Active screening and Molecular Epidemiology Characteristics of fecal colonization of Carbapenem resistance Enterobacterales from Intensive Care Units wards in a Tertiary Hospital in Shanghai, China

doi:10.21203/rs.3.rs-5286316/v1

Download PDF

Research Article

Active screening and Molecular Epidemiology Characteristics of fecal colonization of Carbapenem resistance Enterobacterales from Intensive Care Units wards in a Tertiary Hospital in Shanghai, China

https://doi.org/10.21203/rs.3.rs-5286316/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: Active screening fecal colonization of carbapenem resistance Enterobacterales(CRE) and intervention in Intensive Care Units(ICU) wards have become important measures to prevent CRE infection. However, limited data is available on molecular epidemiological characteristics and homology analysis of fecal colonization of CRE(CRE-fc) in ICU wards. This prospective observational study was aimed to investigate the molecular epidemiological characteristics and homology analysis of fecal colonization of CRE in ICU wards from a university hospital in China.

Methods: Fecal swabs were collected from 435 patients in ICU wards of a tertiary hospital in Shanghai, China from March 1, 2022 to February 28, 2023, and the above specimens were inoculated in Resistant Bacteria Chromogenic Plate (Antu Bio, China). We removed duplicate strains from the same patient and only retain the first isolated CRE-fc. Infection prevention and control (IPC) interventions were carried out for patients with positive CRE screening results. The bacterial identification, antimicrobial susceptibility, MLST and serotypes were profiled. We also applied whole-genome sequencing and core-genome MLST to analysis the molecular epidemiological characteristics and homology of these strains.

Results: The prevalence of CRE-fc in ICU wards was 12.6%(55/435). The predominate CRE-fc was Klebsiella pneumoniae (83.6%, 46/55), followed by Escherichia coli (9.1%, 5/55), Enterobacter aerogenes (3.7%, 2/55), Enterobacter cloacae (1.8%, 1/55), Citrobacter freundii (1.8%, 1/55). Through active screening of CRE-fc and IPC interventions in 2022, we found that the CRE infection rate in 2022 (22.8%) was significantly lower than that in 2021 (33.7%). MLST analysis revealed that the 46 fecal colonization of carbapenem resistance Klebsiella pneumoniae (CRKP-fc) belonged to 3 different ST, ST11 was the most predominant ST (71.7%, 33/46), followed by ST15 (26.1%, 12/46) and ST290 (2.2%, 1/46). All ST11 and ST15 strains harbored blaKPC-2, and ten ST15 strains carried two carbapenemase genes (blaKPC-2, blaOXA-1) at the same time. The phylogenetic tree identified two major clades, cluster 1 corresponding to ST11, cluster 2 to ST15.

Conclusion: Phylogenetic analysis showed clonal spread of CRKP among patients in ICU wards. ST11-KL64 CRKP has emerged as the most prevalent fecal colonized carbapenem-resistant Enterobacterales and may contribute to hospital outbreaks of infection. Active screening of CRE-fc and IPC interventions can reduce the CRE infection rate in ICU wards.

active screening

fecal colonization

carbapenem resistance Enterobacterales

molecular epidemiological characteristics

homology

Carbapenem resistance Enterobacterales (CRE) infection has emerged as a major global public health threat and caused serious societal and economic burden.^{1, 2} Notably, carbapenem-resistant Klebsiella pneumoniae (CRKP) account for 60–90% of clinical CRE infections in the United States, Europe, and China.^3–5 According to the 2023 China Antimicrobial Surveillance Network (CHINET), the resistance rates of K. pneumoniae to meropenem has straightly climbed from 2.9% in 2005 to 30.0% in 2023.⁶ Moreover, carbapenem-resistant Klebsiella pneumoniae (CRKP) was dominant in intestinal colonized CRE.^{7, 8} It has been reported that CRE colonization is an important risk factor for developing CRE infection in hospitals and communities.^9–12

Enterobacterales develop resistance to carbapenems through two main mechanisms. Non-carbapenemase-producing carbapenem-resistant Enterobacterales (via one or combination of alterations in membrane permeability, alterations in drug efflux pumps, and alterations in antimicrobial target site binding) and carbapenemase-producing carbapenem-resistant Enterobacterales (eg, KPC, NDM, VIM and OXA).^{13, 14} Carbapenemase-producing Enterobacterales (CPE) is of greatest concern,¹⁵ which have higher-level antimicrobial resistance, clonal spread and horizontal gene transfer.¹⁶

Studies have revealed that the ICU wards has a higher CRE colonization rate than other wards.^{7, 17} Studies have also shown that the ICU wards has a higher CRE infection rate than other wards.^{18, 19} It has also been shown that active screening of CRE-fc and IPC interventions can reduce the CRE infection rate in ICU wards.^{20, 21}

Active screening of CRE-fc in ICU wards has become an important prevention measure for CRE infection.²² However, limited data is available on molecular epidemiological characteristics and homology analysis of CRE-fc in ICU wards. Exploring the molecular epidemiological characteristics and homology analysis of CRE-fc in ICU wards can provide evidence for CRE transmission, which is of great value for better application of infection control measures and reduction of mortality. This prospective observational study was aimed to investigate the molecular epidemiological characteristics and homology analysis of CRE-fc in ICU wards from a university hospital in China.

