Acetoacetate Ameliorates Skin Fibrosis by Modulating TGF-β1/Smad2/3 Signaling Pathway

doi:10.21203/rs.3.rs-5282248/v1

Download PDF

Research Article

Acetoacetate Ameliorates Skin Fibrosis by Modulating TGF-β1/Smad2/3 Signaling Pathway

https://doi.org/10.21203/rs.3.rs-5282248/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Skin fibrosis is a progressive pathologic outcome of prolonged healing of cutaneous wound which has been well accepted as a metabolic disease in recent study. However, the impact of ketone body metabolism on the development of cutaneous fibrosis remains largely unknown. Here, we found that ketone body metabolism was impaired in both human scars and bleomycin induced skin fibrogenesis of mouse by bioinformatics analysis, which was further evidenced by downregulated expression of key modulators of ketone metabolism including BDH1, OXCT1, and ACAT1. With knockdown of OXCT1, a spontaneous onset of fibrosis in normal skin and exacerbation of bleomycin induced skin fibrogenesis was observed. In dermal fibroblasts treated with TGF-β1, knockdown of OXCT1 improved their phenotype transition to myofibroblasts. Mechanistic studies indicated that phosphorylation of Smad2/3 signaling was markedly suppressed by acetoacetate (AcAc) supplementation. More importantly, we found that local administration remarkably alleviated fibrosis of bleomycin treated skin in mouse. Thus, our findings underscore the therapeutic potential of AcAc as an alternative intervention for skin fibrosis.

Skin fibrosis

Ketone body

acetoacetate

Smad2/3 signaling pathway

OXCT1

Skin fibrosis is a pathological result of a dysregulated progression in tissue repair and occurs in a variety of fibrotic disorders of the skin, such as scleroderma, hypertrophic scars (HS) and keloids[1]. Cutaneous injuries caused by burns, trauma, surgical incisions and even insect bites can trigger skin fibrosis, which persists over a prolonged period of time, thus considerably affecting patients’ quality of life and mental status[2]. However, current therapeutic strategies to attenuate skin fibrosis are limited and bring about a wide range of side effects, including skin atrophy, ulceration and hyperpigmentation[3, 4]. Therefore, there is an urgent need for exploring more effective therapies that can inhibit skin fibrosis.

In the fibrotic skin, dermal fibroblasts exhibit a significant enhancement in biosynthetic and proliferative activities, leading to an excessive deposition of extracellular matrix (ECM), including collagen and glycosaminoglycan (GAG)[5, 6]. Meanwhile, transforming growth factor-beta1 (TGF-β1) plays a critical role in regulating ECM deposition by dermal fibroblasts through interaction with the classical Smad pathway[7, 8]. In this context, the TGF-β1/Smad signaling pathway has been targeted to ameliorate tissue fibrosis[9].

Serving as a vital alternative metabolic fuel source, ketone bodies are transformed from acetyl-CoA produced from fatty acid β-oxidation in the liver[10]. Acetoacetate (AcAc), β-hydroxybutyrate (β-OHB), and acetone are major types of ketone bodies, among which AcAc and β-OHB can convert to each other under the catalysis of β-hydroxybutyrate dehydrogenase (BHD)[11]. With the completion of their synthesis in liver, ketone bodies are transported to extrahepatic tissues such as brain, muscle and heart for energy supply[12]. In extrahepatic tissues, β-OHB is catalyzed into AcAc via BDH, which is subsequently converted to AcAc-CoA by the succinyl CoA-oxoacid transferase (SCOT) that is encoded by the nuclear Oxct1 gene. The generated AcAc-CoA further produces two molecules of acetyl-CoA that enters the tricarboxylic acid cycle (TCA cycle) and serves as fuel for the ultimate production of ATP.

Recently, the complicated relationship between metabolic processes, in particular the ketone bodies metabolism, and the development of fibrosis has gained increasing interest. It was found that over expression of Bdh1 in failing heart showed a 1.7-fold increase in ketone body oxidation and significantly ameliorated heart fibrosis[13]. An increased exogenous AcAc shuttle from hepatocytes to macrophage resulted in improvement in diet-induced hepatic fibrosis[14]. However, the influence of ketone body metabolism on cutaneous fibrosis remains poorly described.

In this study, we examined the gene expression related to ketone body catabolism in fibrotic tissues from human keloids and bleomycin-induced murine skin. Our findings indicated that the impairment in ketone body metabolism played a critical role in the pathogenesis of skin fibrogenesis. Furthermore, the supplementation of exogenous AcAc was shown to mitigate the progression of dermatofibrosis.

Bioinformatic analysis

Transcriptome datasets were obtained from NCBI Gene Expression Omnibus libraries GSE145725 and GSE226331, where relative gene expression levels were calculated using Cufflinks v2.2.1 in fragments per kilobase per million reads (FPKM). Transcript annotation files were obtained from the Gencode v22 Comprehensive Gene Annotation gtf file (http://www.gencodegenes.org). EdgeR, a Bioconductor software package, was used to identify differentially expressed genes (DEGs) between normal skin tissue and fibrotic keloids for gene ontology (GO) pathway analysis, the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, and to draw Volcano Plot and heat maps. A PPI network was created utilizing the Search Tool for Retrieval of Interacting Genes (STRING) database (https://string-db.org/), in which homo sapiens was the only species considered. The PPI network was constructed by mutual mapping of disease targets and drug targets, incorporating the mapping results into the STRING database.

