Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2

doi:10.21203/rs.3.rs-5269858/v1

Download PDF

Research Article

Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2

https://doi.org/10.21203/rs.3.rs-5269858/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The expression of inflammation and oxidative stress caused by obesity is high, which has a certain degree of damage to myocardial cells. is a glucagon-like peptide-1 receptor agonist, which has a hypoglycemic and weight loss effect. Similarly, hydroxysteroid dehydrogenase-like protein 2 (HSDL2) can also regulate lipid metabolism. However, it is not clear whether smegroupide reduces obesity-related cardiomyocyte damage through HSDL2. In this study, the oxidative stress index of the serum of mouse cardiomyocytes and obese mice in a high-fat environment and the expression of HSDL2 were detected to reveal the mechanism of obesity-induced cardiomyocyte injury and the effect of semaglutide in reducing cardiomyocyte injury regulated by HSDL2.

Methods

In this study, animal models of mice in the obesity group and the micetigrupide intervention group, the cardiomyocyte model of palmitic acid cultured mice in ordinary and knockout HSDL2, and the cell model of the miceglupeptide intervention were established. The levels of inflammatory and oxidative stress indicators such as tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), reactive oxygen (ROS) and malondialdehyde (MDA) in mouse serum and mouse cardiomyocytes were also detected. Then, the expression of HSDL2 of normal mouse cardiomyocytes cultured with high fat culture and mouse cardiomyocytes that knocked HSDL2, as well as the oxidative stress and autophagy levels of cells, were measured, and the effect of semaglutide regulation by HSDL2 on cardiomyocyte damage caused by high fat was evaluated.

Conclusion

Obesity increased the oxidative stress level of mouse cardiomyocytes and mouse serum, while semaglutide can reduce the increased oxidative stress level caused by obesity. At the same time, semaglutide also significantly reduced the weight of obese mice. The myocardial tissue and myocardial cells of mice in the obese group showed an upward expression of HSDL2, but after the intervention of semaglutide. After knocking out HSDL2, the level of ROS and autophagy of mouse cardiomyocytes decreased significantly. Semaglutide may reduce cardiomyocyte damage caused by high fat by regulating the expression of HSDL2. These findings are expected to reveal the new molecular mechanism of semaglutide to regulate obesity-related cardiomyocyte injury through HSDL2, providing a new target for clinical treatment.

Obesity

inflammation

oxidative stress

semaglutide

HSDL2

Obesity is a chronic multifactorial disease in which the accumulation of multiple fats can have a negative impact on human health. With the development of the global economy, the incidence of obesity continues to rise among people around the world, and there is no sign of a significant decline. Obesity is directly involved in the occurrence and development of metabolic diseases, cardiomyopathy, ischemic coronary heart disease, peripheral artery disease, heart failure and arterial hypertension, affecting global morbidity and mortality. Therefore, obesity is a disease syndrome that deserves our continued attention.

Obesity causes a variety of hemodynamic changes, which may lead to changes in heart morphology, ventricular function and vascular endotheter cells, leading to various cardiovascular diseases such as heart hypertrophy, heart failure and atherosmosis.^{1, 2} Abnormal metabolism in the body caused by obesity plays a key role in cardiovascular disease. Studies have shown that feeding a high-fat diet (HFD) can lead to obesity in mice, accompanied by impaired endothelial-dependent vasostolic function and arterial wall thickness.³ In addition, lipid metabolism disorders caused by obesity greatly increase the level of oxidative stress, which can damage a variety of target organs, mainly affecting the function of cardiovascular cells and triggering a series of pathological changes. At the same time, the increase in oxidative stress will also increase the product of lipid peroxide, resulting in myocardial cell damage.⁴ However, the mechanism of myocardial injury caused by obesity still needs to be further explored.

Insulin-like peptide-1 receptor agonist (GLP-1RA) enhances insulin secretion by activating the GLP-1 receptor and reduces blood sugar. Semaglutide is a long-acting glucagon-like peptide-1 receptor agonist and has the effect of reducing sugar and weight loss. In a clinical trial, we observed a significantly lower risk of heart disease in patients with type 2 diabetes treated with smegrin, and a significant improvement in the prognosis of heart disease. However, most studies on GLP-1R agonists focus on the mechanism of atherosclerosis induced by diabetes. There are few studies on the protective effect of early myocardial injury caused by obesity, and the molecular mechanism of drugs and new target effects is lacking. Obesity and diabetes have common pathogenic mechanisms, which can lead to cardiac lesions. Hydroxysteroid dehydrogenase-like protein 2 (HSDL2) is a member of the short-chain dehydrogenase/reductase (SDR) family, ^{5, 6} expressed in fat, myocardium and other tissues. And it can catalyze the oxidation and reduction of various substrates, such as steroids, sugars, vitamin A and fatty acids.⁷ A large number of studies have shown that HSDL2 is a key factor in the regulation of fatty acids in lipid metabolism, and it also participates in cholesterol synthesis.^8–10 Shang et al observed that long-chain non-coding RNA LNMICC can promote lymph node metastasis in cervical cancer by reprogramming fatty acid metabolism, which also proves that HSDL2 is a key factor for fatty acids to regulate lipid metabolism.¹¹ In recent years, it has been found that abnormal lipid metabolism can accelerate cardiomyopathy.¹² HSDL2 can participate in the synthesis of cholesterol by binding the coenzyme NADPH. The study found that when HSDL2 is overexpressed in the body, the cholesterol synthesis in the cell is significantly accelerated, and the total cholesterol in the body is significantly increased.⁹ At the same time, our previous study of cardiovascular protein expression in mice based on proteomics-fat diet showed that Hsd17b4, Hsdl2 and Acadvl are proteins mainly involved in lipid metabolism, and Hsd17b4, Hsdl2 and Acadvl, as co-differentiated expression proteins of the heart and aorta (Co-DEP), may become new targets for the diagnosis and treatment of obese cardiovascular diseases. Therefore, we assume that Hsd17b4 and Hsdl2 are involved in regulating lipid metabolism and oxidative stress, because they are all related to catalase activity, and peroxidase bodies are essential in maintaining cell redox normal state.¹³ In addition, HSDL2 expresses disorders in a variety of cancers and is associated with tumor progression.^{14, 15} HSDL2 is positioned at the peroxisome, which also affects tumor progression by regulating lipid metabolism.^{7, 8} Iron death is a type of iron-dependent cell death characterized by increased lipid peroxidation; this type of cell death is different from necrosis, apoptosis and autophagy.¹⁶ Iron death plays a potential role in nerve formation, cancer and organ dysfunction.^{17, 18} Research shows that HSDL2 is related to the occurrence and development of iron death.¹⁹ However, so far, it is not clear whether the abnormality of HSDL2 is related to myocardial damage caused by obesity.