Study Design

Fecal swabs were collected from 435 patients in ICU wards of a tertiary hospital in Shanghai, China from March 1, 2022 to February 28, 2023, and the above specimens were inoculated in Resistant Bacteria Chromogenic Plate (Antu Bio, China). Therefore, active screening of CRE-fc was performed. Subsequently, the meropenem-resistant colonies were selected, and bacterial identification was performed by MALDI-TOF mass spectrometry (Bruker Daltonics, Billerica, MA, Germany) and VITEK-2 compact automated microbiology analyzer (Biomerieux, Marcy L‘Etoile, France). Active screening was conducted upon the patient's admission, and then repeated weekly throughout their hospitalization. We removed duplicate strains from the same patient and only retain the first isolated CRE-fc. A total of 55 isolates of fecal colonization of CRE(CRE-fc) were identified. Two strains of CRKP, WYZHKP101 and WYZHKP102, were isolated from the ICU environment for comparison with CRKP-fc. The CRE strains were used to test for the presence of the carbapenemase genes bla_KPC, bla_NDM, bla_VIM, bla_IMP, bla_OXA−48 using PCR with specific primers (bla_KPC: Forward: ATGTCACTGTATCGCCGTCT, Reverse: TTTTCAGAGCCTTACTGCCC; bla_NDM: Forward: GGTTTGGCGATCTGGTTTTC, Reverse: CGGAATGGCTCATCACGATC; bla_VIM: Forward: GATGGTGTTTGGTCGCATA, Reverse: CGAATGCGCAGCACCAG; bla_IMP: Forward: GGAATAGAGTGGCTTAAYTCTC, Reverse: GGTTTAAYAAAACAACCACC; bla_OXA−48: Forward: GCGTGGTTAAGGATGAACAC, Reverse: CATCAAGTTCAACCCAACCG).

Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing was performed using the broth microdilution method of the Clinical and Laboratory Standards Institute(CLSI). The results were interpreted according to 2022 CLSI breakpoints²³ for all antimicrobial agents except tigecycline, which was interpreted using the interpretative criteria of the Food and Drug Administration (FDA). Escherichia coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as controls for antimicrobial susceptibility testing.

Whole Genome Sequencing and Bioinformatics Analysis

As the predominate CRE-fc was Klebsiella pneumoniae (83.6%, 46/55), it is necessary to further analyze the phenotype and genome of 46 CRKP-fc strains. Two CRKP strains, WYZHKP101 and WYZHKP102, which were isolated from the environment, were also further analyze the phenotype and genome for homology. Finally, 48 isolates of CRKP were selected and subjected to whole-genome sequencing (WGS). The genomic DNA of K. pneumoniae strains was extracted using a commercial DNA extraction kit (Qiagen, Germany) following the manufacturer’s instructions. Fragmented genomic DNA was sequenced using the 150-bp paired-end Illumina Hiseq platform (Illumina, San Diego, CA, United States). De novo assembly was conducted using Unicycler version 0.4.8.²⁴ Then, the genome sequence was acquired after the rectification by using pilon software.²⁵ Gene annotation was performed using the Prokka version 1.12.²⁶

Antimicrobial resistance genes analysis were identified using ResFinder 4.1 (https://cge.food.dtu.dk/services/ResFinder/). Multilocus sequence typing (MLST), capsule serotypes and virulence genes were identified according to the BIGSdb-Pasteur (https://bigsdb.pasteur.fr/cgi-bin/bigsdb/bigsdb.pl?db=pubmlst_klebsiella_seqdef&page=sequenceQuery). Core genome MLST(cgMLST) analysis was performed using SeqSphere + version 9.0.8 (Ridom GmbH, Muenster, Germany).^{27, 28}

IPC Interventions and effect evaluation

According to the World Health Organization (WHO) guidelines²⁹, infection prevention and control (IPC) interventions were carried out for patients with positive CRE screening results, including contact isolation, use of disposable or dedicated patient care equipment, hand hygiene of medical staff, and disinfection of their wards.

The CRE detection rate of clinical infection in ICU wards was used as the evaluation index of the effect of active screening and IPC interventions. The CRE detection rate of clinical infection in ICU wards was compared between the period without CRE active screening and IPC interventions (from January to December 2021) and the period with CRE active screening and IPC interventions (from January to December 2022).

Statistical Analysis

Data were described as means ± standard deviation (SD). All statistical analyses were performed using SPSS version 23.0 (IBM Co., Armonk, NY, USA). Categorical variables were assessed by Chi-square test or Fisher’s exact test. All statistical tests were 2 tailed and P < 0.05 was considered statistically significant.

