Trichomonas vaginalis adhesion protein 33 (TvAP33) promotes HPV infection by upregulating the expression of HPV membrane receptor molecules

doi:10.21203/rs.3.rs-5285571/v1

Download PDF

Research Article

Trichomonas vaginalis adhesion protein 33 (TvAP33) promotes HPV infection by upregulating the expression of HPV membrane receptor molecules

https://doi.org/10.21203/rs.3.rs-5285571/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: An increasing number of studies have identified Trichomonas vaginalis (T. vaginalis) as a risk factor for human papillomavirus (HPV) infection, yet experimental data and the mechanisms involved are still lacking.

Methods: Wild-type and T. vaginalis adhesion protein 33 (TvAP33) knockdown T. vaginaliswere used to infect HaCaT cells and the vaginal tissue of mice, while HaCaT cells were also transfected to overexpress TvAP33. The effects of TvAP33 on the expression of HPV membrane receptor molecules and HPV infection were assessed. Infection of HaCaT cells with low expression of HPV membrane receptor molecules by T. vaginalis with reduced TvAP33 expression was conducted to analyze whether TvAP33 influences HPV infection through HPV membrane receptor molecules.

Results: In this study, we found that T. vaginalissignificantly enhances HPV invasion into HaCaT cells and the mouse vagina, and increases the expression of HPV membrane receptor molecules CD151 and HSPG2. Reducing the expression of TvAP33 led to a significant decrease in both HPV invasion rate and CD151/HSPG2 expression. Conversely, overexpressing TvAP33 in HaCaT cells resulted in a notable increase in HPV invasion and CD151/HSPG2 expression. Furthermore, simultaneous reduction of the expression of TvAP33 in trophozoites and CD151/HSPG2 in HaCaT cells further decreased HPV invasion rates. These findings suggest that TvAP33 promotes HPV infection by upregulating CD151 and HSPG2 expression.

Conclusions: This study not only confirms that T. vaginalis can facilitate HPV infection through both in vivo and in vitro experiments but also explores the mechanism by which TvAP33 enhances HPV infection by upregulating HPV receptor expression. These results provide a theoretical basis for understanding the mechanisms of T. vaginalis co-infection with HPV.

T. vaginalis

Adhesion protein 33

Human papillomavirus

Membrane receptor molecules

• Trichomonas vaginalis significantly enhances HPV invasion in both HaCaT cells and mouse vaginal tissues.

• Upregulation of HPV receptor molecules CD151 and HSPG2 is observed following T. vaginalis infection.

• TvAP33, an adhesion protein of T. vaginalis, is crucial in promoting HPV invasion by increasing CD151 and HSPG2 expression.

• Reducing TvAP33 expression leads to a decrease in HPV invasion and receptor expression, while overexpression of TvAP33 has the opposite effect.

Trichomonas vaginalis is a globally distributed sexually transmitted parasite, and trichomoniasis is a common non-viral sexually transmitted disease (Sexually transmitted disease, STD) [1]. According to World Health Organization (WHO) statistics, there are 276 million new cases of trichomoniasis each year [2]. The prevalence of T. vaginalis varies by region, with the highest prevalence found in women in Africa (11.7%) [3, 4], where there are about 30 million infections annually in sub-Saharan Africa [5], followed by the Americas (7.7%), the Western Pacific (5.6%), the Eastern Mediterranean (4.7%), Southeast Asia (2.5%), and finally Europe (1.6%) [4, 6]. T. vaginalis infection can lead to various health issues, including male infertility, prostatitis, and prostate cancer, as well as female vaginitis, cervicitis, pelvic inflammatory disease, infertility, and pregnancy complications. It also increases the risk of invasive cervical cancer, mycoplasma and human immunodeficiency virus (HIV) infections, prolonged cycles of human papillomavirus (HPV) infection, and a higher risk of high-risk human papillomavirus (HR-HPV) infections [7–9].

HPV is a non-enveloped DNA tumor virus that infects skin and mucosa [10]. HPV is widespread and poses significant health risks. The development of cervical cancer is closely associated with HPV, particularly persistent infection with high-risk HPV (HR-HPV), which is a major risk factor for cervical cancer [10, 11]. HPV infection of the cervix could lead to intraepithelial neoplasia (CIN) and invasive cervical cancer, with HPV present in approximately 95% of invasive cervical cancer cases [12]. Persistent infection with HR-HPV causes more than for over 70% of cervical cancer cases [13]. T. vaginalis tends to increase the infection risk and infection cycle of HR-HPV [9]. Studies have shown that individuals with T. vaginalis positive were 6.5 times more likely to be infected with HPV16 compared to individuals with T. vaginalis negative [14]. Epidemiological data also show high HPV infection rates among T. vaginalis-positive patients. The rate of HPV infection in T. vaginalis positive patients was 73.8% (79/107) in Brazil [15], 22.8% (13/57) in Belgium [16], 34.4% (11/32) in South Africa [19], 22.9% (8/35) in India [20] and 34.6% (28/81) [23] in Shanxi Province, China. Although epidemiological studies and meta-analyses have provided substantial evidence for a link between T. vaginalis and HPV infection, the specific mechanisms remain unclear. Therefore, investigating the pathogenic mechanisms by which T. vaginalis contributes to HPV infection is of great importance.

HPV infection of host cells is mediated by cell membrane receptors that facilitate the transmission of viral genetic material to the nucleus [24]. The membrane receptor molecules primarily associated with HPV infection include HSPG2, ITGA6, ITGB1, and CD151 [25–28]. The specific receptors and entry pathways for HPV may vary depending on the virus type [29]. In the well-established model of HPV16 binding to host cells, the major capsid protein L1 of HPV16 first binds to heparan sulfate proteoglycans (HSPGs) on the host cell surface [30], inducing conformational changes in the virus particles and subsequently exposing the minor capsid protein L2. The L2 protein then binds to ITGA6 on the host cell surface, activating the Ras-MAP kinase pathway. Ras releases anti-apoptotic signals through PI3, promoting cell division and creating an environment more conducive to HPV infection [31]. The L2 protein carries the viral genome into the nucleus with the assistance of actin, ultimately completing the entry of the HPV virus into the host cell [31–33].