Collection of hypertrophic scar and normal skin

Samples of hypertrophic scar were obtained from 3 donors (at an average age of 42 years) undergoing resection of scar in accordance with procedures approved by the Ethics Committee of Shanghai Ninth People's Hospital. Each participant was asked to sign an informed consent form before surgery. Hypertrophic scar and normal skin were identified upon characteristics of clinical diagnosis and pathology. Following harvest of samples, the tissues were processed for histology, fibroblast culture and qRT-PCR analysis, respectively.

Creation of skin fibrosis in mice

Fifteen 8-week-old male BALB/c mice (weighing 30–35g) were purchased from Shanghai SLAC Laboratory Animal Co.Ltd., and maintained under specific pathogen-free (SPF) conditions in animal center of Tongji University School of Medicine. All procedures were approved by the Animal Research Committee of Tongji University.

As reported previously[15], skin fibrosis was induced by subcutaneously injecting bleomycin (BLM, 5mg/kg) into a one-square-centimeter area of dorsal skin in mice every two days for four weeks (BLM group, n = 5). Administration of AcAc was performed by subcutaneous injection of AcAc (3mg/kg) in combination with bleomycin every other day for 4 weeks (AcAc group, n = 5). Injection of phosphate buffered saline (PBS: Invitrogen, USA) served as control (PBS group, n = 5). After 28 days, dorsal skin with subcutaneous adipose layer was harvested for histology and qRT-PCR.

Histological and immunofluorescent staining

Samples of human normal skin, hypertrophic scar and bleomycin-treated dorsal skin of mice were fixed with formalin and then embedded with paraffin, respectively. Following serial section in 4 µm, slices were deparaffined and dehydrated and subjected to H&E, Masson’s trichrome and Sirius Red staining. For immunofluorescent staining, primary antibodies against COL1A1 (1:500, PA5-29569, Thermo Fisher Scientific), BDH1 (1:100, 15417-1-AP, Proteintech), OXCT1 (1:600, 12175-1-AP, Proteintech), p-Smad2/3 (1:100, PA5-99378, Thermo Fisher Scientific) were incubated at 4°C overnight. Slides were washed and incubated for 1 h with Alexa Fluor 568-conjugated goat anti-rabbit IgG (1:500 dilution in 5% BSA). Nuclei were stained for 10 min at RT with 5 µg/ml Hoechst 33242 from Thermo Fisher Scientific. Images were obtained using a Fluoview FV10i confocal microscope or a BX53 fluorescence microscope from Olympus (Tokyo, Japan).

Cultivation of dermal fibroblasts

The freshly harvested dermal tissue was thoroughly washed in PBS after removing of epidermal and adipose tissues, and subjected to digestion with type I collagenase (Worthington, USA) at 37°C for one hour. Following digestion, cell pellets were obtained by centrifuging at 400×g for 10 minutes and resuspended in culture medium consisting of Dulbecco's modified Eagle's medium (DMEM; Gibco, USA), supplemented with 10% fetal bovine serum (FBS; Hyclone, USA), and 1% penicillin-streptomycin. The resuspended fibroblasts were cultured at 37°C with 5% CO2 for approximately 14 days. When reaching 80 ~ 90% confluence, cells were passaged and those at passage 3–5 were used in the following study.

Transition of fibroblasts to myofibroblasts was established by treating cells with TGF-β1 (10ng/ml) for 24 Hours as previously reported[16]. The effect of AcAc on cell phenotype transition was observed by adding AcAc (50µM) in culture medium, in the presence of absence of TGF-β1 (10ng/ml), respectively.

Knock-down of OXCT1 in vitro and in vivo

Adenoviruses engineered to express mouse OXCT1 shRNA (Ad-shOXCT1) were procured from Wei Nuo Sai Biology (Wuhan, China). These adenoviruses were propagated by infecting HEK-293a cells for a duration of 48 hours. Subsequently, the HEK cells were collected and lysed through a series of freeze-thaw cycles to release the adenoviruses, which were then subjected to CsCl density gradient ultracentrifugation for purification.

Fibroblasts at passage 1, reaching a confluence of 70–80%, were cultured in serum-free medium for 12 hours prior to transfection with either Ad-shControl or Ad-shOXCT1 at a multiplicity of infection (MOI) of 800 for 48 hours, thereby establishing stable fibroblasts with OXCT1 knockdown. Followed by a 24-hour culture period with or without TGF-β1 (10ng/ml) before undergoing further analysis.

Knock-down of OXCT1 in vivo was performed by subcutaneous injection of Ad-shOXCT1 (1×10⁹ plaque forming units (PFU) in a total volume of 10 µl) once a week for 4 weeks with or without bleomycin (Ad-shOXCT1 group, Ad-shOXCT1 + BLM group, n = 5). Subcutaneous injection of empty adenovirus (Ad-shControl) was used as a control (Ad-shControl group, Ad-shControl + BLM group, n = 5). Four weeks post-initial injection, the mice were euthanized, and their skin was meticulously harvested for subsequent analysis.

Quantitative real-time PCR

Total RNA was extracted with TRIzol (R401, Vazyme) and subsequently reverse-transcribed into cDNA with HiScript II Q RT SuperMix (R222-01, Vazyme) in preparation for qPCR. Quantitative real-time polymerase chain reaction (qRT-PCR) was consequently conducted with an Applied Biosystems 7500 device with ChamQ SYBR qPCR Master Mix (Q331-02, Vazyme). 2-ΔΔCT approach was employed to calculate the relative expression levels, in turn normalized to β-actin. The sequences of all primers are illustrated in Table 1.

