isolates from Infected Wounds. Ibn AL-Haitham Journal For Pure and Applied Sciences, 37(2), 41-50.‏
Ahmed M.E., Abdul Muhsin Z.A. Synergistic Effect of Gentamicin and Iron Oxide Nanoparticles on phzM Gene of Pseudomonas aeruginosa. Microbiological journal. 2024 (3). P. 27—39. https://doi.org/10.15407/ microbiolj86.03.027
(Dorri, K., Modaresi, F., Shakibaie, M. R., & Moazamian, E. (2022). Effect of gold nanoparticles on the expression of efflux pump mexA and mexB genes of Pseudomonas aeruginosa strains by Quantitative real-time PCR. Pharmacia, 69(1), 125-133.‏
Zahmatkesh, S., Hajiaghaei-Keshteli, M., Bokhari, A., Sundaramurthy, S., Panneerselvam, B., & Rezakhani, Y. (2023). Wastewater treatment with nanomaterials for the future: A state-of-the-art review. Environmental Research, 216, 114652

Download PDF

Version 1

posted

You are reading this latest preprint version

Characterization of green Synthesis of cucumber extract -Derived Zinc-Copper Oxide Nanocomposite Antibacterial Activity and Effects on MexA Gene Expression on Efflux Pumps in Pseudomonas aeruginosa.

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Agarose Gel Electrophoresis

Results

Discussion

Conclusion

Declarations

References

Status:

Version 1