Fecal Carriage of Carbapenem-Resistant Enterobacterales

During the study period, we active screened fecal swabs from 435 patients in ICU wards. The prevalence of CRE-fc in ICU wards was 12.6%(55/435). The predominate CRE-fc was Klebsiella pneumoniae (83.6%, 46/55), followed by Escherichia coli (9.1%, 5/55), Enterobacter aerogenes (3.7%, 2/55), Enterobacter cloacae (1.8%, 1/55), Citrobacter freundii (1.8%, 1/55). We removed duplicate strains from the same patient and only retain the first isolated CRE-fc. The 55 CRE-fc strains were isolated from 55 individual patients (35 male and 20 female) whose mean age was 70.6 ± 13.5 years. Two strains of CRKP, WYZHKP101 and WYZHKP102, were isolated from the ICU environment for comparison with CRKP-fc. As the predominate CRE-fc was Klebsiella pneumoniae (83.6%, 46/55), it is necessary to further analyze the phenotype and genome of 46 CRKP-fc strains, WYZHKP101 and WYZHKP102.

Molecular characterization of carbapenemase genes

The distribution of carbapenemase genes of 55 CRE-fc strains was shown in Table 1. As was shown in Table 1, the most prevalent carbapenemase gene was bla_KPC (89.1%, 49/55), detected in 45 Klebsiella pneumoniae isolates, 1 Escherichia coli, 2 Enterobacter aerogenes and 1 Citrobacter freundii; followed by bla_NDM (10.9%, 6/55), detected in 4 Escherichia coli isolates, 1 Klebsiella pneumoniae and 1 Enterobacter cloacae; bla_IMP, bla_VIM, and bla_OXA−48 were not detected(Table 1).

Table 1

carbapenemase genes in 55 CRE-fc strains
Bacteria	Carbapenemase genes(isolate number)
Bacteria	bla_KPC	bla_NDM	bla_VIM	bla_IMP	bla_OXA−48
Klebsiella pneumoniae	45	1	-	-	-
Escherichia coli	1	4	-	-	-
Enterobacter aerogenes	2	-	-	-	-
Enterobacter cloacae	-	1	-	-	-
Citrobacter freundii	1	-	-	-	-

Active screening of CRE-fc and IPC interventions reduce the CRE infection rate in ICU wards

The CRE infection rate in ICU wards from 2021 to 2022 was shown in Table 2. Through active screening of CRE-fc and IPC interventions in 2022, we found that the CRE infection rate in 2022 (22.8%) was significantly lower than that in 2021 (33.7%), and the difference was statistically significant. CRKP and carbapenem-resistant Escherichia coli (CRECO) were the two most dominant CRE in CRE-fc. The infection rate of CRKP in 2022 (39.3%) was lower than that in 2021 (55.9%), and the difference was statistically significant. However, the CRECO infection rate in 2022 (2.9%) and 2021 (2.6%) was stable, and the difference was not statistically significant. This suggested that active screening of CRE-fc and IPC interventions can reduce the CRE infection rate in ICU wards.

Table 2

Profiles of CRE, CRKP, and CRECO infections in ICU wards from 2021 to 2022
Bacteria	Year(%)		P-value
Bacteria	2021	2022	P-value
CRE	33.7(63/187)	22.8(57/250)	0.012
CRKP	55.9(57/102)	39.3(48/122)	0.014
CRECO	2.6(1/38)	2.9(2/69)	0.936

Abbreviations: CRE, carbapenem resistance Enterobacterales; CRKP, carbapenem-resistant Klebsiella pneumoniae; CRECO, carbapenem-resistan Escherichia coli

The Antimicrobial Resistance Profile of 46 Carbapenem-Resistant K. pneumoniae

To clarify the antibiotic-resistant Profile of 46 Fecal colonization of CRKP, we tested their susceptibility to 18 antibiotics (Table 3). All CRKP showed multiple drug resistance phenotype resistant to three or more antibiotic classes. The 46 CRKP-fc were resistant to ampicillin,

ampicillin/sulbactam, cefoperazone/sulbactam, piperacillin/tazobactam, cefazolin, cefuroxime, ceftazidime, ceftriaxone, Cefepime, Cefoxitin, Imipenem, Meropenem. The antimicrobial resistance rate of Ceftazidime/Avibactam was the lowest (6.5%), followed by Tigecycline (8.7%), Trimethoprim-sulfamethoxazole (73.9%), Amikacin (76.1%), Gentamicin (93.5%) and Levofloxacin (97.8%).