T. vaginalis is an extracellular parasite. Upon adhesion to the target site, it can directly damage the epithelial cells through a combination of mechanisms, including the passage and encirclement by pleomorphic pseudopodia, flagellar movement, the release of digestive hydrolases, and phagocytosis. These actions lead to tissue and organ inflammation [35, 36]. Therefore, adhesion to host cell surfaces is a critical step in the parasitism and pathogenicity of T. vaginalis [8]. The TvAP33 protein contains two host cell-specific binding regions, located at the N-terminal and C-terminal of the protein sequence. The protein also has seven hydrophilic regions and nine highly antigenic, continuous regions, primarily located on the surface of T. vaginalis trophozoites, playing a key role in the adhesion of T. vaginalis to host cells [8, 37]. TvAP33 is a crucial adhesion molecule in T. vaginalis, facilitating the parasite's attachment to host cells via interaction with the BNIP3 receptor, and TvAP33 played an important role in adhesion to host cells, inhibition of host cell proliferation and induction of host cell apoptosis and death during the process of T. vaginalis infection [38]. This study attempts to explore the mechanism by which T. vaginalis and TvAP33 promote HPV infection by upregulating the expression of HPV receptor molecules.

Ethical Statement

All experiments involved in this study were approved by the Ethics Review Committee of Xinxiang Medical College (Reference No. XYLL-20210184). We made all efforts to alleviate the distress and pain of the experimental animals as much as possible, and the infected mice were euthanized at humane endpoints when the mice appeared moribund. Euthanasia was performed as follows: the experimental animal was placed in a confined space and exposed to 60-70% CO₂for 5 min. Occasionally, cervical dislocation was used to confirm the effectiveness of euthanasia.

Parasites, Cells, and Mice

In this study, the strain of T. vaginalis was kept in our laboratory and identified as actin genotype E by PCR restriction fragment length polymorphism, which was the dominant genotype in the city of Xinxiang, Henan Province, China. As previously studied, T. vaginalis was cultured in complete TYM medium and placed in a humidified chamber at 37°C and 5% CO₂.

HaCaT cells were supplied by Procell Inc.,(Wuhan, China) and cultured on complete Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 1% penicillin–streptomycin solution and 10% fetal calf serum in a humidified chamber at 37°C and 5% CO₂.

Six-week-old female immunodeficient BALB/cA-nu mice were purchased from Henan Skobes Biotechnology Co., Ltd. (Henan, China) and kept under specific pathogen-free conditions.

RNA interference

Based on the gene sequence of TvAP33, our research group designed and screened the optimal siRNA and non-interfering control siRNA (NC-siRNA) for reducing TvAP33 gene expression, which were synthesized by GENEWIZ® (Suzhou, China) [38]. The siRNA and NC-siRNA used to reduce the expression of CD151 and HSPG2 were purchased from SANTA CRUZ BIOTECHNOLOGY, INC. (USA) with item numbers sc-42829, sc-44010 and sc-37007, and contain 3 pairs of siRNA that interfere with CD151 and HSPG2, respectively (The siRNA sequences are listed in Table 1).

Dilute 1.2 μL of Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) with 50 μL of Opti-MEM I reduced-serum medium (Thermo Fisher Scientific), gently pipette to mix well, and let it stand at room temperature for 5 min. Simultaneously, dilute 5 μL of TvAP33/TvNC-siRNA at a concentration of 20 μM with 50 μL of Opti-MEM I reduced-serum medium, adjusting the final concentration to 200 nM. Mix the transfection reagent with the siRNA diluent and let it stand at room temperature for 20 min. Allow the mixture to settle, then dilute the insect solution with basic TYM culture medium (excluding serum and antibiotics) (TUOPU Biol-engineering Co., Ltd.). Set up a T.vaginalis group, T.vaginalis-Lipo2000 group, T.vaginalis-NC-siRNA group, and T.vaginalis-TvAP33-siRNA group, with 3 wells in each group. Add 400 μL of insect solution to each well in a 24-well plate (approximately 5 × 10⁵ cells/well). Finally, add the prepared mixture dropwise to each well (100 μL/well). Place the 24-well plate in a humidified chamber at 37°C and 5% CO2. After 12 h, add 500 μL of TYM complete culture medium and continue culturing. T. vaginalis from each group were collected after an additional 12 h, and TvAP33 gene expression was detected by qPCR (primer sequence is shown in Table 1) and western blot (see additional file 1: Fig. S1).

HaCaT cells were diluted in 2 mL of DMEM without antibiotics to a concentration of 1 × 10⁶/well, and evenly inoculated into 6-well plates. The experimental groups included a control group, a Lipo-2000 group, a NC-siRNA group, and a CD151/HSPG2-siRNA group, with each group replicated in three wells. Transfection was performed when the cell confluence reached 60%-70%. To prepare the transfection mixture, 5 µL of liposomes was diluted in 250 µL of Opti-MEM I reduced-serum medium, mixed gently, and incubated at room temperature for 5 min. Concurrently, 10 µL of CD151/HSPG2-siRNA at a concentration of 10 µM was diluted in 250 µL of Opti-MEM I reduced-serum medium to achieve a final concentration of 100 pmol. The diluted siRNA and liposomes were then combined and incubated at room temperature for 20 min. Finally, the resulting complexes were added to the cells (500 µL/well), and the 6-well plates were placed in a humidified chamber at 37°C and 5% CO₂. After 24 h, HaCaT cells from each group were collected, and gene expression was detected by qPCR (primer sequence is shown in Table 1) and western blot (see additional file 2: Fig. S2).

Real-time PCR (qPCR)

Primers for CD151, HSPG2, ITGA6, ITGB1 and GAPDH were found through literature review, synthesized and qPCR testing (Table 1). Using gradient diluted cDNA as template, qPCR method was used to detect the amplification efficiency and specificity of primers. The qPCR (RT-PCR) was run on a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, USA) with SYBR qPCR Master Mix (Vazyme, Nanjing, China). The reaction mixture (20 μL) contained 2 × ChamQ Universal SYBR qPCR Master Mix (10 μL), forward primer (10 μM, 0.4 μL), reverse primer (10 μM, 0.4 μL), cDNA (2 μL), and ddH₂O (7.2 μL). The amplification protocol was pre-denaturation at 95°C for 30 s, circular reaction at 95°C for 10 s and 60°C for 30 s (40 cycles), and melting curve at 95°C for 15 s, 60°C for 30 s and 95°C for 15 s. Relative expression levels were calculated by the 2^-^ΔΔCt method.