In summary, we screened the heart and aortic Co-DEP based on proteomics results. Then carry out functional analysis of the key proteins.¹³ Therefore, HSDL2 was selected to further explore the molecular mechanism of the protective effect of Semaglutide on myocardial injury in obese mice and potential new clinical therapeutic targets for obesity-related cardiomyopathy. To further verify this mechanism, we have established a high-fat myocardial cell model to observe changes in myocardial cell damage. Protein immunosprinting technology and polymerase chain reaction technology were used to observe changes in myocardial cell proteins and mRNA in high-fat mice before and after Smegrupide intervention and before and after HSDL2 knockout. The molecular mechanism of Smegrutide's protective effect on myocardial cell damage caused by high fat by regulating HSDL2 was explored.

2.1 Animals and Experimental Design

In this study, 24 6-week-old male C57BL/6 mice were obtained from Hebei Shengwu Technology Co., Ltd. The company holds a license (certificate number: SYXK) (June 20150004) for the sale and distribution of experimental animals. These mice were then placed in the Experimental Animal Center of Hebei Provincial People's Hospital, where they were raised under standard laboratory conditions. These conditions include a temperature of 22 ± 2°C, a humidity of 55 ± 10%, a 12-hour light-dark cycle, and free drinking water. These standardized conditions ensure that mice have a suitable environment during the study.

After a one-week domestication period, the mice were randomly divided into the normal feed group (NC), the high-fat feed group (HF) and the high-fat feed plus meglutide group (Sema). It should be noted that all experimental procedures are approved by the Animal Ethics Committee of Hebei Provincial General Hospital and carried out in accordance with the Regulations on the Management of Experimental Animals in Hebei Province. The NCD group feeds normal daily food with a fat content of 4%, a protein content of 20% and a carbohydrate content of 20% (D1035, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 34.8 kcal/100 g. The high-fat group feeds high-fat feed with a fat content of 60%, a protein content of 20% and a carbohydrate content of 20% (H10060, Beijing Huafukang Biotechnology Co., Ltd., China), with a total energy of 524 kcal/100 g. The smeglu peptide group followed a similar high-fat diet for 14 weeks, and then injected subcutaneously with a daily dose of 30 nmol/kg/day (Novo Nordisk, Bagsvaerd, Denmark). The maximum dose of smeglupeptide is selected according to previously published mouse studies. After 8 weeks of treatment, glucose tolerance test and weight and serum measurement were carried out. The mouse fasted for 12 hours before euthanasia. After the experiment, 1% sodium pentobarbital (60 mg/kg) was injected into the peritoneal cavity of the mouse. Blood samples were collected from the posterior orbital sinus and placed in a sterile tube containing 1mm ethylenediaminetetraacetic acid (EDTA). Then euthanate the mice. Collect the heart tissue of mice, weigh it, stain it with Sumujing and Yihong or freeze it with liquid nitrogen, and store it at -80°C for further analysis.

2.2 Weight assessment

During the whole experiment, the weight of the mice was measured weekly. These measurements can provide valuable data for assessing the physiological and metabolic effects of drug interventions on mice.

2.3 Enzyme linked immunosorbent assay (ELISA)

Elabscience Mouse insulin ELISA Kit was used to determine the plasma insulin (INS) level of mice. The kit was made by Wuhan Elarite Biological Department. Produced by Technology Co., Ltd. This kit is specially designed to measure insulin levels in mouse plasma samples.

Nanjing Jiancheng's commercial kit is used to detect low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), serum total cholesterol (TC), triglycerides (TG), inflammatory cytokines (IL-1β), tumor necrosis factor α (TNF-α), propylene aldehyde ( MDA) and superoxide dismutase (SOD) levels. All measurements are detected using VERSAmax, a fully automatic ELISA reader made in the United States. Use Graphpad Prism software to analyze the data obtained from the ELISA reader.

2.4 IHC

The paraffin slices (thickness of 3µm) of mice with fixed formalin were dewaxed and rehydrated. 3% hydrogen peroxide solution blocks endogenous peroxidase activity. The slide and anti-HSDL2 (1:200) anti-incubation overnight, and then incubate immunoglobulin G (IgG) coupled with horseradish peroxidase (HRP) for 50 minutes at room temperature. The slicing is made of freshly prepared DAB color rendering liquid. The color rendering time is controlled under the microscope, and the positive is brownish yellow. Sugnylin 3min re-infects the nucleus. The slice is placed under a white light microscope (Nikon Instrument Co., Ltd., China) for interpretation of the results.

2.5 cell culture

Mouse cardiomyocytes (HL-1) are cultured in DMEM medium (Gibco, USA, 22400089), adding 10% fetal bovine serum (Gibco, USA, 16140071) and 1% double antibiotics (100µg/mL penicillin and 100 U/mL streptomycin). Cells hatch at 37°C in a humidifying incubator with 5% CO2.