Table 3 Antibiotic Susceptibilities of 46 Carbapenem-Resistant K. pneumoniae

Antibiotics	Sensitivity (%)	Intermediate (%)	Resistance (%)
Ampicillin	0	0	100
Ampicillin/sulbactam	0	0	100
Cefoperazone/sulbactam	0	0	100
Piperacillin/tazobactam	0	0	100
Cefazolin	0	0	100
Cefuroxime	0	0	100
Ceftazidime	0	0	100
Ceftriaxone	0	0	100
Cefepime	0	0	100
Cefoxitin	0	0	100
Imipenem	0	0	100
Meropenem	0	0	100
Amikacin	21.7	2.2	76.1
Gentamicin	6.5	0	93.5
Levofloxacin	2.2	0	97.8
Trimethoprim-sulfamethoxazole	26.1	0	73.9
Ceftazidime/Avibactam	93.5	0	6.5
Tigecycline	76.1	15.2	8.7

The Distribution of Antibiotic Resistance Genes, Virulence Genes, MLST and Capsular Serotypes

Then, 46 CRKP-fc underwent whole-genome sequencing. Two strains of CRKP, WYZHKP101 and WYZHKP102, were isolated from the ICU environment for comparison with 46 strains of CRKP-fc, and whole genome sequencing was performed. MLST analysis revealed that the 46 CRKP-fc belonged to 3 different ST, ST11 was the most predominant ST (71.7%, 33/46), followed by ST15 (26.1%, 12/46) and ST290 (2.2%, 1/46) (Figure 1). Capsular serotypes revealed four 4 different K loci; KL64 was the most predominant serotype (54.3%, 25/46), followed by KL19 (26.1%, 12/46), KL47 (4.3%, 2/46), KL21 (2.2%, 1/46) and six strains could not be typed (Figure 1). This suggests that ST11-KL64 CRKP has emerged as the most prevalent CRKP-fc and may contribute to hospital outbreaks of infection.

The presence of carbapenemase genes is concerning, as it can cause resistance to many types of antibiotics, including carbapenems. All ST11 and ST15 strains harbored bla_KPC-2, and ten ST15 strains carried two carbapenemase genes (bla_KPC-2, bla_OXA-1) at the same time (Figure 1). One ST290 strain carried two carbapenemase genes (bla_NDM-1, bla_OXA-9) (Figure 1). Compared with ST11 strains, ST15 strains carried multiple carbapenase genes, which further increased antibiotic resistance.

Almost all ST11 strains carried virulence genes iucABCD-iutA and rmpA2, while ST15 strains lacked these virulence genes (Figure 1). ST11 strains carried more virulence genes than ST15 strains, which is the opposite of resistance between them. This result suggests that strains with more resistance may have less virulence potential.

WYZHKP101 and WYZHKP102 isolated from the ICU environment belonged to the ST11-KL64 clone. Their antibiotic resistance genes profile and virulence genes profile were similar to ST11-KL64 CRKP-fc (Figure 1). This suggests that ST11-KL64 CRKP may cause nosocomial infection outbreaks.

Figure 1 Virulence genes, antimicrobial resistance genes, capsular serotype and MLST of 46 Fecal colonization of CRE strains and 2 environmental CRE strains. The different MLST and capsular serotype were color-coded and illustrated at the tips. The occurrence of antimicrobial resistance genes and virulence genes were also color-coded.

Phylogenetic Analysis of Colonized CRKP

To gain a deeper understanding of the homology of these strains, we conducted whole-genome sequencing and core-genome phylogenetic analysis(Figure 2). The phylogenetic tree identified two major clades, each belonging to the same ST; specifically, cluster 1 corresponding to ST11, cluster 2 to ST15(Figure 2, Fifure 1).

The results showed that the colonized ST11 CRKP strains dominated and formed a single cluster(Cluster 1) in ICU wards, indicating clonal expansion. These ST11 strains mainly contained KL64 capsular serotypes and a few other capsular serotypes(Fifure 1). WYZHKP101 and WYZHKP102 isolated from the ICU environment were ST11-KL64 clones belonging to Cluster 1. This suggests that ST11-KL64 CRKP has emerged as the most prevalent colonized carbapenem-resistant K. pneumoniae and may contribute to the outbreak of nosocomial infection. While ST15 K. pneumoniae was identified as the second most prevalent colonized CRKP clone in ICU wards after ST11 K. pneumoniae. These ST15 strains contained only one capsule serotypes, KL19. This suggests that ST15-KL19 CRKP formed a single cluster(Cluster 2) may also contribute to the outbreak of nosocomial infection.

Figure 2 Minimum-spanning tree of cgMLST profiles among 46 Fecal colonization of CRE strains and 2 environmental CRE strains. The minimum-spanning tree was generated based on cgMLST analysis with 2358 conserved genome-wide genes. A cluster was defined at a distance of ≤15 alleles.

CRE has recently aroused an extremely severe health challenge and public concern worldwide for its high morbidity and mortality rate.^{2, 30} Fecal colonization of CRE is one of the risk factor for CRE infection in hospitalized patients.³¹ Screening fecal colonization of CRE in ICU wards can contribute to better infection control measures to limit CRE dissemination. This prospective observational study was aimed to investigate the molecular epidemiological characteristics and homology analysis of fecal colonization of CRE in ICU wards from a university hospital in China.