Western blot

Soluble protein from HaCaT cells was lysed and extracted using NP40 lysate (containing PMSF at a final concentration of 1 mmol/L), and the protein concentration was measured and quantified using BCA method. HaCaT cell proteins were separated by SDS-PAGE gel electrophoresis and transferred to PVDF membrane (Merck, USA). The PVDF membrane was blocked with 5% (w/v) skim milk/PBS-0.5% Tween 20 (TBST) for 1 h at room temperature. Dilute the HSPG2/CD151/ITGA6/ITGB1/β-Actin primary antibody with blocking solution at a ratio of 1:100, incubate with PVDF membrane for 2 h. and wash the membrane three times with 1×TBST. The PVDF membrane was then incubated in the diluted goat anti-rat IgG-horseradish peroxidase (HRP) (Sigma, Shanghai, China) for 1 h and then washed 3 times with 1X TBST. Finally, an enhanced chemiluminescence (ECL) kit (Vazyme, Nanjing, China) was used, preparing a developer solution and coating it on a PVDF membrane, and taking exposure and photos in an ultra-sensitive multi-function imager.

The eukaryotic expression vector pDsRed-N1-TvAP33 was transfected into HaCaT cells

HaCaT cells were diluted in 2 mL of Opti-MEM I reduced-serum medium at a rate of 1 × 10⁶ cells/well, and evenly seeded into 6-well cell culture plates, and divided into the following three groups: Control group, pDsRed-N1 group and pDsRed-N1-TvAP33 group, with 3 replicate wells in each group. After 12 h, 250 μL of Opti-MEM I reduced-serum medium was used to dilute 2500 ng pDsRed-N1-TvAP33 eukaryotic expression vector, mixed thoroughly, and incubated at room temperature in the dark for 5 min. Simultaneously, 250 μL of Opti-MEM I reduced-serum medium was used to dilute 10 μL of Lipofectamine 2000. The transfection reagent was then mixed with the plasmid dilution, and after thorough mixing, it was incubated at room temperature in the dark for 20 min. Finally, 500 μL of the mixture was added dropwise to each well of a 6-well plate and incubated at 37℃ in a CO₂ incubator for 24 h. HaCaT cells from each group were collected, and TvAP33 gene expression was detected by qPCR (primer sequence is shown in Table1) and western blot.

In Vitro HPV infection assay

T. vaginalis infection of HaCaT cells

HaCaT cells were seeded into 6-well plates at a density of 1 × 10⁶ cells/well, with three duplicate wells for each group. After 12 h, when the cell confluence reached 60%-70%, T. vaginalis (1 × 10⁶/well) was added at a 1:1 ratio (cells: T. vaginalis).

Detection of the influence of T. vaginalis on HPV infection rate in HaCaT cells

After HaCaT cells were inoculated into 6-well cell culture plates, Control group, HPV group, and T. vaginalis + HPV group were set up, and each group was set up with three duplicate wells. After 12 h, T. vaginalis + HPV group cells were infected with T. vaginalis. After 24 h, the cells were replaced with Opti-MEM I reduced-serum medium. The HPV group and T. vaginalis + HPV group cells were added with RFP-HPV18 pseudovirus to a final concentration of 5 × 10⁵TU/mL (protected from light). After 48 h of culture, 5 fields of view were selected from each well to be photographed under an inverted fluorescent microscope or the cells were digested and used to detect HPV infection rate with flow cytometry.

Detection of the effect of HPV infection in HaCaT cells after decreasing TvAP33 expression

After TvAP33-siRNA was transfected into T. vaginalis for 12 h, HaCaT cells were inoculated into a 6-well cell culture plate. Control group, T. vaginalis group, HPV group, T. vaginalis + HPV group, TvAP33-siRNA + T. vaginalis + HPV group, three multiple holes were set in each group. After transfection with T. vaginalis for24 h, the corresponding group of cells were infected with T. vaginalis. After 24 h, the cells in the corresponding group were infected with the RFP-HPV18 pseudovirus, and the HPV infection was finally detected by fluorescence microscope or flow cytometry.

Detection of the effect of HPV infection in HaCaT cells after increasing TvAP33 expression

After inoculating HaCaT cells in 6-well cell culture plates, the cells were divided into three groups: Control + HPV group, pDsRed-N1 + HPV group and pDsRed-N1-TvAP33 + HPV group, with three duplicate wells in each group. After the AP33 eukaryotic expression vector plasmid was transfected into the corresponding group of cells for 24 h, each group of cells was infected with RFP-HPV18 pseudovirus. Finally, HPV infection was detected by fluorescence microscope or flow cytometry.

TvAP33 in T. vaginalis promotes HPV infection by upregating CD151 and HSPG2 expression

On the first day, HaCaT cells were seeded in a 6-well plate overnight until they reached 60% confluence. The following groups were established: Control group, HPV group, T. vaginalis + HPV group, TvAP33-siRNA + T. vaginalis + HPV group, CD151-siRNA + T. vaginalis + HPV group, HSPG2-siRNA + T. vaginalis + HPV group, CD151-siRNA + TvAP33-siRNA + T. vaginalis + HPV group, and HSPG2-siRNA + TvAP33-siRNA + T. vaginalis + HPV group, with three replicates per group. On the second day, after 12 h of cell plating, CD151/HSPG2-siRNA was transfected into the corresponding group of cells, and TvAP33-siRNA was transfected into the corresponding group of T. vaginalis. On the third day, 24 h after siRNA transfection, the corresponding group of T. vaginalis was used to infect the corresponding cells. On the fourth day, after 24 h of T. vaginalis infection in HaCaT cells, the corresponding cells were infected with RFP-HPV18 pseudovirus. Finally, HPV infection was observed using fluorescence microscopy or assessed via flow cytometry.