2.6 Study subgroups

High-fat cell additives (sodium palmitate concentration is 6mmol/L) and complete medium at a ratio of 1:30, and finally palmitic acid (PA) 0.25mmol/L. The cell suspension is inoculated into the 6-hole plate, and the prepared palmitine solution is added after the cell is attached to the wall. It is cultured at 37°C for 24 hours to build a high-fat cardiomyocyte model. In the same way, the prepared smegroupide (concentration of 100nmol/L) will intervene in the high-fat cardiomyocyte model for 24 hours for the following experiments.

2.7 HSDL2 transfection

siHSDL2 (HSDL2 knocks low RNA) is processed by GenePharma (Shanghai, China). Try to transfect the cell line with the Lipofectamine 3000 of Genechem (Shanghai, China). HSDL2 small interference RNA (siRNA) (si-HSDL2) and siRNA (siRNA control) were obtained from GenePharma.

SiRNA is transfected with Lipofectamine 3000 to HL-1 cells according to the experimental instructions. After transfection, the transfection efficiency is verified by western blotting 24 hours, and the transfection stable cells are used for the next experiment. Transfection sequence, siRNA-HSDL2 forward: GGGAGGACCUGGUAUCGAATT, reverse: UUCGAUACCAGGUCCUCCCTT.

The cells were divided into palmitic acid (PA) group, palmitate plus semaglutide group (Sema) group, knockout HSDL2 plus palmitate group (Si-HSDL2) group and normal control (NC) group.

2.8 Western blotting

Protein extraction uses cell cracking buffer (Biosharp, China, BL509A) with phase inhibitor (Biosharp, China, BL507A). Protein concentration was measured using bicinchoninic acid protein assay kit (Servicebio, China, G2026). The protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoretic (SDS-PAGE) method and transferred to a polyvinylidene (PVDF) membrane (Immobilon-P, USA). Sealed with 5% skim milk powder. After the closure, use appropriately diluted rabbit-derived HSDL2 (Proteintech, USA), P62 (Servicebio, China), LC3 (Servicebio, China) and Rat-derived Gapdh (ABclonal, USA) to infer overnight at 4℃, and inocate with The film was obtained by exposure of Amersham Imager 600 ultra-sensitive multifunction imager (General Electric, American).

2.9 Quantitative reverse transcription PCR (qRT-PCR)

Total RNA is extracted with TRIzol reagent. The isolated RNA is reversed into complementary DNA (cDNA) with SweScript All-in-one RT SuperMix for qPCR (Servicebio, China, G3337). Adopt SuperReal PreMix Plus (SYBR Green) (TIANGEN, China, FP205) in StepOnePlus real-time fluorescent quantitative PCR system (Applied Biosystem, Quantification on USA, Cat#4376600). The results are calculated using the 2-ΔΔCT method. The primers used in qRT-PCR are shown in Table 1.

Table 1

Sequences of primers used for qPCR.
Genes	Forward (5'→3')	Reverse (5'→3')
HSDL2	ATTCTCAATCTCAGCCCACC	TCCCAGCATATCCATAGCAG
β-actin	GTGACGTTGACATCCGTAAAGA	GTAACAGTCCGCCTAGAAGCAC

2.10 Cell viability detection

Cell activity was evaluated by CCCK-8 determination (Biosharp, China, BS350A). Cells are inoculated on 96 orifice plates (1 × 103 cells per hole) and cultured for 24 hours incubators containing 10% fetal bovine serum incubators of 37°C and 5% CO2. After the cell was attached to the wall, the Palmitic Acid (PA) group intervened with 20% PA for 24 hours, the semaglutide group intervened with 20% for 24 hours, and then 200nmmol/L. The cell is then hatched with the CCK-8 solution for 2 hours. The absorption at 450nm is measured by Synergy HT multi-mode microporous plate (BioTek, USA).

2.11 IF

In order to detect the expression of HSDL2, cells were inoculated into confocal dishes and cultured for 24 hours at 37°C and 5% CO2 with an RPMI 1640 medium containing 10% bovine serum. After knocking out HSDL2, the Si group intervened with 20% palmitic acid for 24 hours, the PA group with 20% PA intervention for 24 hours, the semaglutide group with 20% intervention for 24 hours, and 200nmmol/L semaglutide intervention for 24 hours. Cells are fixed with 4% polyformaldehyde, transparent, and closed by 1% bovine Serum Protein (BSA). The sample is incubated overnight with an anti-HSDL2 (1:500), and then the fluorescent rabbit-resistant IgG combined with 486 is incubated at room temperature for 1.5 hours. The nucleus was stained with hoechst and imaged under a laser confocal microscope (observer Z1, Zeisss, Germany).

2.12 Enzyme-linked immunosorbent assay

The corresponding ELISA kit (Esebio, Shanghai, China) was used to detect interleukin (IL)-6 and tumor necrosis factor (TNF)-α levels in mice. Each group of cell supernatant was added to the pores and reacted with the detected antibody labeled by horseradish peroxidase (HRP), and inocchered at 37℃ for 60 min. Remove the liquid and clean the orifice plate. Add color developer A and color developer B, 37℃ to avoid light and inhale for 10min, and add 50µL of reaction termination solution per hole to determine the absorbance (OD) value of each hole at 450nm.

2.13 Measurement of ROS production

Use fluorescent probe dichlorodihydrofluorofluoroin diacetate (DCFH-DA, Zomanbio, China) to detect the ROS level. According to the manufacturer's instructions, add 10µM DCFHDA to each group after processing. Cell incubation for 30min, washing with DMEM 3 times, and laser confocal (BD Biosciences, USA) to detect the fluorescence intensity.