This study showed that the overall prevalence of CRE-fc in ICU wards was 12.6% (55/435). The predominate CRE-fc was CRKP, accounting for 83.6% (46/55). In different studies around the world, the prevalence of CRE in fecal specimen varied from country to country。Some studies had a lower prevalence of CRE-fc than the present study^32-35, while others had a higher prevalence of CRE-fc.^{36, 37} The prevalence of CRE-fc varied from country to country could be explained by: (1) differences in CRE colonization rate in different regions; (2) inconsistency of disease type; (3) differences in detection methods; and (4) differences in the level of health care.

Irrational use of antibiotics and cross infection of patients in the hospital setting may lead to the high prevalence of CRE-fc. This study showed that active screening fecal colonization of CRE(CRE-fc) and IPC interventions could reduce the CRE infection rate in ICU wards. A 3-year prospective study in China suggested that active rapid molecular screening and other IPC interventions may significantly reduce CRE nosocomial infections even in wards without enough single-room isolation.²¹ A prospective study in South Korea suggested that active surveillance testing for carbapenem-resistant, gram-negative bacteria may reduce its acquisition in clinical specimens in the ICU without additional costs.³⁸ An Israeli study showed that active screening and implementation of interventions led to a 34% reduction in CRE carriage over 3 years.³⁹ What is the reason for the decrease in CRE infection rates through active screening and IPC interventions? The phylogenetic tree identified two major clades , each belonging to the same ST; specifically, cluster 1 corresponding to ST11, cluster 2 to ST15. This study showed that the colonized ST11 CRKP strains dominated and formed a single cluster(Cluster 1) in ICU wards, indicating clonal expansion. WYZHKP101 and WYZHKP102 isolated from the ICU environment were ST11-KL64 clones belonging to Cluster 1. This suggested that the high rate of CRE infection in ICU wards is largely due to the clonal spread of CRE from patient to patient and from environment to patient. Exploring the molecular epidemiological characteristics and homology analysis of fecal colonization of CRE in ICU wards can provide evidence for CRE transmission, which is of great value for better application of infection control measures and reduction of CRE infection rates.

This study showed that the predominate CRE-fc was CRKP, accounting for 83.6% (46/55). Some studies showed that carbapenem-resistant Klebsiella pneumoniae (CRKP) account for 60%–90% of clinical CRE infections in the United States, Europe, and China.^3-5 Meanwhile, some studies showed that colonization of CRE was dominated by CRKP.^{7, 8} This suggested that CRKP was dominant in both clinical CRE infection and intestinal colonization of CRE. In this study, we further performed phenotypic and genomic analysis of 46 CRKP to prevent the spread of nosocomial infection.

With the widespread clinical use of carbapenems, the resistance of enterobacteriaceae to carbapenems, particularly CRKP, has become increasingly serious in China.^{40, 41} In recent years, an alternating trend of subclones has been observed among the prevalent ST11 CRKP strains in China, with a significant increase in KL64 and a significant decrease in KL47.^{6, 42, 43} ST11-KL64 CRKP carries a series of virulence genes associated with high pathogenicity, resulting in higher mortality in infected patients.⁴² In summary, there are many studies on the molecular epidemiological characteristics of CRKP in clinical infection, but few studies on the molecular epidemiological characteristics of fecal colonization of CRKP. This study showed that ST11-KL64 CRKP has emerged as the most prevalent CRKP-fc and may contribute to hospital outbreaks of infection. This finding is consistent with clinical infection of ST11-KL64 CRKP as the most prevalent CRKP.

The limitations of this study are the single-center study and the small number of strains. The study demonstrates the need for further studies on the relationship between fecal colonization of CRE and clinical infection of CRE.

The prevalence of fecal colonization of CRE(CRE-fc) in ICU wards was 12.6%(55/435), and CRKP was the main type of CRE-fc (83.6%, 46/55). Phylogenetic analysis showed clonal spread of CRKP among patients in ICU wards. ST11-KL64 CRKP has emerged as the most prevalent fecal colonization of CRKP and may contribute to hospital outbreaks of infection. Active screening fecal colonization of CRE(CRE-fc) and IPC interventions can reduce the CRE infection rate in ICU wards.

Ethics Approval

This study was approved by the Medical Ethics Council of Shanghai Fifth People’s Hospital (Approval No. 10, 2022). We confirm that all adult participants gave their informed consent. The research was conducted in accordance with the Declaration of Helsinki.

Disclosure

The authors report no conflicts of interest in this work.

Funding

This study was supported by the Outstanding Young Medical Technical Talents and Pharmaceutical Talents Training Program supported by Health Commission of Minhang District, Shanghai (No. MWYJYX04).