Detection of HPV infection in vivo

Detection of the influence of T. vaginalis on vaginal HPV infection in mice

Six-week-old female immunodeficient BALB/cA-nu mice were randomly divided into Control group, HPV group and T. vaginalis + HPV group, with 3 mice in each group. On Day 1, each group of mice was injected subcutaneously with 500 μg estradiol valerate (dissolved in 100 μL sesame oil). From Day 6 to Day 9, each group of mice was injected intraperitoneally with dexamethasone every day, and the injection amount was calculated based on body weight (10 mg/kg, dissolved in 100 μL PBS). On Days 10 and 11, the vaginas of mice in each group were injured by sterile cell brushes, and mice in the T. vaginalis + HPV group were inoculated with 1 × 10⁶ T. vaginalis. On Day 12, each mouse in each group was injected subcutaneously with 100 μL of 30 mg/mL medroxyprogesterone (diluted in sterile PBS). On Day 16, RFP-HPV18 pseudovirus at a final concentration of 5 × 10⁵ TU/mL was mixed with 4% hydroxymethyl cellulose (CMC) at a ratio of 3:1. After mechanical injury to the vagina of mice in each group with sterile cell brushes, 12 μL of the diluted virus was injected into the vagina of mice in the HPV group and T. vaginalis + HPV group (protected from light). After mice were infected with the virus 24 h, the vaginal tissue of mice was taken and HPV infection was detected by an in vivo imager (protected from light).

Detection of the effect of HPV infection in vagina of mice after decreasing TvAP33 expression

Six-week-old female immunodeficient BALB/cA-nu mice were randomly divided into Control group, T. vaginalis group, HPV group, T. vaginalis + HPV group, TvAP33-siRNA + T. vaginalis + HPV group, three mice in each group. Mice were pretreated with estradiol valerate and dexamethasone in turn according to the above method. The day before infection with T. vaginalis, TvAP33-siRNA was transfected into T. vaginalis. Subsequently, mice were infected with T. vaginalis, pretreated with medroxyprogesterone, infected withRFP-HPV18 pseudovirus, and tested for HPV infection according to the above method.

Detection of HPV membrane receptor molecule expression level

Detection of the effect of T. vaginalis on the expression of HPV membrane receptor molecules

After HaCaT cells were inoculated into 6-well cell culture plates, Control group and T. vaginalis group were set up, and each group was set up with three complex wells. HaCaT cells from T. vaginalis group were infected with T. vaginalis. Total RNA and total protein of HaCaT cells were extracted 24 hours after infection with T. vaginalis. Expression of HPV membrane receptor molecules (CD151, HSPG2, ITGA6 or ITGB1) was detected by qPCR and western blot.

Detection of the effect of T. vaginalis on the expression of HPV membrane receptor molecules CD151 and HSPG2 after reducing TvAP33 expression

After transfecting T. vaginalis with TvAP33-siRNA for 12 h, HaCaT cells were seeded into a 6-well cell culture plate, establishing the following groups: Control group , T. vaginalis group, T. vaginalis + Lipo-2000 group, T. vaginalis-NC-siRNA group, and T. vaginalis-TvAP33-siRNA group, with three replicates per group. After T. vaginalis transfection for 24 h, the corresponding group of HaCaT cells was infected with T. vaginalis. After 24 h of T. vaginalis infection HaCaT cells, total RNA and protein were extracted from the cells to detect the expression of HPV membrane receptor molecules CD151 and HSPG2 using qPCR and western blot analysis.

Detection of the effect of TvAP33 overexpressed in HaCaT cells on the expression of HPV membrane receptor molecules CD151 and HSPG2

The pDsRed-N1-TvAP33 eukaryotic expression vector was transfected into HaCaT cells. 24 h later, total RNA and total protein were extracted to detect the expression of HPV membrane receptor molecules CD151 and HSPG2 by qPCR and western blot.

Statistical analysis

GraphPad Prism 9.0 software (Dotmatics, Boston, MA) was used for mapping analysis, and ImajgeJ software was used for gray value analysis for protein expression quantification. The experimental data are expressed as mean ± standard deviation (x±s). T-test is used for pairwise comparisons. One-way analysis of variance and two-factor analysis of variance (ANOVA) are used to compare the mean data among multiple groups. P < 0.05 means that there is a statistical difference between the control group and the experimental group.

T. vaginalis promotes HPV infection

The results of fluorescence microscopy observation revealed a significant increase in the amount of HPV invading HaCaT cells in the T. vaginalis + HPV group compared to the HPV group (Fig. 1A). The HPV infection rate detected by flow cytometry is depicted in Fig. 1B and C, showing a substantial increase in the HPV infection rate of HaCaT cells in the T. vaginalis + HPV group (99.90 ± 0.29%) compared to the HPV group (59.26 ± 0.47%). Live imaging device detection of HPV infection is shown in Fig. 1D and E, indicating a significant increase in vaginal HPV infection in mice within the T. vaginalis + HPV group compared to the HPV group. These findings suggest that T. vaginalis promotes HPV infection.

Upregulation of HPV membrane receptor molecule expression by T. vaginalis

As shown in Fig. 2, T. vaginalis significantly increased the mRNA transcription and protein expression levels of CD151 and HSPG2 in HaCaT cells compared to the Control group (Fig. 2A-F). However, there were no significant changes in the mRNA transcription and protein expression levels of ITGA6 and ITGB1 (Fig. 2G-L). These results indicate that T. vaginalis selectively promotes the expression of the HPV receptor molecules CD151 and HSPG2, with no significant impact on ITGA6 and ITGB1 expression.

Low expression of TvAP33 can inhibit HPV infection and CD151/HSPG2 expression

The results of fluorescence microscopy observation revealed that the TvAP33-siRNA + T. vaginalis + HPV group significantly reduced the invasion of HPV into HaCaT cells compared with the T. vaginalis + HPV group (Fig. 3A). The HPV infection rate detected by flow cytometry is presented in Fig. 3A and 3B. The TvAP33 siRNA + T. vaginalis + HPV group (57.92 ± 0.47%) exhibited a significant decrease in the HPV infection rate of HaCaT cells compared to the T. vaginalis + HPV group (98.65 ± 0.23%). Live imaging instrument detection showed a significant reduction in the invasion of HPV in the vagina of mice in the TvAP33 siRNA + T. vaginalis + HPV group compared to the T. vaginalis + HPV group, as depicted in Fig. 4 (Fig. 3C and D). These findings suggest that reducing TvAP33 expression leads to a significant reduction in promoting HPV infection by T. vaginalis, indicating that TvAP33 mediates the promotion of HPV infection by T. vaginalis.

Compared to the T. vaginalis + HaCaT group, the T. vaginalis-Lipo2000 + HaCaT group, and the T. vaginalis-NC siRNA + HaCaT group, the mRNA transcription and protein expression levels of CD151 (Fig. 3E-G) and HSPG2 (Fig. 3H-J) in HaCaT cells were significantly decreased in the T. vaginalis-TvAP33 siRNA + HaCaT group. These findings suggest that downregulation of TvAP33 expression significantly attenuates the stimulatory effect of T. vaginalis on CD151 and HSPG2 expression in HaCaT cells, implying that TvAP33 functions as a mediator in promoting CD151 and HSPG2 expression induced by T. vaginalis.