2.14 Assessment of MDA

In order to detect the level of propylene aldehyde, the treated cells are mixed and incubated with 300µL of MDA working solution containing thiobarbituric acid (TBA) for 60 minutes, and then centrifuge to remove the supernatant, using Gene5 multifunctional enzyme labeler (Gene, USA) analyze.

2.15 Cell apoptosis assay

According to the reagent manufacturer's plan, Annexin V-FITC/propyl iodide (PI) cell apoptosis test kit (Elabscience (China)) is used for apoptosis detection according to the instructions. BD Biosciences (USA) was used to detect apoptosis and analyze at least 10,000 cells in the gated area. The results are expressed as a percentage of the total number of cells.

2.16 Statistical processing

The average comparison of the two sets of data is tested by Student's t. Single-factor variance analysis is used to compare the data mean of three or more groups. P < 0.05 is defined as a statistically significant difference between groups. All statistical analysis uses Graphpad 8.0 software for statistical analysis.

3.1 Changes in weight in three groups of mice

At first, the weight of the three groups of mice was not different. However, after a 14-week high-fat diet, the weight of HF mice increased significantly compared with that in the NC group (Fig. 1, P < 0.01), indicating that the obesity model was successfully established. After the semaglutide drug intervention of 8W, the weight of the Sema group decreased significantly compared with the HF group (Fig. 1, P < 0.01). From the 18th week, the weight of the Sema and NC groups was basically the same (Fig. 1, P > 0.05). It illustrates the weight changes of mice after high-fat diet and smegroupide treatment. Figure 1 describes a line chart of weight changes in three groups of mice.

3.2 Changes in blood sugar and blood lipids in three groups of mice

TC, HDL-C, LDL-C, FBG and OGTT of three groups of mice were determined to evaluate the changes in blood lipids and blood sugar and the regulation of glycolipid disorders by smeglupeptide in obese mice. The serum TC, HDL-C, LDL-C and FBG levels of the mice in the HF group were significantly higher than those of the mice in the NC group (Fig. 2, P < 0.01), and the average blood lipids and FBG water in the Sema group decreased significantly (Fig. 2, P < 0.01). The OGTT level of the HF group was also significantly higher than that of other groups (Fig. 2, P < 0.01). The OGTT of the Sema group increased at 15 minutes and 30 minutes earlier than that of the NC group. After that, the level of the two groups is basically the same (Fig. 2, P > 0.05). At the same time, the insulin level of obese mice was higher than that of the smeglutide treatment group and the normal group (Fig. 2, P < 0.01). Compared with the HF group, the insulin level of the Sema group decreased more significantly than that of the NC group. (Fig. 2, P < 0.01).

3.3 The effect of smeglupeptide on the level of inflammation and oxidative stress caused by obesity

The levels of TNF-α, MDA, IL-1β, T-SOD and adenosine in myocardial tissue of obese mice were significantly higher than those of normal mice (Fig. 3, P < 0.05), indicating that obesity can aggravate inflammation and oxidative stress of myocardial tissue. After treatment with smeglu peptide, the levels of TNF-α, IL-6, MDA, ROS, IL-1β, T-SOD and adenosine in myocardial tissue decreased, indicating that smeglu peptide can improve the inflammation and oxidative stress levels of myocardial tissue caused by obesity to a certain extent (Fig. 3, P < 0.05).

3.4 Effect of HSDL2 on myocardial cells in obese mice

After transfection of HSDL2-siRNA, the morphology of mouse cardiomyocytes changed, and the transfected cells became wider than the NC group(Fig. 8). After transfection HSDL2-siRNA, Wb expression of HSDL2 showed a corresponding trend, HSDL2 expression increased in PA group, and PCR and IF results were consistent with Wb results (Fig. 5, P < 0.05). PA-induced high-fat environment increases ROS in myocardial cells, and HSDL2 knockout reduces the level of oxidative stress caused by PA (Fig. 5, P < 0.05). In addition, PA will increase the autovoy of cardiomyocyte, while knockout HSDL2 can relieve cell autochy at a certain level (Fig. 5, P < 0.05).

3.5 Statistical processing

The myocardial cells in PA group showed obvious fat vacuoles and slow cell proliferation, while those in Sema group were reduced(Fig. 8).The levels of TNF-α, IL-6, MDA and ROS in the Sema group decreased significantly, and the difference was statistically significant (Fig. 4, P < 0.05). Sema can also increase cell activity and reduce apoptosis affected by PA (Fig. 6, P < 0.001). At the same time, the results of Wb and IF tests in the Sema group also showed that Sema can reduce cell autophagy caused by PA (Fig. 5, P < 0.05). For HSDL2, compared with the PA group, Sema reduces the protein expression of HSDL2 in cardiomyocytes, and the PCR results are consistent (Fig. 7,P < 0.05). In addition, the immunohistochemistometry of mouse myocardial tissue to detect the expression of HSDL2 in the Sema group and PA group was consistent with the Wb expression (Fig. 7, P < 0.05).