Author Contribution

HZ carried out the experiments and wrote the paper. CZ performed the results analysis and wrote the paper. MSX collected clinical information of patients. CMS performed the DNA sequencing. YL and FS designed the experiments and revised the manuscript. All authors contributed to the article and approved the submitted version.

Acknowledgement

We extend our thanks to Sangon Biotechnology Co., Ltd. Shanghai, China, for the support of whole-genome sequencing and the prediction of coding DNA sequences in the genome.

Soontaros S, Leelakanok N. Association between carbapenem-resistant Enterobacteriaceae and death: A systematic review and meta-analysis. Am J Infect Control. 2019;47:1200–12. 10.1016/j.ajic.2019.03.020.
Murray CJL, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, Han C, Bisignano C, Rao P, Wool E, et al. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet. 2022;399:629–55. 10.1016/S0140-6736(21)02724-0.
Guh AY, Bulens SN, Mu Y, Jacob JT, Reno J, Scott J, Wilson LE, Vaeth E, Lynfield R, Shaw KM, et al. Epidemiology of Carbapenem-Resistant Enterobacteriaceae in 7 US Communities, 2012–2013. JAMA. 2015;314:1479–87. 10.1001/jama.2015.12480.
Grundmann H, Glasner C, Albiger B, Aanensen DM, Tomlinson CT, Andrasevic AT, Canton R, Carmeli Y, Friedrich AW, Giske CG, et al. Occurrence of carbapenemase-producing Klebsiella pneumoniae and Escherichia coli in the European survey of carbapenemase-producing Enterobacteriaceae (EuSCAPE): a prospective, multinational study. Lancet Infect Dis. 2017;17:153–63. 10.1016/S1473-3099(16)30257-2.
Zhang R, Liu L, Zhou H, Chan EW, Li J, Fang Y, Li Y, Liao K, Chen S. Nationwide Surveillance of Clinical Carbapenem-resistant Enterobacteriaceae (CRE) Strains in China. EBioMedicine. 2017;19:98–106. 10.1016/j.ebiom.2017.04.032.
Hu F, Pan Y, Li H, Han R, Liu X, Ma R, Wu Y, Lun H, Qin X, Li J, et al. Carbapenem-resistant Klebsiella pneumoniae capsular types, antibiotic resistance and virulence factors in China: a longitudinal, multi-centre study. Nat Microbiol. 2024;9:814–29. 10.1038/s41564-024-01612-1.
Yan L, Sun J, Xu X, Huang S. Epidemiology and risk factors of rectal colonization of carbapenemase-producing Enterobacteriaceae among high-risk patients from ICU and HSCT wards in a university hospital. Antimicrob Resist Infect Control. 2020;9:155. 10.1186/s13756-020-00816-4.
Mekonnen Y, Solomon S, Gebreyohanns A, Teklu DS, Ayenew Z, Mihret A, Bonger ZT. Fecal Carriage of Carbapenem Resistant Enterobacterales and Associated Factors Among Admitted Patients in Saint Paul's Hospital Millennium Medical College, Addis Ababa, Ethiopia. Infect Drug Resist. 2023;16:6345–55. 10.2147/IDR.S418066.
Giufre M, Ricchizzi E, Accogli M, Barbanti F, Monaco M, Pimentel DAF, Farina C, Fazii P, Mattei R, Sarti M, et al. Colonization by multidrug-resistant organisms in long-term care facilities in Italy: a point-prevalence study. Clin Microbiol Infect. 2017;23:961–7. 10.1016/j.cmi.2017.04.006.
Gorrie CL, Mirceta M, Wick RR, Edwards DJ, Thomson NR, Strugnell RA, Pratt NF, Garlick JS, Watson KM, Pilcher DV, et al. Gastrointestinal Carriage Is a Major Reservoir of Klebsiella pneumoniae Infection in Intensive Care Patients. Clin Infect Dis. 2017;65:208–15. 10.1093/cid/cix270.
Dutcher L, Lautenbach E. A Deeper Dive: Implications of Identifying More of the Carbapenem-Resistant Enterobacteriaceae Iceberg. J Infect Dis. 2020;221:1743–5. 10.1093/infdis/jiz290.
Lin Q, Wang Y, Yu J, Li S, Zhang Y, Wang H, Lai X, Liu D, Mao L, Luo Y, et al. Bacterial characteristics of carbapenem-resistant Enterobacteriaceae (CRE) colonized strains and their correlation with subsequent infection. BMC Infect Dis. 2021;21:638. 10.1186/s12879-021-06315-0.
Bradley N, Lee Y. Practical Implications of New Antibiotic Agents for the Treatment of Carbapenem-Resistant Enterobacteriaceae. Microbiol Insights. 2019;12:1690429841. 10.1177/1178636119840367.
Bush K, Bradford PA. Epidemiology of beta-Lactamase-Producing Pathogens. Clin Microbiol Rev. 2020;33. 10.1128/CMR.00047-19.