Table 1

Primers used in this study.
Target gene	Primer sequences (5’–3’)
mβ-actin	5'ATATCGCTGCGCTGGTCGTC3' 5'AGGATGGCGTGAGGGAGAGC3'
mα-SMA	5'GTCCCAGACATCAGGGAGTAA3' 5'TCGGATACTTCAGCGTCAGGA3'
mCOL1A1	5’GCTCCTCTTAGGGGCCACT3’ 5’CCACGTCTCACCATTGGGG3’
mCOL3A1	5’CTGTAACATGGAAACTGGGGAAA3’ 5’CCATAGCTGAACTGAAAACCACC3’
mFN1	5’ATGTGGACCCCTCCTGATAGT3’ 5’GCCCAGTGATTTCAGCAAAGG3’
mMCT1	5'CCAGGCACCTGTGGTCAAC3' 5'GGTCTCGTGATTGGATCTGCT3'
mBDH1	5'CGGCTAGTGGCAAAGCTATC3' 5'GTTGCAGACATTGAGCTGGA3'
mOXCT1	5'CATAAGGGGTGTGTCTGCTACT3' 5'GCAAGGTTGCACCATTAGGAAT3'
mACAT1	5'CAGGAAGTAAGATGCCTGGAAC3' 5'TTCACCCCCTTGGATGACATT3'
hβ-actin	5'CATGTACGTTGCTATCCAGGC3' 5'CTCCTTAATGTCACGCACGAT3'
hα-SMA	5’AAAAGACAGCTACGTGGGTGA3’ 5’GCCATGTTCTATCGGGTACTTC3’
hCOL1A1	5’GAGGGCCAAGACGAAGACATC3’ 5’ CAGATCACGTCATCGCACAAC3’
hCOL3A1	5’GGAGCTGGCTACTTCTCGC3’ 5’GGGAACATCCTCCTTCAACAG3’
hFN1	5’CGGTGGCTGTCAGTCAAAG3’ 5’AAACCTCGGCTTCCTCCATAA3’
hMCT1	5'GGCCAAGTGTGAGTTCTTCAA3' 5'GGCTCGATAATCGTGTCCCC3'
hBDH1	5'GGCAGAAGTGAACCTTTGGG3' 5'GCAGTCCGAGAAAGCCTCTAC3'
hOXCT1	5'GTTGGTGGTTTTGGGCTATGT3' 5'AGACCATGCGTTTTATCTGCTT3'
hACAT1	5'ATGCCAGTACACTGAATGATGG3' 5'GATGCAGCATATACAGGAGCAA3'

Western blot analysis

Cells were implanted into six-well plates and cultured until attachment. TGF-β1, Hcy, and THF were added correspondingly and incubated. The protein concentration was determined using the Pierce BCA protein assay kit (Thermo Fisher Scientific). The collected proteins were separated through SDS-PAGE and were electrotransferred to polyvinylidene fluoride (PVDF) membranes. After blocking, the membranes were reacted with the corresponding primary antibodies against BDH1(1:5000, 15417-1-AP, Proteintech), OXCT1(1:6000, 12175-1-AP, Proteintech), COL1A1 (1:1000, TA7001, Abmart), COL3A1 (1:1000, T510299, Abmart), α-SMA (1:1000, T55295, Abmart, Shanghai, China), Fibronectin (1:1000, T59537, Abmart), Smad2/3 (1:4000, PA5-17621, Thermo Fisher Scientific), p-Smad2/3 (1:1000, PA5-110155, Thermo Fisher Scientific), GAPDH(1:1000, TT0004, Abmart) overnight at 4°C. Finally, they were incubated with HRP-linked rabbit IgG antibody (1:3000,7074S/ 7076S, Cell Signaling Technology) for 1 hour. Signals were developed with SuperSignal West Dura substrate (Thermo Fisher Scientific) and imaged with a Gel Doc XR + device (Bio-Rad Laboratories, Inc.). Quantification analysis was performed with the Volume tool in ImageLab 6.0.1 (Bio-Rad), adjusted to GAPDH expression, and normalized to respective Ctrl samples to calculate fold change to Ctrl.

Quantitative and statistical analysis

Data were expressed as the mean ± standard deviation (SD). To determine the statistical significance of observed differences, we utilized one-way or two-way analysis of variance (ANOVA), followed by Tukey's post hoc test for multiple comparisons when appropriate. For direct comparisons between two groups, we employed unpaired two-tailed Student's t-tests. The levels of statistical significance were set at *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. All calculations were performed using Prism version 9.0 (GraphPad Software, Inc.) on a Windows 11 operating system.