In recent years, with the improvement of people's living standards, the number of obesity has increased, and the damage of obesity-related target organs, such as the heart, islet and kidney function, has posed a considerable threat to people's health.²⁰ According to many clinical and basic experiments, obesity damages the human body through a significant increase in lipid glucose levels, leading to metabolic disorders.²¹ Research shows that in the model of obese mice caused by a high-fat diet, obesity increases the levels of TG, TC, LDL-C and fasting blood glucose in the blood. Elevated blood lipids and blood sugar levels, coupled with inflammatory states caused by obesity, will accelerate lipid oxidation, leading to atherosclerosis and cardiac function impairment.²² At the same time, the increase in LDL-C and the decrease in HDL-C caused by obesity are related to oxidative stress, which will lead to a large amount of lipid oxidation, which further significantly increases the lipid peroxidation product.²³ The activation of a variety of oxidoreductases and the reduction of the activity of cellular antioxidant enzymes (including Cu-Zn SOD, hydroperoxidase and GPx) can induce an increase in lipid peroxide and reactive oxygen (ROS), thus damaging cells and tissues.^{24, 25} In addition, obesity also leads to a significant increase in TNF-α and IL-6 levels in serum and cardiac tissue, indicating the presence of inflammation in the body. The increase in cardiac tissue ROS caused by obesity may lead to the production of toxic MDA. Increased lipid synthesis, inflammation and oxidative stress all contribute to lipid peroxidation to produce excessive MDA. MDA levels in cardiac tissue are related to mitochondrial activity, cell membrane damage and peroxidation damage. Changes in lipid and oxidative stress indicators can affect myocardial cell metabolism, thus affecting the progression of obesity-associated cardiomyopathy.^{26, 27} In the early stage of obesity, cardiomyocyte hypertrophy and ventricular wall thickening can still produce sufficient compensatory function, but the occurrence of compensation loss will lead to irreversible serious cardiac function damage.^{28, 29} In our previous studies, cardiac ultrasound in obese mice showed that the ventricular wall was thickened and the ventricular volume decreased, indicating centritropic hypertrophy.³⁰ In this study, we established a mouse model of the HF group and the Sema group, and also established a cell model of the PA group and the Sema group to better study the mechanism of myocardial damage caused by obesity and whether smeglutide can reduce the damage caused by high fat. The weight of the mice in the HF group increased compared with that of the mice in the Sema group, and the blood lipid levels such as TC, TG and LDL-C increased. The levels of TNF-α, IL-6, ROS and MDA in the serum of mice in the HF group also increased significantly. The expression results of the same PA group cell oxidative stress level are similar to those of the HF group. In addition, the morphology of the myocardial cells in the PA group has changed compared with that of the NC group. The cells in the PA group showed lipidrop formation and cell atrophy under a 20-fold electron microscope. At the same time, cell fragments formed by large-scale cell death can be seen. Using cck8 to measure cell vitality, the cell vitality of the PA group also decreased significantly. Cell autophagy and apoptosis of the PA group also increased significantly. This means that obesity increases the level of lipids and oxidative stress in the body, resulting in an increase in the production of lipid peroxide products, which leads to myocardial damage and myocardial disease.

HSDL2 is located on the human chromosome 9Q32, with a length of 92kd on the chromosome, with 11 exonons and 418 amino acids. HSDL2 belongs to the SDR family, which is a group of proteins that catalyze the oxidation and reduction of a variety of substrates, including steroid hormones, oxysterols, BASs, prostaglandins, vitamins a, fatty acids, amino acids, sugars, etc.³¹ HSDL2 includes n-end SDR domain and c-end SCP2 domain. These two structural characteristics are involved in the redox reaction of nicotinamide adenine dinucleotide (oxidation form) (NAD)/NAD phosphate (NADP)-dependent and the binding of sterols and other lipids.^{32, 33} HSDL2 can bind NADP/H, sterol derivatives and fatty acids, which is related to HSDL2's highly conservative NADP/H binding site and SCP2 domain, which is a structure that binds sterols and other lipids to promote its intermembraneal transport.^{34, 35} In past studies, it has only been proposed that HSDL2 affects lipid metabolism, and the relationship between HSDL2 and high-lipid myocardium has not been further studied. This study found that in the immunohistochemistry of mouse myocardium, there were significantly more brown and yellow particles in the Sema group, that is, HSDL2 was highly expressed in the HF group, and the expression in the Sema group was reduced. At the same time, the Wb, PCR and IF results of the PA group of mouse cardiomyocytes and Sema group were consistent with this. That is, high fat does improve the expression of HSDL2 in the myocardium, and smegropeptide can reduce this expression. We performed HSDL2 knockout to determine whether HSDL2 is one of the mechanisms for high fat to cause changes in myocardial function. After knockout of HSDL2, according to the autophagy of IF and ROS results, the expression inhibition of HSDL2 improves the autophagy and oxidative stress levels of high-fat-induced cardiomyocytes. According to the above findings, HSDL2 seems to be one of the mechanisms of myocardial injury.

Smeglutide is a sugar-lowering drug belonging to GLP-1R. A large number of tests have proved that it has a hypoglycemic and weight-reducing effect.³⁶ In recent years, the weight loss effect of smegropeptide has been widely studied clinically. This drug can reduce basic weight by 20–30% with few side effects.^{37, 38} At the same time, smegroupide has also been shown to reduce the risk of cardiovascular events in patients with type 2 diabetes and have a cardiac protective effect on patients who are overweight or obese but have no diabetes.^{39, 40} According to our previous research, Smegrutin can reduce the negative effects of obesity on the heart and change the expression of many proteins involved in Lipid metabolism in heart tissue.³⁰ This study found that smeglutide can reduce the weight and blood lipid levels of mice in the HF group, and at the same time reduce the level of oxidative stress indicators such as lipids, TNF-α, IL-6, ROS and MDA in serum and myocardial cells of mice in the HF group and PA group. Although smeglutide cannot change the cell morphology caused by the PA group, microscopic observation found that a wide range of cell death stopped. When measuring cell activity, it was found that the cell activity of the Sema group was higher than that of the PA group. At the same time, the cell autophagy level and apoptosis level of the Sema group decreased significantly compared with the PA group. The results show that smeglutide may reduce the state of myocardial inflammatory injury caused by high fat and restore myocardial vitality. By looking for the expression of HSDL2 in high-fat myocardium above, it was found that smeglutide significantly reduced the expression of HSDL2 in high-fat myocardium. According to the above findings, HSDL2 may be one of the mechanisms that cause myocardial injury, and smeglutide seems to protect the myocardium by regulating the expression of HSDL2.