Nordmann P, Poirel L. The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin Microbiol Infect. 2014;20:821–30. 10.1111/1469-0691.12719.
Lutgring JD, Limbago BM. The Problem of Carbapenemase-Producing-Carbapenem-Resistant-Enterobacteriaceae Detection. J Clin Microbiol. 2016;54:529–34. 10.1128/JCM.02771-15.
Salomao MC, Freire MP, Boszczowski I, Raymundo SF, Guedes AR, Levin AS. Increased Risk for Carbapenem-Resistant Enterobacteriaceae Colonization in Intensive Care Units after Hospitalization in Emergency Department. Emerg Infect Dis. 2020;26:1156–63. 10.3201/eid2606.190965.
Yi J, Kim KH. Identification and infection control of carbapenem-resistant Enterobacterales in intensive care units. Acute Crit Care. 2021;36:175–84. 10.4266/acc.2021.00409.
Kang JS, Yi J, Ko MK, Lee SO, Lee JE, Kim KH. Prevalence and Risk Factors of Carbapenem-resistant Enterobacteriaceae Acquisition in an Emergency Intensive Care Unit in a Tertiary Hospital in Korea: a Case-Control Study. J Korean Med Sci. 2019;34:e140. 10.3346/jkms.2019.34.e140.
Shimasaki T, Segreti J, Tomich A, Kim J, Hayden MK, Lin MY. Active screening and interfacility communication of carbapenem-resistant Enterobacteriaceae (CRE) in a tertiary-care hospital. Infect Control Hosp Epidemiol. 2018;39:1058–62. 10.1017/ice.2018.150.
Yang S, He L, Li K, Yu X, Ni L, Hu L, Guo J, Biskup E, Tang L, Wu W. Efficacy of Active Rapid Molecular Screening and IPC Interventions on Carbapenem-Resistant Enterobacterales Infections in Emergency Intensive Care Units without Enough Single-Room Isolation. Infect Drug Resist. 2023;16:1039–48. 10.2147/IDR.S396331.
Liang Q, Chen J, Xu Y, Chen Y, Huang M. Active surveillance of carbapenem-resistant gram-negative bacteria to guide antibiotic therapy: a single-center prospective observational study. Antimicrob Resist Infect Control. 2022;11:89. 10.1186/s13756-022-01103-0.
Yeaman MR, Yount NY. Mechanisms of antimicrobial peptide action and resistance. Pharmacol Rev. 2003;55:27–55. 10.1124/pr.55.1.2.
Wick RR, Judd LM, Gorrie CL, Holt KE, Unicycler. Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput Biol. 2017;13:e1005595. 10.1371/journal.pcbi.1005595.
Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, et al. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS ONE. 2014;9:e112963. 10.1371/journal.pone.0112963.
Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9. 10.1093/bioinformatics/btu153.
Zhou C, Zhang H, Xu M, Liu Y, Yuan B, Lin Y, Shen F. Within-Host Resistance and Virulence Evolution of a Hypervirulent Carbapenem-Resistant Klebsiella pneumoniae ST11 Under Antibiotic Pressure. Infect Drug Resist. 2023;16:7255–70. 10.2147/IDR.S436128.
Pu D, Zhao J, Lu B, Zhang Y, Wu Y, Li Z, Zhuo X, Cao B. Within-host resistance evolution of a fatal ST11 hypervirulent carbapenem-resistant Klebsiella pneumoniae. Int J Antimicrob Agents. 2023;61:106747. 10.1016/j.ijantimicag.2023.106747.
Guidelines for the Prevention and Control of Carbapenem-Resistant Enterobacteriaceae. Acinetobacter baumannii and Pseudomonas aeruginosa in Health Care Facilities. Geneva: World Health Organization; 2017.
Zhang Y, Wang Q, Yin Y, Chen H, Jin L, Gu B, Xie L, Yang C, Ma X, Li H, et al. Epidemiology of Carbapenem-Resistant Enterobacteriaceae Infections: Report from the China CRE Network. Antimicrob Agents Chemother. 2018;62. 10.1128/AAC.01882-17.
Zhu R, Xu X, Lian S, Cai M, Zhang H, Chen X, Cao Y. Intestinal Colonization with Carbapenem-Resistant Enterobacteriaceae in Acute Leukemia Patients: Risk Factors and Molecular Characteristics. Infect Drug Resist. 2022;15:4275–83. 10.2147/IDR.S376413.
Liu Q, Liu L, Li Y, Chen X, Yan Q, Liu WE. Fecal Carriage and Epidemiology of Carbapenem-Resistant Enterobacteriaceae Among Hospitalized Patients in a University Hospital. Infect Drug Resist. 2019;12:3935–42. 10.2147/IDR.S233795.