3.1 Ketone metabolism remodeling is associated with skin fibrosis

To elucidate the connection between altered metabolic pathways and skin fibrosis, we conducted an analysis of skin tissues from both healthy individuals and keloid patients using the GSE145725 dataset. The result yields 568 differentially expressed genes (DEGs), comprising 261 up-regulated and 307 down-regulated genes, respectively. Variance analysis of those differentially expressed genes was presented in the volcano plot as shown in Fig. 1A. By gene ontology (GO) enrichment analysis, it was found that genes related to fibrogenesis, including cell-substrate junction, focal adhesion, collagen-containing extracellular matrix, and positive regulation of SMAD protein signal transduction, were upregulated in keloids (Fig. 1B). More importantly, the analysis identified increase in enrichment of ketone body metabolism including response to ketones and cellular ketone metabolic processes in fibrotic keloid. The increase in response to ketones was further enriched by gene set enrichment analysis (GSEA), along with significant enrichment in fibrogenesis including collagen-containing extracellular matrix, cytokine production related to the inflammatory response and SMAD binding in keloids (Fig. 1C-1F). This suggests a notable correlation between ketone metabolism and skin fibrosis. We thus analyzed RNAseq datasets of skin tissue from keloid patients (GSE145725) and bleomycin (BLM)- induced mice (GSE226331) (Fig. 1H-1I), respectively. RNA-seq analysis unveiled decreased expression of genes involved in ketone catabolism, including 3- Hydroxybutyrate Dehydrogenase 1 (Bdh1), 3-Oxoacid CoA Transferase 1 (Oxct1), Hydroxybutyrate Dehydrogenase 2 (Bdh2), Acetyl-CoA Acetyltransferase 1 (Acat1), and Acetyl-CoA Acetyltransferase 2 (Acat2), in the fibrotic skin of both human and mice. Moreover, the association between ketone metabolism-related proteins, such as BDH1 and OXCT1, and fibrosis-related proteins was documented by the Protein- Protein Interaction (PPI) network analysis (Fig. 1J). Collectively, these findings underscore a remodeling in ketone metabolism in pathological skin fibrogenesis.

3.2 Ketone catabolism was impaired in fibrotic skin

Based on the analysis of skin fibrosis database, we next investigated the expression of key regulators involved in ketone catabolism in the pathogenesis of skin fibrosis. In human hypertrophic scar which is characterized by increased fibrotic matrix deposition and epidermis thickness (Fig. 2A), expression of BDH1, OXCT1, and ACAT1 was significantly decreased compared with those in normal skin by qRT-PCR. While expression of MCT1 showed no significance (Fig. 2B). Accordingly, numbers of BDH1 (p < 0.05) and OXCT1 (p < 0.01) -positive cells was markedly reduced in human hyperplastic scar as showed by immunofluorescent staining (Fig. 2C-E). In bleomycin induced fibrotic mouse skin, downregulation of genes related to ketone body catabolism was also indicated by qRT-PCR assessment (Fig. 2F-J). In addition, a significant decrease in the number of OXCT1 (Fig. 2H, p < 0.01) and BDH1-positive (Fig. 2I, p < 0.01)) cells as well as in expression of OXCT1 and BDH1 was detected in the bleomycin treated skin.

We next treated human dermal fibroblasts with TGF-β1 to examine changes in expression of key catalysts regulating ketone metabolism. We found that that the levels of expression of OXCT1 and BDH1 were markedly decreased in TGF-β1- treated fibroblasts, as determined by western-blot and qRT-PCR, respectively (Fig. 2K-M). Meanwhile, immunofluorescent staining showed that treatment with TGF-β1 resulted in significant reduction in OXCT1 (p < 0.01) and BDH1 (p < 0.01) - positive cells (Fig. 2N-P). Together, these findings suggested that ketone catabolism was impaired in pathogenesis of skin fibrosis.

3.3 Knockdown of OXCT1 induced the onset and exacerbation of skin fibrosis

Given that ketone catabolism was impaired in the pathogenesis of skin fibrosis, we addressed whether dysfunction of ketone body metabolism induced by knockdown of OXCT1 would exacerbate skin fibrosis. Expression of OXCT1 was significantly decreased by transfection of adenovirus mediated siRNA against OXCT1 in human dermal fibroblasts (p < 0.01). Treatment with TGF-β1 induced no more enhancement in OXCT1 expression in Ad-shOXCT1 transfected cells (Fig. 3A). In TGF-β1-treated fibroblasts, Ad-shOXCT1 transfection induced significant increase in expressions of COL I, COL III, fibronectin, and α-SMA, at both mRNA and protein levels, in comparison to that treated with TGF-β1 alone, as revealed by qRT-PCR (Fig. 3C) and Western blot analyses, respectively (Fig. 3D). The enhancement of COLI expression resulted from Ad-shOXCT1 transfection was further manifested by immunofluorescence analysis (Fig. 3E-G). It is noteworthy that transfection of Ad-shOXCT1 alone induced remarkable increase in fibrogenesis of dermal fibroblasts. Meanwhile, we found that expression of proinflammatory cytokines IL-6 and IL-1 was significantly elevated in Ad-shOXCT1-treated fibroblasts, in the presence or absence of TGF-β1, compared to those in Ad-shControl -treated control fibroblasts.

We next investigated whether OXCT1 knockdown would enhance skin fibrogenesis in vivo by subcutaneously injecting Ad-shOXCT1 (1×10⁹ PFU in a total volume of 10 µl) in mice that treated with BLM(5mg/kg) once a week for 8 weeks. Administration of Ad-shOXCT1 markedly exacerbated skin fibrosis as characterized by thickening of dermis, atrophy of adipose layer, deposition of disorganized collagen bundles and an increased COLIII/I ratio in BLM treated mice. In accordance with in vitro observations, we found introduction of Ad-shOXCT1 alone induced a spontaneous skin fibrosis (Fig. 3H-L). The enhancement in skin fibrogenesis was further revealed by increased expression of COL1A1, COL3A1, ACTA1 and FN1(Fig. 3M), alone with proinflammatory cytokine such as IL6, IL1-β, TNF-α (Fig. 3N) in BLM-treated skin. More importantly, with reduction in number of OXCT1-positive cells in ad-shOXCT1 administrated skin, COL-I relative fluorescent intensity was significantly increased as determined by immunofluorescence analysis (Fig. 3O-Q).