Our study shows that obesity can lead to oxidative stress, inflammatory reactions and cell autosage, apoptosis in cardiomyocyte cells. Expression inhibition of HSDL2 can reduce the levels of autophage and oxidative stress in myocardial cells. Semaglutide can reduce cell damage caused by obesity while also reducing the high level of HSDL2 expression caused by obesity. It provides new ideas for GLP-1 receptor agonists as a target therapy for regulating the treatment and prognosis of myocardial injury caused by obesity, and also provides a new potential target for clinical control of obesity-related myocardial injury.

Ethics approval

All experimental procedures and animal management procedures were approved by the Ethics Committee of Hebei General Hospital (Approval Number: 2023-32; Date of approval: Jun 14, 2023).

Funding

This study was supported by the Hebei Province Natural Science Foundation (H2022307026). The funding bodies played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Authorship contribution statement

Lin Yang: Conceptualization, Investigation, Formal analysis, Project administration, Writing – original draft. Xiaoyu Pan: Conceptualization, Project administration, Writing – review & editing, Funding acquisition. Zhenyu Pan: Resources, Investigation. Haina Gao: Investigation. Jiangli Ban: Resources. Shuchun Chen: Conceptualization, Funding acquisition, Supervision, Project administration, Writing – review & editing.

Data availability

Data available on request from the authors.