Overexpression of TvAP33 promotes HPV infection and CD151/HSPG2 expression

As shown in Fig. 4, the Control group and pDsRed-N1 group exhibited no discernible TvAP33 expression in HaCaT cells. Conversely, the pDsRed-N1 TvAP33 group revealed elevated levels of TvAP33 mRNA transcription (Fig. 4A) and protein expression (Fig. 4B and 4C), indicating the successful transduction and expression of the TvAP33 eukaryotic expression vector plasmid in HaCaT cells, thereby producing the TvAP33 recombinant protein.

Fluorescence microscopy observations revealed that HPV invasion into HaCaT cells was markedly enhanced in the pDsRed-N1-TvAP33 + HPV group, compared to both the Control + HPV and pDsRed-N1 + HPV groups (Fig. 4D). Flow cytometry analysis demonstrated a significant increase in HPV infection rate in the pDsRed-N1-TvAP33 + HPV group (50.10 ± 0.68%), compared to the Control + HPV (40.18 ± 1.08%) and pDsRed-N1 + HPV (40.41 ± 0.11%) groups (Fig. 4E and 4F). Furthermore, the pDsRed-N1-TvAP33 group exhibited a pronounced upregulation of CD151 and HSPG2 mRNA transcription and protein expression in HaCaT cells, compared to the Control and pDsRed-N1 groups (Fig. 4G-L). These findings underscore the capability of TvAP33 to facilitate HPV infection and augment CD151 and HSPG2 expression.

TvAP33 promotes HPV infection by upregating CD151 and HSPG2 expression

Fluorescence microscopy analysis indicated a substantial decrease in HPV invasion into HaCaT cells in the CD151/HSPG2-siRNA + TvAP33-siRNA + T. vaginalis + HPV group, compared to the TvAP33-siRNA + T. vaginalis + HPV group (Fig. 5A). The results of flow cytometry detection of HPV infection rates showed that compared with the TvAP33-siRNA + T. vaginalis + HPV group (65.88 ± 0.52%), the CD151/HSPG2-siRNA + TvAP33-siRNA + T. vaginalis + HPV group (54.18 ± 0.10%/53.20 ± 0.36%) had significantly reduced HPV invasion in HaCaT cells (Fig. 5B and C). Pointed out that these results with lower expression TvAP33 infection of T. vaginalis in vitro respectively wild strains compared HaCaT cells after HPV invasion of quantity, low express TvAP33 infection of T. vaginalis in vitro respectively lower expression of CD151/HSPG2 HaCaT cells after the invasion of HPV was significantly decreased, These results indicate that TvAP33 in promoting HPV infection by upregulating CD151 and HSPG2 expression.

T. vaginalis is a prevalent yet frequently overlooked extracellular parasite following infection [35]. Some relevant epidemiological studies have shown that T. vaginalis infection is closely related to HR-HPV infection [39-41]. The persistent presence of HR-HPV subtypes, particularly HPV16 and HPV18, is the primary driver of cervical cancer, a rapidly progressing malignancy with a high mortality rate, posing a significant threat to women's health [42, 43]. Despite the efficacy of preventive HPV vaccines against common subtypes, current formulations do not encompass all pathogenic HPV types, limiting their coverage, especially in low- and middle-income countries [44]. Therefore, HPV infection and T. vaginalis that induce HPV infection remain an important public health issue. There are currently no relevant studies using experimental data to prove that T. vaginalis promotes HPV infection. This study used cell and animal experiments to confirm that T. vaginalis promotes HPV infection, providing certain ideas for the joint prevention and treatment of T. vaginalis and HPV.

Several mechanisms through which vaginal pathogens affect HPV infection have been initially explored. For instance, Gardnerella vaginalis has been shown to facilitate HPV infection by enhancing the production of mucin-degrading enzymes in vaginal secretions, thereby compromising the integrity of the host’s mucosal barrier, which normally serves as a defense against viral entry [45]. Chlamydia trachomatis impairs the host's ability to clear HPV by altering the density of antigen-presenting cells and the balance of regulatory T cells in the cervical epithelium through immune response modulation [47]. However, the mechanism by which promotes HPV infection remains unknown. HPV infection is facilitated by membrane receptor molecules such as HSPG2, CD151, ITGA6, and ITGB1 [25-28]. In this study, by infecting HaCaT cells or mouse vaginas with T. vaginalis and RFP-HPV18 pseudovirus, it was found that the expression of HPV membrane receptor molecules CD151 and HSPG2 increased significantly after T. vaginalis infection, but the expression of ITGA6 and ITGB1 did not change significantly. The HPV infection rate increased significantly, providing direct evidence that T. vaginalis promotes HPV infection.

T. vaginalis is an extracellular parasitic protozoan, and its adhesion to host cells is crucial for establishing parasitism and pathogenicity [8]. TvAP33 is a key molecule for T. vaginalis to play its adhesion and pathogenic role [8]. Studies have shown that TvAP33 are pivotal in facilitating the adhesion of T. vaginalis to host cells, while also inhibiting host cell proliferation and inducing apoptosis. Passive immunization with anti-rTvAP33 antibodies, or blocking TvAP33 proteins with antibodies, significantly reduces the pathogenicity of T. vaginalis [8]. Further research is needed to determine whether TvAP33 of T. vaginalis also promote HPV infection and the expression of HPV membrane receptors. Studies found that reducing the expression of TvAP33 inhibited the promotion effect of T. vaginalis on HPV infection rate and the expression of HPV membrane receptor molecule CD151/HSPG2, while the result of overexpressing TvAP33 was opposite to the result of reducing TvAP33 expression. Through low expression and overexpression experiments, it was demonstrated that TvAP33 mediated T. vaginalis promotes HPV infection and the expression of HPV membrane receptor molecules.