Taken together, these results demonstrated that dysfunction of ketone body metabolism induced by OXCT1 suppression induced a spontaneous onset of skin fibrogenesis and exacerbated BLM-induced fibrotic skin in mice.

3.4 AcAc administration ameliorated skin fibrosis

We next investigated whether remodeling ketone metabolism would rescue pathology of skin fibrosis by administration of AcAc in TGF-β1 treated human dermal fibroblasts. We found that, with addition of AcAc, expression levels of fibrogenesis-associated markers including COLI, COLIII, fibronectin and α- SMA was markedly reduced in TGF-β1 treated fibroblasts, which was determined by qRT-PCR (Fig. 4A) and western-blot analysis (Fig. 4B), respectively. Meanwhile, expression of proinflammatory cytokines induced by TGF-β1, including IL6, IL1-β and TNF-α, was significantly reduced by exogenous AcAc administration (Fig. 4C). Double fluorescent staining of COLI and α-SMA exhibited that AcAc administration significantly decreased expression of COLI (p < 0.05) and α-SMA (p < 0.05) in TGF-β1 treated fibroblasts(Fig. 4D, 4F).

To address whether topical administration of AcAc would ameliorate skin fibrosis in vivo, we performed subcutaneous injection of AcAc (3mg/ kg) together with bleomycin (5mg/kg) in mice once daily for 4 weeks. At 4 weeks post-injection, skin received AcAc injection exhibited remarkable improvement in fibrogenesis induced by bleomycin injection. Histological observation showed that AcAc efficiently improved skin fibrosis (Fig. 4G), which was further quantitively determined by reduction in thickening of dermis (Fig. 4H), atrophy of hypodermal fat (Fig. 4I) and increase in collagenous matrix (Fig. 4J) and collagen type III/I ration (Fig. 4K). Moreover, with administration of AcAc, the elevated mRNA levels of fibrotic and inflammatory associated markers induced by bleomycin was significantly decreased (Fig. 4L, 4M). Meanwhile, accumulation of COLI was significantly decreased by AcAc as detected by immunofluorescent staining (Fig. 4N, 4O). Collectively, these results suggest that remodeling of ketone metabolism by AcAc supplementation prevented the development of BLM-induced skin fibrosis.

3.5 Impairment in ketone metabolism enhanced TGF-β1/Smad2/3 pathway.

As Smad pathway plays a critical role in mediating pro-fibrotic effect of TGF-β1, we investigated the role of AcAc in regulating Smad2/3 signaling in fibroblasts. We found that, with knockdown of OXCT1 by Ad-shOXCT1 transfection, phosphorylation levels of Smad2/3 induced by TGF-β1 was markedly increased in human dermal fibroblasts as determined by western blot (Fig. 5A, B). In accordance with this, immunofluorescent staining showed that fluorescent intensity of activated Smad2/3 in Ad-shOXCT1 transfected cells was significantly higher than that in cells treated with TGF-β1 alone (Fig. 5C, D). These results indicated that impairment in ketone body metabolism largely affected activation of TGF-β1/ Smad2/3 pathway, we thus examined whether knockdown of OXCT1 would lead to an enhancement of TGF-β1/ Smad2/3 activation in bleomycin treated skin, where increased activation of TGF-β1/ Smad2/3 has been observed. By subcutaneously injecting Ad-shOXCT1 in bleomycin-treated skin, we were able to find that phosphorylation of Smad2/3 was significantly increased (Fig. 5E, F).

Given that AcAc treatment ameliorates skin fibrosis, and that dysregulation of ketone metabolism resulted in an increase in TGF-β1/Smad2/3 activation, we explored whether the therapeutic effect of AcAc on skin fibrosis is mediated by inhibiting TGF-β1/Smad2/3 pathway in human fibroblasts. As showed in western-blot analysis, TGF-β1 induced remarkable upregulation of Smad2/3 phosphorylation in human dermal fibroblasts. With addition of AcAc, phosphorylation of Smad2/3 was significantly suppressed (Fig. 5G, H, p < 0.05). By immunostaining analysis, the suppression of nuclear translocation of pSmad2/3 by AcAc in TGF-β1-stimulated fibroblasts was observed (Fig. 5I, J). In vivo, subcutaneous administration of AcAc over four weeks resulted in significant down-regulation of p-Smad2/3 in BLM-induce fibrotic skin (Fig. 5K, L, p < 0.05). Thus, these results suggest that the effect of AcAc in rescuing skin fibrosis is, at least in part, mediated through suppressing the TGF-β1/ Smad2/3 signaling.

Skin fibrosis, characterized by excessive proliferation of skin fibroblasts and deposition of extracellular matrix, is the histopathologic hallmark of many dermatologic disease such as scleroderma, hypertrophic scars (HS) and keloids[17, 18]. Despite numerous studies on the pathological mechanism of skin fibrosis, there is a scarcity of interventions and treatments that have progressed to clinical trials[19]. In the present study, our findings revealed a reduction in the expression of BDH1 and OXCT1 in settings of skin fibrosis including hypertrophic scar and BLM-induced mouse skin. We found that remodeling ketone body metabolism by AcAc supplementation remarkably ameliorated skin fibrosis in mouse skin treated with bleomycin (Fig. 6).