Conflicts of interest

None of the authors have a conflicts of interest

Pan, X.; Chen, S.; Chen, X.; Ren, Q.; Yue, L.; Niu, S.; Li, Z.; Zhu, R.; Chen, X.; Jia, Z.; Zhen, R.; Ban, J., Effect of high-fat diet and empagliflozin on cardiac proteins in mice. Nutr Metab (Lond) 2022, 19 (1), 69.
Rosengren, A., Obesity and cardiovascular health: the size of the problem. Eur Heart J 2021, 42 (34), 3404-3406.
Ma, L.; Ma, S.; He, H.; Yang, D.; Chen, X.; Luo, Z.; Liu, D.; Zhu, Z., Perivascular fat-mediated vascular dysfunction and remodeling through the AMPK/mTOR pathway in high-fat diet-induced obese rats. Hypertens Res 2010, 33 (5), 446-53.
Ionică, L. N.; Gaiță, L.; Bînă, A. M.; Soșdean, R.; Lighezan, R.; Sima, A.; Malița, D.; Crețu, O. M.; Burlacu, O.; Muntean, D. M.; Sturza, A., Metformin alleviates monoamine oxidase-related vascular oxidative stress and endothelial dysfunction in rats with diet-induced obesity. Mol Cell Biochem 2021, 476 (11), 4019-4029.
Kowalik, D.; Haller, F.; Adamski, J.; Moeller, G., In search for function of two human orphan SDR enzymes: hydroxysteroid dehydrogenase like 2 (HSDL2) and short-chain dehydrogenase/reductase-orphan (SDR-O). J Steroid Biochem Mol Biol 2009, 117 (4-5), 117-24.
Dai, J.; Xie, Y.; Wu, Q.; Wang, L.; Yin, G.; Ye, X.; Zeng, L.; Xu, J.; Ji, C.; Gu, S.; Huang, Q.; Zhao, R. C.; Mao, Y., Molecular cloning and characterization of a novel human hydroxysteroid dehydrogenase-like 2 (HSDL2) cDNA from fetal brain. Biochem Genet 2003, 41 (5-6), 165-74.
Yang, Y.; Han, A.; Wang, X.; Yin, X.; Cui, M.; Lin, Z., Lipid metabolism regulator human hydroxysteroid dehydrogenase-like 2 (HSDL2) modulates cervical cancer cell proliferation and metastasis. J Cell Mol Med 2021, 25 (10), 4846-4859.
Han, A.; Xu, R.; Liu, Y.; Yin, X.; Lin, Z.; Yang, W., HSDL2 Acts as a Promoter in Pancreatic Cancer by Regulating Cell Proliferation and Lipid Metabolism. Onco Targets Ther 2021, 14, 435-444.
Cheng, Z.; Li, Y.; Sui, C.; Sun, X.; Xie, Y., Synthesis, purification and crystallographic studies of the C-terminal sterol carrier protein type 2 (SCP-2) domain of human hydroxysteroid dehydrogenase-like protein 2. Acta Crystallogr F Struct Biol Commun 2015, 71 (Pt 7), 901-5.
Gronemeyer, T.; Wiese, S.; Ofman, R.; Bunse, C.; Pawlas, M.; Hayen, H.; Eisenacher, M.; Stephan, C.; Meyer, H. E.; Waterham, H. R.; Erdmann, R.; Wanders, R. J.; Warscheid, B., The proteome of human liver peroxisomes: identification of five new peroxisomal constituents by a label-free quantitative proteomics survey. PLoS One 2013, 8 (2), e57395.
Shang, C.; Wang, W.; Liao, Y.; Chen, Y.; Liu, T.; Du, Q.; Huang, J.; Liang, Y.; Liu, J.; Zhao, Y.; Guo, L.; Hu, Z.; Yao, S., LNMICC Promotes Nodal Metastasis of Cervical Cancer by Reprogramming Fatty Acid Metabolism. Cancer Res 2018, 78 (4), 877-890.
Kim, M. S.; Kim, W. J.; Khera, A. V.; Kim, J. Y.; Yon, D. K.; Lee, S. W.; Shin, J. I.; Won, H. H., Association between adiposity and cardiovascular outcomes: an umbrella review and meta-analysis of observational and Mendelian randomization studies. Eur Heart J 2021, 42 (34), 3388-3403.
Pan, X.; Zhang, X.; Ban, J.; Yue, L.; Ren, L.; Chen, S., Effects of High-Fat Diet on Cardiovascular Protein Expression in Mice Based on Proteomics. Diabetes Metab Syndr Obes 2023, 16, 873-882.
Zhang, D. Y.; Liu, Z.; Lu, Z.; Sun, W. L.; Ma, X.; Zhang, P.; Wu, B. Q.; Cui, P. Y., Lentivirus-mediated overexpression of HSDL2 suppresses cell proliferation and induces apoptosis in cholangiocarcinoma. Onco Targets Ther 2018, 11, 7133-7142.
Sun, Q.; Zhang, Y.; Su, J.; Li, T.; Jiang, Y., Role of Hydroxysteroid Dehydrogenase-Like 2 (HSDL2) in Human Ovarian Cancer. Med Sci Monit 2018, 24, 3997-4008.
Dixon, S. J.; Lemberg, K. M.; Lamprecht, M. R.; Skouta, R.; Zaitsev, E. M.; Gleason, C. E.; Patel, D. N.; Bauer, A. J.; Cantley, A. M.; Yang, W. S.; Morrison, B., 3rd; Stockwell, B. R., Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 2012, 149 (5), 1060-72.
Stockwell, B. R.; Friedmann Angeli, J. P.; Bayir, H.; Bush, A. I.; Conrad, M.; Dixon, S. J.; Fulda, S.; Gascón, S.; Hatzios, S. K.; Kagan, V. E.; Noel, K.; Jiang, X.; Linkermann, A.; Murphy, M. E.; Overholtzer, M.; Oyagi, A.; Pagnussat, G. C.; Park, J.; Ran, Q.; Rosenfeld, C. S.; Salnikow, K.; Tang, D.; Torti, F. M.; Torti, S. V.; Toyokuni, S.; Woerpel, K. A.; Zhang, D. D., Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171 (2), 273-285.
Tang, D.; Chen, X.; Kang, R.; Kroemer, G., Ferroptosis: molecular mechanisms and health implications. Cell Res 2021, 31 (2), 107-125.
Ma, S.; Ma, Y.; Qi, F.; Lei, J.; Chen, F.; Sun, W.; Wang, D.; Zhou, S.; Liu, Z.; Lu, Z.; Zhang, D., HSDL2 knockdown promotes the progression of cholangiocarcinoma by inhibiting ferroptosis through the P53/SLC7A11 axis. World J Surg Oncol 2023, 21 (1), 293.
Bunbupha, S.; Apaijit, K.; Maneesai, P.; Prasarttong, P.; Pakdeechote, P., Nobiletin ameliorates high-fat diet-induced vascular and renal changes by reducing inflammation with modulating AdipoR1 and TGF-β1 expression in rats. Life Sci 2020, 260, 118398.
O'Neil, P. M.; Birkenfeld, A. L.; McGowan, B.; Mosenzon, O.; Pedersen, S. D.; Wharton, S.; Carson, C. G.; Jepsen, C. H.; Kabisch, M.; Wilding, J. P. H., Efficacy and safety of semaglutide compared with liraglutide and placebo for weight loss in patients with obesity: a randomised, double-blind, placebo and active controlled, dose-ranging, phase 2 trial. Lancet 2018, 392 (10148), 637-649.
Piché, M. E.; Tchernof, A.; Després, J. P., Obesity Phenotypes, Diabetes, and Cardiovascular Diseases. Circ Res 2020, 126 (11), 1477-1500.
Cafe, S. L.; Nixon, B.; Dun, M. D.; Roman, S. D.; Bernstein, I. R.; Bromfield, E. G., Oxidative Stress Dysregulates Protein Homeostasis Within the Male Germ Line. Antioxid Redox Signal 2020, 32 (8), 487-503.
Rani, V.; Deep, G.; Singh, R. K.; Palle, K.; Yadav, U. C., Oxidative stress and metabolic disorders: Pathogenesis and therapeutic strategies. Life Sci 2016, 148, 183-93.