Studies have shown that factors such as inflammation and immune responses, hypoxia and hypoxia-inducible factors (HIFs), epidermal growth factor receptor (EGFR) signaling, and genetic and epigenetic modifications (such as DNA methylation and histone modifications) can upregulate the expression of CD151 and HSPG2 in HPV infections [48]. The interaction between TvAP33 and host cells can trigger inflammatory responses and induce the production of pro-inflammatory cytokines [8]. Subsequently, TvAP33 disrupts the host's immune response by regulating the production of these cytokines, thereby maintaining a chronic infectious environment that allows T. vaginalis to persist within the host [8]. Therefore, the interaction between TvAP33 and host cells may be closely related to the up-regulation of CD151 and HSPG2 expression and the process of HPV infection.

To further clarify whether TvAP33 promotes HPV infection by upregulating HSPG2/CD151 expression, T. vaginalis with reduced TvAP33 expression were infected with HaCaT cells with reduced CD151/HSPG2 expression and HPV in this study. The results showed that T. vaginalis infected group with low expression of TvAP33 significantly reduced the HPV invasion rate, confirming that TvAP33 promotes HPV infection by promoting CD151 and HSPG2 expression.

In summary, TvAP33 plays a crucial role in T. vaginalis promoting HPV infection and promoting the expression of HPV membrane receptor molecules CD151 and HSPG2. Due to limited conditions, only the results and data of cell experiments and animal experiments have proved that TvAP33 promotes HPV infection by upregulating the expression of HPV membrane receptor molecules. Whether this conclusion is true in humans still needs further exploration. In future research, we can start to explore the relationship between TvAP33 and HPV infection and HPV membrane receptor molecules from a deeper perspective, for example, to explore whether TvAP33 interacts with certain pathways or molecules on cellular or animal receptors. This will help to more comprehensively analyze and understand the complex interaction between T. vaginalis and HPV, and provide a more favorable theoretical basis for the prevention and treatment of T. vaginalis and HPV.

Acknowledgements

Not applicable.

Author Contributions

XFM and ZCZ designed the study and critically revised the paper. WXS, JWZ, HZ, WJT and YNZ prepared the experimental samples and performed the experimental procedures. WXS and XFM analyzed the results. WXS, ZKY, XWT, SW, XFM and ZCZ contributed to the writing of the manuscript. All the authors have read and approved the final manuscript.

Funding

This study was financially supported by National Natural Science Foundation of China (No. 81802028), the Training Plan for Young Backbone Teachers in Colleges and Universities of Henan Province (No. 2023GGJS104), the Science and Technology Planning Project of Henan Province (No. 232102311113), the Doctoral Scientific Research Activation Foundation of Xinxiang Medical University (No. XYBSKYZZ202140) and the Opening Foundation of Shangqiu Medical College (No. KFKT23007). The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.

Data availability statement

The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding author.

Ethics statement

The study was reviewed and approved by the Ethics Review Committee of Xinxiang

Medical University (Reference No. XYLL-20210184).

Competing interests statement

The authors declare that they have no competing interests.