Fibrogenesis has been defined as a metabolic disease which involves a complex network of metabolic pathways that orchestrates fundamental cellular behaviors[20–22]. For example, diabetic cardiomyopathy largely relies on ketone bodies as an alternative energy source[23]. Reduction in activity of BDH1 and OXCT1 leads to exacerbation of myocardial fibrosis resulted from oxidative damage. In skin fibrosis, metabolic dysregulations have been associated with abnormal cell proliferation, differentiation and excessive ECM deposition. Zhao et al. observed the the reciprocal role of downregulation in fatty acid oxidation (FAO) and upregulation in glycolysis in the progression of skin fibrogenesis, respectively, underscoring the multifaceted outcomes of metabolic remodeling in regulating ECM homeostasis in skin[24]. Keloids represents a typical model for skin fibrosis, which is characterized by progressive accumulation of dense collagenous matrix that is usually beyond original wound[18]. By analyzing public RNA sequencing data of keloid, we were able to identify a significant fold change in expression of OXCT1 and BDH1 in keloid, which was consistently manifested in the whole transcriptome data for BLM-treated skin in mice. The impairment of ketone body metabolism, as characterized by decreased expression of OXCT1 and BDH1, was also detected in human hypertrophic scar and BLM-induced fibrotic skin. Thus, the dysfunction of ketone body metabolism highlights their potential role in regulating skin fibrosis.

In the context of starvation or carbohydrate restriction, ketone bodies, mainly β-OHB and AcAc, serve as alternative fuels for the mitochondria in extrahepatic cells, producing two molecules of AcCoA and one molecule of succinate, both of which subsequently enter the TCA cycle[10]. The effects of ketogenic supplement therapy on fibrogenesis seem to vary across different organs. For instance, by enhancing ketolysis in vivo with either βOHB supplementation or KD feeding, fibrosis in the kidneys was markedly reversed in C57 BKS db/db mice[25]. While a high-fat ketogenic diet can lead to cholesterol accumulation in the liver and thus exacerbates liver fibrosis induced by CCl4 in mice[26]. This discrepancy has been ascribed to different impact of β-OHB and AcAc on the development, progression of fibrogenesis, respectively. Given that under the circumstance of pathological disease, expression of BDH1, which is responsible for the conversion of β-OHB into AcAc, has been widely reported to be inhibited[27]. Thus, AcAc was administrated to replenish ketone body metabolism in this study in an attempt to impede the progression of skin fibrosis. Our results showed that inhibition of ketone body metabolism by Ad-shOXCT1 transfection significantly up-regulated fibrosis-associated markers in dermal fibroblasts. Consistently, knockdown of OXCT1 by adenoviral injection in vivo can induce simultaneously skin fibrogenesis and aggravated fibrosis in skin treated with bleomycin. More importantly, we observed a down-regulated response of fibroblasts to TGF-β1 in fibrotic markers expression by exogenous supplementation of AcAc. The in vivo study further manifested the therapeutic effect of AcAc on skin fibrosis, as evidenced by improvement in dermal thickening and subcutaneous fat layer atrophy in BLM-treated skin. In addition, collagenous matrix deposition was significantly ameliorated with administration of AcAc. These findings propose a novel therapeutic approach for addressing skin fibrosis by subcutaneously administering AcAc to reprogramming impaired ketone body catabolism.

The canonical TGF-β1-smad signaling pathway, which involves the activation of Smad2 and Smad3 through phosphorylation of TGF-β1 receptor 1 (ALK5), plays a central role in boosting the excessive fibrogenesis of skin, leading to aberrant collagen synthesis and deposition, a higher proportion of collagen I/III, and formation of abnormally cross-linked collagen fiber bundles[28, 29]. The interaction between ketone body reprogramming and activation of TGF-β1/Smad2/3 pathway has been well documented in different organs. In liver of diabetic mice, it was observed that expression level of TGF-β1 was significantly decreased in response to ketone body diet, indicating that KD-induced TGF-β1/Smad signaling suppression contributed to improvement in hepatic fibrosis[30]. Intriguingly, it was shown that supplementation of β-OHB alone unexpectedly resulted in activation of TGF-β1/Smad pathway in HK-2 cells[25]. Thus, we turned to investigate the impact of AcAc on TGF-β1/Smad pathway during progression of skin fibrogenesis. We found that knockdown of OXCT1 by adenovirus increased the expression of p-Smad2/3 in fibroblasts. We found that AcAc treatment significantly down-regulated the phosphorylation of Smad2/3 in TGF-β1 treated fibroblasts, as well as in fibrotic skin of mice. Together, these results suggested that the amelioration of skin fibrosis by AcAc was mediated, at least in part, via suppression of TGF-β1/Smad pathway. However, the mechanism by which ketone bodies regulate the TGF-β1/Smad pathway remains to be explores in our future works.

In conclusion, our study provides experimental evidence supporting the dysfunction of ketone body metabolism is associated with onset and exacerbation of skin fibrosis. Notably, subcutaneous administration of AcAc resulted in remarkable improvement in impeding the progression of skin fibrogenesis. Mechanistic study showed that the effect of AcAc on ameliorating skin fibrogenesis is, at least in part, mediated by suppressing TGF-β1-Smad2/3 signaling pathway. Our findings thus indicated that administration of AcAc could serve as a potential therapeutic avenue to disrupt the pathology in skin fibrogenesis.