Holvoet, P.; Kritchevsky, S. B.; Tracy, R. P.; Mertens, A.; Rubin, S. M.; Butler, J.; Goodpaster, B.; Harris, T. B., The metabolic syndrome, circulating oxidized LDL, and risk of myocardial infarction in well-functioning elderly people in the health, aging, and body composition cohort. Diabetes 2004, 53 (4), 1068-73.
Kolijn, D.; Pabel, S.; Tian, Y.; Lódi, M.; Herwig, M.; Carrizzo, A.; Zhazykbayeva, S.; Kovács, Á.; Fülöp, G.; Falcão-Pires, I.; Reusch, P. H.; Linthout, S. V.; Papp, Z.; van Heerebeek, L.; Vecchione, C.; Maier, L. S.; Ciccarelli, M.; Tschöpe, C.; Mügge, A.; Bagi, Z.; Sossalla, S.; Hamdani, N., Empagliflozin improves endothelial and cardiomyocyte function in human heart failure with preserved ejection fraction via reduced pro-inflammatory-oxidative pathways and protein kinase Gα oxidation. Cardiovasc Res 2021, 117 (2), 495-507.
Watanabe, K.; Nagao, M.; Toh, R.; Irino, Y.; Shinohara, M.; Iino, T.; Yoshikawa, S.; Tanaka, H.; Satomi-Kobayashi, S.; Ishida, T.; Hirata, K. I., Critical role of glutamine metabolism in cardiomyocytes under oxidative stress. Biochem Biophys Res Commun 2021, 534, 687-693.
Alpert, M. A.; Omran, J.; Bostick, B. P., Effects of Obesity on Cardiovascular Hemodynamics, Cardiac Morphology, and Ventricular Function. Curr Obes Rep 2016, 5 (4), 424-434.
Harada, T.; Obokata, M., Obesity-Related Heart Failure with Preserved Ejection Fraction: Pathophysiology, Diagnosis, and Potential Therapies. Heart Fail Clin 2020, 16 (3), 357-368.
Pan, X.; Yue, L.; Ban, J.; Ren, L.; Chen, S., Effects of Semaglutide on Cardiac Protein Expression and Cardiac Function of Obese Mice. J Inflamm Res 2022, 15, 6409-6425.
Kavanagh, K. L.; Jörnvall, H.; Persson, B.; Oppermann, U., Medium- and short-chain dehydrogenase/reductase gene and protein families : the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cell Mol Life Sci 2008, 65 (24), 3895-906.
Persson, B.; Kallberg, Y.; Bray, J. E.; Bruford, E.; Dellaporta, S. L.; Favia, A. D.; Duarte, R. G.; Jörnvall, H.; Kavanagh, K. L.; Kedishvili, N.; Kisiela, M.; Maser, E.; Mindnich, R.; Orchard, S.; Penning, T. M.; Thornton, J. M.; Adamski, J.; Oppermann, U., The SDR (short-chain dehydrogenase/reductase and related enzymes) nomenclature initiative. Chem Biol Interact 2009, 178 (1-3), 94-8.
Chiapparino, A.; Maeda, K.; Turei, D.; Saez-Rodriguez, J.; Gavin, A. C., The orchestra of lipid-transfer proteins at the crossroads between metabolism and signaling. Prog Lipid Res 2016, 61, 30-9.
Bhatia, C.; Oerum, S.; Bray, J.; Kavanagh, K. L.; Shafqat, N.; Yue, W.; Oppermann, U., Towards a systematic analysis of human short-chain dehydrogenases/reductases (SDR): Ligand identification and structure-activity relationships. Chem Biol Interact 2015, 234, 114-25.
Burgardt, N. I.; Gianotti, A. R.; Ferreyra, R. G.; Ermácora, M. R., A structural appraisal of sterol carrier protein 2. Biochim Biophys Acta Proteins Proteom 2017, 1865 (5), 565-577.
Ryan, D. H.; Lingvay, I.; Colhoun, H. M.; Deanfield, J.; Emerson, S. S.; Kahn, S. E.; Kushner, R. F.; Marso, S.; Plutzky, J.; Brown-Frandsen, K.; Gronning, M. O. L.; Hovingh, G. K.; Holst, A. G.; Ravn, H.; Lincoff, A. M., Semaglutide Effects on Cardiovascular Outcomes in People With Overweight or Obesity (SELECT) rationale and design. Am Heart J 2020, 229, 61-69.
Aroda, V. R.; Ahmann, A.; Cariou, B.; Chow, F.; Davies, M. J.; Jódar, E.; Mehta, R.; Woo, V.; Lingvay, I., Comparative efficacy, safety, and cardiovascular outcomes with once-weekly subcutaneous semaglutide in the treatment of type 2 diabetes: Insights from the SUSTAIN 1-7 trials. Diabetes Metab 2019, 45 (5), 409-418.
Thethi, T. K.; Pratley, R.; Meier, J. J., Efficacy, safety and cardiovascular outcomes of once-daily oral semaglutide in patients with type 2 diabetes: The PIONEER programme. Diabetes Obes Metab 2020, 22 (8), 1263-1277.
Husain, M.; Birkenfeld, A. L.; Donsmark, M.; Dungan, K.; Eliaschewitz, F. G.; Franco, D. R.; Jeppesen, O. K.; Lingvay, I.; Mosenzon, O.; Pedersen, S. D.; Tack, C. J.; Thomsen, M.; Vilsbøll, T.; Warren, M. L.; Bain, S. C., Oral Semaglutide and Cardiovascular Outcomes in Patients with Type 2 Diabetes. N Engl J Med 2019, 381 (9), 841-851.
Bain, S. C.; Mosenzon, O.; Arechavaleta, R.; Bogdański, P.; Comlekci, A.; Consoli, A.; Deerochanawong, C.; Dungan, K.; Faingold, M. C.; Farkouh, M. E.; Franco, D. R.; Gram, J.; Guja, C.; Joshi, P.; Malek, R.; Merino-Torres, J. F.; Nauck, M. A.; Pedersen, S. D.; Sheu, W. H.; Silver, R. J.; Tack, C. J.; Tandon, N.; Jeppesen, O. K.; Strange, M.; Thomsen, M.; Husain, M., Cardiovascular safety of oral semaglutide in patients with type 2 diabetes: Rationale, design and patient baseline characteristics for the PIONEER 6 trial. Diabetes Obes Metab 2019, 21 (3), 499-508.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Semaglutide reduces cardiomyocyte damage caused by high-fat through HSDL2

Status:

Version 1

Abstract

Background

Methods

Conclusion

Figures

1. Introduction

2. Methods

2.1 Animals and Experimental Design

2.2 Weight assessment

2.3 Enzyme linked immunosorbent assay (ELISA)

2.4 IHC

2.5 cell culture

2.6 Study subgroups

2.7 HSDL2 transfection

2.8 Western blotting

2.9 Quantitative reverse transcription PCR (qRT-PCR)

2.10 Cell viability detection

2.11 IF

2.12 Enzyme-linked immunosorbent assay

2.13 Measurement of ROS production

2.14 Assessment of MDA

2.15 Cell apoptosis assay

2.16 Statistical processing

3. Results

3.1 Changes in weight in three groups of mice

3.2 Changes in blood sugar and blood lipids in three groups of mice

3.3 The effect of smeglupeptide on the level of inflammation and oxidative stress caused by obesity

3.4 Effect of HSDL2 on myocardial cells in obese mice

3.5 Statistical processing

4. Discussion

5. Conclusions

Declarations

References

Additional Declarations

Status:

Version 1