Shiratori M, Patel A, Gerhold RW, Sullivan SA, Carlton JM. Persistent Trichomonas vaginalis infections and the pseudocyst form. Trends Parasitol. 2023;39(12):1023-1031.
Saleh NE, Alhusseiny SM, El-Zayady WM, Aboelnaga EM, El-Beshbishi WN, Saleh YM, et al. Trichomonas vaginalis serostatus and prostate cancer risk in Egypt: a case-control study. Parasitol Res. 2021;120(4):1379-1388.
Price CM, Peters RPH, Steyn J, Mudau M, Olivier D, De Vos L, et al. Prevalence and Detection of Trichomonas vaginalis in HIV-Infected Pregnant Women. Sex Transm Dis. 2018;45(5):332-336.
Mabaso N, Abbai NS. A review on Trichomonas vaginalis infections in women from Africa. S Afr J Infect Dis. 2021;36(1):254.
Harryparsad R, Meyer B, Taku O, Serrano M, Chen PL, Gao X, et al. Prevalence and incidence of sexually transmitted infections among South African women initiating injectable and long-acting contraceptives. PLoS One. 2023;18(11):e0294285.
Rowley J, Vander Hoorn S, Korenromp E, Low N, Unemo M, Abu-Raddad LJ, et al. Chlamydia, gonorrhoea, trichomoniasis and syphilis: global prevalence and incidence estimates, 2016. Bull World Health Organ. 2019;97(8):548-562p.
Zhang Z, Song X, Deng Y, Li Y, Li F, Sheng W, et al. Trichomonas vaginalis adhesion protein 65 (TvAP65) modulates parasite pathogenicity by interacting with host cell proteins. Acta Trop. 2023;246:106996.
Zhang Z, Li Y, Wang S, Hao L, Zhu Y, Li H, et al. The Molecular Characterization and Immunity Identification of Trichomonas vaginalis Adhesion Protein 33 (AP33). Front Microbiol. 2020;11:1433.
Azadehrah M, Azadehrah M, Zeinali F, Nokhostin F. Prevalence of Trichomonas Infection in Relation to Human Papillomavirus (HPV) in Pap Smear Samples of Female Patients Referred to Shahid Sadoughi Hospital, Yazd (Iran). Cureus. 2024;16(4):e57701.
Ma Y, Xia X, Zheng W, Dai Y, Zhuang X. HPV prevalence and genotype distribution among women in eastern China during the Covid-19 pandemic. Hum Vaccin Immunother. 2023;19(1):2212571.
Williamson AL. Recent Developments in Human Papillomavirus (HPV) Vaccinology. Viruses. 2023;15(7).
Menon S, Wusiman A, Boily MC, Kariisa M, Mabeya H, Luchters S, et al. Epidemiology of HPV Genotypes among HIV Positive Women in Kenya: A Systematic Review and Meta-Analysis. PLoS One. 2016;11(10):e0163965.
Liu J, Ma S, Qin C, Zheng S, Chen Z, Huang Y, et al. Prevalence and genotype distribution of human papillomavirus in Zhengzhou, China, in 2016. Arch Virol. 2020;165(3):731-736.
Lazenby GB, Taylor PT, Badman BS, McHaki E, Korte JE, Soper DE, et al. An association between Trichomonas vaginalis and high-risk human papillomavirus in rural Tanzanian women undergoing cervical cancer screening. Clin Ther. 2014;36(1):38-45.
Belfort IKP, Cunha APA, Mendes FPB, Galvão-Moreira LV, Lemos RG, de Lima Costa LH, et al. Trichomonas vaginalis as a risk factor for human papillomavirus: a study with women undergoing cervical cancer screening in a northeast region of Brazil. BMC Womens Health. 2021;21(1):174.
Noël JC, Fayt I, Romero Munoz MR, Simon P, Engohan-Aloghe C. High prevalence of high-risk human papillomavirus infection among women with Trichomonas vaginalis infection on monolayer cytology. Arch Gynecol Obstet. 2010;282(5):503-505.
Hu SY, Tsang SH, Chen F, Pan QJ, Zhang WH, Hong Y, et al. Association Between Common Vaginal Infections and Cervical Non-Human Papillomavirus (HPV) 16/18 Infection in HPV-Vaccinated Women. J Infect Dis. 2021;223(3):445-451.
Zhang D, Li T, Chen L, Zhang X, Zhao G, Liu Z. Epidemiological investigation of the relationship between common lower genital tract infections and high-risk human papillomavirus infections among women in Beijing, China. PLoS One. 2017;12(5):e0178033.
Taku O, Brink A, Meiring TL, Phohlo K, Businge CB, Mbulawa ZZA, et al. Detection of sexually transmitted pathogens and co-infection with human papillomavirus in women residing in rural Eastern Cape, South Africa. PeerJ. 2021;9:e10793.
Ghosh I, Ghosh P, Bharti AC, Mandal R, Biswas J, Basu P. Prevalence of human papillomavirus and co-existent sexually transmitted infections among female sex workers, men having sex with men and injectable drug abusers from eastern India. Asian Pac J Cancer Prev. 2012;13(3):799-802.
Mendoza L, Mongelos P, Paez M, Castro A, Rodriguez-Riveros I, Gimenez G, et al. Human papillomavirus and other genital infections in indigenous women from Paraguay: a cross-sectional analytical study. BMC Infect Dis. 2013;13:531.
Lockhart A, Senkomago V, Ting J, Chitwa M, Kimani J, Gakure H, et al. Prevalence and Risk Factors of Trichomonas vaginalis Among Female Sexual Workers in Nairobi, Kenya. Sex Transm Dis. 2019;46(7):458-464.
Wang W, Zhang XH, Li M, Hao CH, Liang HP. Association between Vaginal Infections and the Types and Viral Loads of Human Papillomavirus: A Clinical Study Based on 4,449 Cases of Gynecologic Outpatients. Can J Infect Dis Med Microbiol. 2020;2020:9172908.
Gong X, Chi H, Xia Z, Yang G, Tian G. Advances in HPV-associated tumor management: Therapeutic strategies and emerging insights. J Med Virol. 2023;95(7):e28950.
Xie H, Wei M, Yao L, Liu Y, Xie X, Li X. The Significance of Human Papillomavirus Receptors Related Genetic Variants in Cervical Cancer Screening. Microbiol Spectr. 2023;11(4):e0511722.
Mukherjee A, Ye Y, Wiener HW, Kuniholm MH, Minkoff H, Michel K, et al. Variations in Genes Encoding Human Papillomavirus Binding Receptors and Susceptibility to Cervical Precancer. Cancer Epidemiol Biomarkers Prev. 2023;32(9):1190-1197.
Kwon EJ, Lee HR, Lee JH, Seo C, Ha M, Roh J, et al. Identification of differentially expressed genes and pathways for risk stratification in HPV-associated cancers governing different anatomical sites. Front Biosci (Landmark Ed). 2022;27(1):2.
Scheffer KD, Berditchevski F, Florin L. The tetraspanin CD151 in papillomavirus infection. Viruses. 2014;6(2):893-908.
Khalil MI, Yang C, Vu L, Chadha S, Nabors H, Welbon C, et al. HPV upregulates MARCHF8 ubiquitin ligase and inhibits apoptosis by degrading the death receptors in head and neck cancer. PLoS Pathog. 2023;19(3):e1011171.
Fons NR, Kines RC, Thompson CD, Day PM, Lowy DR, Schiller JT. Chondroitin Sulfate Proteoglycans Are De Facto Cellular Receptors for Human Papillomavirus 16 under High Serum Conditions. J Virol. 2022;96(7):e0185721.
Fothergill T, McMillan NA. Papillomavirus virus-like particles activate the PI3-kinase pathway via alpha-6 beta-4 integrin upon binding. Virology. 2006;352(2):319-328.
Henken FE, Banerjee NS, Snijders PJ, Meijer CJ, De-Castro Arce J, Rösl F, et al. PIK3CA-mediated PI3-kinase signalling is essential for HPV-induced transformation in vitro. Mol Cancer. 2011;10:71.
Breiner B, Preuss L, Roos N, Conrady M, Lilie H, Iftner T, et al. Refolding and in vitro characterization of human papillomavirus 16 minor capsid protein L2. Biol Chem. 2019;400(4):513-522.
Spoden G, Kühling L, Cordes N, Frenzel B, Sapp M, Boller K, et al. Human papillomavirus types 16, 18, and 31 share similar endocytic requirements for entry. J Virol. 2013;87(13):7765-7773.
Ortiz S, Verdan R, Fortes F, Benchimol M. Trichomonas vaginalis: Monolayer and Cluster Formation-Ultrastructural Aspects Using High-Resolution Scanning Electron Microscopy. Pathogens. 2023;12(12).
Zhang Z, Song X, Zhang Z, Li H, Duan Y, Zhang H, et al. The molecular characterization and immune protection of adhesion protein 65 (AP65) of Trichomonas vaginalis. Microb Pathog. 2021;152:104750.
Rada P, Kellerová P, Verner Z, Tachezy J. Investigation of the Secretory Pathway in Trichomonas vaginalis Argues against a Moonlighting Function of Hydrogenosomal Enzymes. J Eukaryot Microbiol. 2019;66(6):899-910.
Zhang Z, Deng Y, Sheng W, Song X, Li Y, Li F, et al. The interaction between adhesion protein 33 (TvAP33) and BNIP3 mediates the adhesion and pathogenicity of Trichomonas vaginalis to host cells. Parasit Vectors. 2023;16(1):210.
Zhang Z, Li F, Deng Y, Li Y, Sheng W, Tian X, et al. Trichomonas vaginalis excretory secretory proteins reduce semen quality and male fertility. Acta Trop. 2023;238:106794.
Zhang Z, Li D, Li Y, Zhang R, Xie X, Yao Y, et al. The correlation between Trichomonas vaginalis infection and reproductive system cancer: a systematic review and meta-analysis. Infect Agent Cancer. 2023;18(1):15.
Zhang Z, Li Y, Lu H, Li D, Zhang R, Xie X, et al. A systematic review of the correlation between Trichomonas vaginalis infection and infertility. Acta Trop. 2022;236:106693.
Yu L, Majerciak V, Zheng ZM. HPV16 and HPV18 Genome Structure, Expression, and Post-Transcriptional Regulation. Int J Mol Sci. 2022;23(9).
Kjaer SK, Dehlendorff C, Belmonte F, Baandrup L. Real-World Effectiveness of Human Papillomavirus Vaccination Against Cervical Cancer. J Natl Cancer Inst. 2021;113(10):1329-1335.
Basu P, Malvi SG, Joshi S, Bhatla N, Muwonge R, Lucas E, et al. Vaccine efficacy against persistent human papillomavirus (HPV) 16/18 infection at 10 years after one, two, and three doses of quadrivalent HPV vaccine in girls in India: a multicentre, prospective, cohort study. Lancet Oncol. 2021;22(11):1518-1529.
Santella B, Schettino MT, Franci G, De Franciscis P, Colacurci N, Schiattarella A, et al. Microbiota and HPV: The role of viral infection on vaginal microbiota. J Med Virol. 2022;94(9):4478-4484.
Nicolò S, Tanturli M, Mattiuz G, Antonelli A, Baccani I, Bonaiuto C, et al. Vaginal Lactobacilli and Vaginal Dysbiosis-Associated Bacteria Differently Affect Cervical Epithelial and Immune Homeostasis and Anti-Viral Defenses. Int J Mol Sci. 2021;22(12).
Gargiulo Isacco C, Balzanelli MG, Garzone S, Lorusso M, Inchingolo F, Nguyen KCD, et al. Alterations of Vaginal Microbiota and Chlamydia trachomatis as Crucial Co-Causative Factors in Cervical Cancer Genesis Procured by HPV. Microorganisms. 2023;11(3).
Kgk D, Kumari S, G S, Malla RR. Marine natural compound cyclo(L-leucyl-L-prolyl) peptide inhibits migration of triple negative breast cancer cells by disrupting interaction of CD151 and EGFR signaling. Chem Biol Interact. 2020;315:108872.