AcAc, acetoacetate

ACAT1, Acetyl-CoA Acetyltransferase 1

ACAT2, Acetyl-CoA Acetyltransferase 2

α-SMA, α-Smooth muscle actin

BLM, Bleomycin

BDH1, 3-Hydroxybutyrate Dehydrogenase 1

BDH2, 3-Hydroxybutyrate Dehydrogenase 2

β-OHB, β-Hydroxybutyrate

COL1A1, Collagen type 1 α1

COL3A1, Collagen type 3 α1

ECM, Extracellular matrix

EMT, Epithelial mesenchymal transition

FN1, Fibronectin

GAPDH, Glyceraldehyde 3-phosphate dehydrogenase

HS, Hypertrophic scar

KD ketogenic diet

OXCT1, 3-Oxoacid CoA-Transferase 1

OXCT2, 3-Oxoacid CoA-Transferase 2

PBS, Phosphate buffered saline

p-SMAD2/3, Phosphorylated Smad2/3

qPCR, quantitative polymerase chain reaction

α-SMA, α-Smooth muscle actin

SSc, Systemic sclerosis

Smad2/3, drosophila mothers against decapentaplegic protein 2/3

TGF-β1, Transforming growth factor-β1

Availability of data and materials

All data generated in this study are available on reasonable request from the corresponding author.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Author information

Author notes

Zixi Tian, Kai Huang and Wanting Yang contributed equally to this work.

Authors and Affiliations

Department of Reconstructive and Regenerative Surgery, Shanghai Tongji Hospital, Tongji University School of Medicine, Shanghai, China.

Ting Shang & Shuaijun Li

Department of Stem Cells and Regenerative Medicine, Tongji University School of Medicine, Shanghai, China.

Ting Shang, Linxiao Li, Xiaohui Miao, Yu Jiang, Wuyan Lu, Zixin Cai^2,Shuaijun Li & Jiefeng Huang

Department of Orthopedics ,Shanghai Tenth People’s Hospital ,Tongji University School of Medicine, Shanghai, China.

Linxiao Li, Yu Jiang & Hui Kang

Department of Plastic Surgery, Shanghai Tenth People's Hospital, Tongji University School of Medicine, Shanghai 200092, China.

Wuyan Lu, Zixin Cai & Jiefeng Huang

Mudanjiang Medical University, Mudanjiang 157011, China.

Jieshen Huang

School & Hospital of Stomatology, Tongji University, Shanghai Engineering Research Center of Tooth Restoration and Regeneration, Shanghai 200072, China.

Yishu Lu

Contributions

Ting Shang: Investigation, Supervision, Project administration, Writing-Original draft preparation; Linxiao Li: Investigation, Methodology, Visualization, Writing-Original draft preparation; Xiaohui Miao: Data curation, Conceptualization, Writing-Original draft; Jieshen Huang: Investigation, Methodology, Writing-Original draft preparation; Yu Jiang: Validation, Data curation; Wuyan Lu: Software; Zixin Cai: Software; Yishu Lu: Formal analysis; Hui Kang: Writing-Reviewing and Editing, Funding acquisition; Shuaijun Li: Resources, Project administration, Funding acquisition; Jiefeng Huang: Supervision, Writing-Reviewing and Editing, Approved the final version.

Corresponding authors

Correspondence to Jiefeng Huang, Shuaijun Li or Hui Kang.

Ethics declarations

Ethics approval

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board (or Ethics Committee) of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine (protocol code SH9H-2021-A32-1).

Consent for publication

We declare that all work described here has not been published before and that its publication has been approved by all co-authors.

Competing interests

The authors declare no competing interests.

Disclosure statement

We report no conflict of interest.