Table 1 qPCR primer sequences and siRNA sequences.

Name	Sequence（5′-3′）
TvAP33 sense	GGCACATCCGAAGAAGATGC
TvAP33 antisense	CTTGCCTGGTGGAGCTGTA
Tv-Actin sense	TCACAGCTCTTGCTCCACCA
Tv-Actin antisense	AAGCACTTGCGGTGAACGAT
CD151 sense	ATGGGTGAGTTCAACGAGAAGA
CD151 antisense	GCAGGCTGATGTAGTCACTCT
HSPG2 sense	TGAGTCCTTCTACTGGCAGC
HSPG2 antisense	ATGTTGTTGCCCGTGATCTG
ITGA6 sense	ATGCACGCGGATCGAGTTT
ITGA6 antisense	TTCCTGCTTCGTATTAACATGCT
ITGB1 sense	CAAGAGAGCTGAAGACTATCCCA
ITGB1 antisense	TGAAGTCCGAAGTAATCCTCCT
GAPDH sense	CGGAGTCAACGGATTTGGTCGTAT
GAPDH antisense	AGCCTTCTCCATGGTGGTGAAGAC
TvAP33-siRNA sense	GUCUCCCAAUCUUCAAGAACATT
TvAP33-siRNA antisense	UGUUCUUGAAGAUUGGGAGACTT
Tv-NC-siRNA sense	CGUCCCGUAGCCCACUAAAdTdT
Tv-NC-siRNA antisense	UUUAGUGGGCUACGGGACGdTdT
Sc-42829A sense	CGAGAAGAAGACAACAUGUtt
Sc-42829A antisense	ACAUGUUGUCUUCUUCUCGtt
Sc-42829B sense	CCUCCAACAUCUACAAGGUtt
Sc-42829B antisense	ACCUUGUAGAUGUUGGAGGtt
Sc-42829C sense	CAGGUCUUUGGCAUGAUCUtt
Sc-42829C antisense	AGAUCAUGCCAAAGACCUGtt
Sc-44010A sense	GCAACAACAUCAUGCUAGUtt
Sc-44010A antisense	ACUAGCAUGAUGUUGUUGCtt
Sc-44010B sense	CGAGCUAUGUGAAUGCAAUtt
Sc-44010B antisense	AUUGCAUUCACAUAGCUCGtt
Sc-44010C sense	CCAAGUGGUUGUCCUUUCAtt
Sc-44010C antisense	UGAAAGGACAACCACUUGGtt

No competing interests reported.

Additionalfile1JPEG.jpg
Additional file 1: Fig. S1. The interference efficiency of TvAP65 siRNAs. A Detection of TvAP33 interference effects at the mRNA level by qPCR. B Detection of TvAP33 interference effects at the protein expression level by western blot. C Gray value analysis of TvAP33 protein expression level using Image J software. “ns” indicates no statistical difference, “***” indicates P < 0.001.
Additionalfile2JPEG.jpg
Additional file 2: Fig. S2. The interference efficiency of CD151 and HSPG2 siRNAs. A Detection of CD151 interference effects at the mRNA level by qPCR. B Detection of CD151 interference effects at the protein expression level by western blot. C Gray value analysis of CD151 protein expression levels using Image J software. D Detection of HSPG2 interference effects at the mRNA level by qPCR. E Detection of HSPG2 interference effects at the protein expression level by western blot. F Gray value analysis of HSPG2 protein expression levels using Image J software. “ns” indicates no statistical difference, “***” indicates P < 0.001.

Download PDF

Reviews received at journal
21 Oct, 2024
Reviewers agreed at journal
20 Oct, 2024
Reviewers agreed at journal
19 Oct, 2024
Reviewers invited by journal
19 Oct, 2024
Editor assigned by journal
18 Oct, 2024
Submission checks completed at journal
18 Oct, 2024
First submitted to journal
17 Oct, 2024

You are reading this latest preprint version

Trichomonas vaginalis adhesion protein 33 (TvAP33) promotes HPV infection by upregulating the expression of HPV membrane receptor molecules

Status:

Version 1

Abstract

Figures

Highlights

Background

Methods

Results

Discussion

Declarations

References

Table

Additional Declarations

Supplementary Files

Status:

Version 1