Henderson, N.C., F. Rieder, and T.A. Wynn, Fibrosis: from mechanisms to medicines. Nature, 2020. 587(7835): p. 555–566.
Lee, H.J. and Y.J. Jang, Recent Understandings of Biology, Prophylaxis and Treatment Strategies for Hypertrophic Scars and Keloids. Int J Mol Sci, 2018. 19(3).
El Ayadi, A., J.W. Jay, and A. Prasai, Current Approaches Targeting the Wound Healing Phases to Attenuate Fibrosis and Scarring. Int J Mol Sci, 2020. 21(3).
Distler, O. and A. Cozzio, Systemic sclerosis and localized scleroderma–current concepts and novel targets for therapy. Semin Immunopathol, 2016. 38(1): p. 87–95.
Huang, J., et al., Dermal extracellular matrix molecules in skin development, homeostasis, wound regeneration and diseases. Semin Cell Dev Biol, 2022. 128: p. 137–144.
Varkey, M., J. Ding, and E.E. Tredget, Differential collagen-glycosaminoglycan matrix remodeling by superficial and deep dermal fibroblasts: potential therapeutic targets for hypertrophic scar. Biomaterials, 2011. 32(30): p. 7581–91.
Hao, Y., D. Baker, and P. Ten Dijke, TGF-β-Mediated Epithelial-Mesenchymal Transition and Cancer Metastasis. Int J Mol Sci, 2019. 20(11).
Hu, H.H., et al., New insights into TGF-β/Smad signaling in tissue fibrosis. Chem Biol Interact, 2018. 292: p. 76–83.
Zhang, T., et al., Current potential therapeutic strategies targeting the TGF-β/Smad signaling pathway to attenuate keloid and hypertrophic scar formation. Biomed Pharmacother, 2020. 129: p. 110287.
Puchalska, P. and P.A. Crawford, Multi-dimensional Roles of Ketone Bodies in Fuel Metabolism, Signaling, and Therapeutics. Cell Metab, 2017. 25(2): p. 262–284.
Laffel, L., Ketone bodies: a review of physiology, pathophysiology and application of monitoring to diabetes. Diabetes Metab Res Rev, 1999. 15(6): p. 412–26.
Puchalska, P. and P.A. Crawford, Metabolic and Signaling Roles of Ketone Bodies in Health and Disease. Annu Rev Nutr, 2021. 41: p. 49–77.
Xu, S., et al., Ketogenic diets inhibit mitochondrial biogenesis and induce cardiac fibrosis. Signal Transduct Target Ther, 2021. 6(1): p. 54.
Puchalska, P., et al., Hepatocyte-Macrophage Acetoacetate Shuttle Protects against Tissue Fibrosis. Cell Metab, 2019. 29(2): p. 383–398.e7.
Sacchetti, C., et al., PTP4A1 promotes TGFβ signaling and fibrosis in systemic sclerosis. Nat Commun, 2017. 8(1): p. 1060.
Vorstandlechner, V., et al., The serine proteases dipeptidyl-peptidase 4 and urokinase are key molecules in human and mouse scar formation. Nat Commun, 2021. 12(1): p. 6242.
Talbott, H.E., et al., Wound healing, fibroblast heterogeneity, and fibrosis. Cell Stem Cell, 2022. 29(8): p. 1161–1180.
Andrews, J.P., et al., Keloids: The paradigm of skin fibrosis - Pathomechanisms and treatment. Matrix Biol, 2016. 51: p. 37–46.
Abraham, D., A. Lescoat, and R. Stratton, Emerging diagnostic and therapeutic challenges for skin fibrosis in systemic sclerosis. Mol Aspects Med, 2024. 96: p. 101252.
Rajesh, R., R. Atallah, and T. Bärnthaler, Dysregulation of metabolic pathways in pulmonary fibrosis. Pharmacol Ther, 2023. 246: p. 108436.
Eming, S.A., P.J. Murray, and E.J. Pearce, Metabolic orchestration of the wound healing response. Cell Metab, 2021. 33(9): p. 1726–1743.
Eming, S.A., T.A. Wynn, and P. Martin, Inflammation and metabolism in tissue repair and regeneration. Science, 2017. 356(6342): p. 1026–1030.
Cai, W., et al., Empagliflozin improves mitochondrial dysfunction in diabetic cardiomyopathy by modulating ketone body metabolism and oxidative stress. Redox Biol, 2024. 69: p. 103010.
Zhao, X., et al., Metabolic regulation of dermal fibroblasts contributes to skin extracellular matrix homeostasis and fibrosis. Nat Metab, 2019. 1(1): p. 147–157.
Wan, S.R., et al., BDH1-mediated βOHB metabolism ameliorates diabetic kidney disease by activation of NRF2-mediated antioxidative pathway. Aging (Albany NY), 2023. 15(22): p. 13384–13410.
Liao, Y.J., et al., Ketogenic Diet Enhances the Cholesterol Accumulation in Liver and Augments the Severity of CCl(4) and TAA-Induced Liver Fibrosis in Mice. Int J Mol Sci, 2021. 22(6).
Xu, B.T., et al., Bdh1 overexpression ameliorates hepatic injury by activation of Nrf2 in a MAFLD mouse model. Cell Death Discov, 2022. 8(1): p. 49.
Meng, X.M., D.J. Nikolic-Paterson, and H.Y. Lan, TGF-β: the master regulator of fibrosis. Nat Rev Nephrol, 2016. 12(6): p. 325–38.
Lin, X. and Y. Lai, Scarring Skin: Mechanisms and Therapies. Int J Mol Sci, 2024. 25(3).
Zhang, Q., et al., High-Intensity Interval Training Attenuates Ketogenic Diet-Induced Liver Fibrosis in Type 2 Diabetic Mice by Ameliorating TGF-β1/Smad Signaling. Diabetes Metab Syndr Obes, 2020. 13: p. 4209–4219.

No competing interests reported.

Download PDF

Editor assigned by journal
21 Oct, 2024
Submission checks completed at journal
21 Oct, 2024
First submitted to journal
17 Oct, 2024

You are reading this latest preprint version

Acetoacetate Ameliorates Skin Fibrosis by Modulating TGF-β1/Smad2/3 Signaling Pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Bioinformatic analysis

Collection of hypertrophic scar and normal skin

Creation of skin fibrosis in mice

Histological and immunofluorescent staining

Cultivation of dermal fibroblasts

Knock-down of OXCT1 in vitro and in vivo

Quantitative real-time PCR

Western blot analysis

Quantitative and statistical analysis

Results

3.1 Ketone metabolism remodeling is associated with skin fibrosis

3.2 Ketone catabolism was impaired in fibrotic skin

3.3 Knockdown of OXCT1 induced the onset and exacerbation of skin fibrosis

3.4 AcAc administration ameliorated skin fibrosis

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1