Ogunbosi BO, Moodley C, Naicker P, Nuttall J, Bamford C, Eley B. Colonisation with extended spectrum beta-lactamase-producing and carbapenem-resistant Enterobacterales in children admitted to a paediatric referral hospital in South Africa. PLoS ONE. 2020;15:e241776. 10.1371/journal.pone.0241776.
Xu Q, Pan F, Sun Y, Wang C, Shi Y, Zhang T, Yu F, Zhang H. Fecal Carriage and Molecular Epidemiology of Carbapenem-Resistant Enterobacteriaceae from Inpatient Children in a Pediatric Hospital of Shanghai. Infect Drug Resist. 2020;13:4405–15. 10.2147/IDR.S275549.
Chu W, Hang X, Li X, Ye N, Tang W, Zhang Y, Yang X, Yang M, Wang Y, Liu Z, et al. Bloodstream Infections in Patients with Rectal Colonization by Carbapenem-Resistant Enterobacteriaceae: A Prospective Cohort Study. Infect Drug Resist. 2022;15:6051–63. 10.2147/IDR.S383688.
Jaiswal SR, Gupta S, Kumar RS, Sherawat A, Rajoreya A, Dash SK, Bhagwati G, Chakrabarti S. Gut Colonization with Carbapenem-resistant Enterobacteriaceae Adversely Impacts the Outcome in Patients with Hematological Malignancies: Results of A Prospective Surveillance Study. Mediterr J Hematol Infect Dis. 2018;10:e2018025. 10.4084/MJHID.2018.025.
Mohan B, Prasad A, Kaur H, Hallur V, Gautam N, Taneja N. Fecal carriage of carbapenem-resistant Enterobacteriaceae and risk factor analysis in hospitalised patients: A single centre study from India. Indian J Med Microbiol. 2017;35:555–62. 10.4103/ijmm.IJMM_17_144.
Jung J, Park JH, Yang H, Lim YJ, Kim EO, Lim CM, Kim MN, Jo MW, Yun SC, Kim SH. Active surveillance testing to reduce transmission of carbapenem-resistant, gram-negative bacteria in intensive care units: a pragmatic, randomized cross-over trial. Antimicrob Resist Infect Control. 2023;12:16. 10.1186/s13756-023-01222-2.
Schwaber MJ, Carmeli Y. An ongoing national intervention to contain the spread of carbapenem-resistant enterobacteriaceae. Clin Infect Dis. 2014;58:697–703. 10.1093/cid/cit795.
Wang M, Earley M, Chen L, Hanson BM, Yu Y, Liu Z, Salcedo S, Cober E, Li L, Kanj SS, et al. Clinical outcomes and bacterial characteristics of carbapenem-resistant Klebsiella pneumoniae complex among patients from different global regions (CRACKLE-2): a prospective, multicentre, cohort study. Lancet Infect Dis. 2022;22:401–12. 10.1016/S1473-3099(21)00399-6.
Yang ZQ, Huang YL, Zhou HW, Zhang R, Zhu K. Persistent carbapenem-resistant Klebsiella pneumoniae: a Trojan horse. Lancet Infect Dis. 2018;18:22–3. 10.1016/S1473-3099(17)30627-8.
Zhou K, Xiao T, David S, Wang Q, Zhou Y, Guo L, Aanensen D, Holt KE, Thomson NR, Grundmann H, et al. Novel Subclone of Carbapenem-Resistant Klebsiella pneumoniae Sequence Type 11 with Enhanced Virulence and Transmissibility, China. Emerg Infect Dis. 2020;26:289–97. 10.3201/eid2602.190594.
Zhou K, Xue CX, Xu T, Shen P, Wei S, Wyres KL, Lam M, Liu J, Lin H, Chen Y, et al. A point mutation in recC associated with subclonal replacement of carbapenem-resistant Klebsiella pneumoniae ST11 in China. Nat Commun. 2023;14:2464. 10.1038/s41467-023-38061-z.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
21 Oct, 2024
Editor assigned by journal
18 Oct, 2024
Submission checks completed at journal
18 Oct, 2024
First submitted to journal
18 Oct, 2024

You are reading this latest preprint version

Active screening and Molecular Epidemiology Characteristics of fecal colonization of Carbapenem resistance Enterobacterales from Intensive Care Units wards in a Tertiary Hospital in Shanghai, China

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Study Design

Antimicrobial Susceptibility Testing

Whole Genome Sequencing and Bioinformatics Analysis

IPC Interventions and effect evaluation

Statistical Analysis

Results

Fecal Carriage of Carbapenem-Resistant Enterobacterales

Molecular characterization of carbapenemase genes

Active screening of CRE-fc and IPC interventions reduce the CRE infection rate in ICU wards

The Antimicrobial Resistance Profile of 46 Carbapenem-Resistant K. pneumoniae

The Distribution of Antibiotic Resistance Genes, Virulence Genes, MLST and Capsular Serotypes

Phylogenetic Analysis of Colonized CRKP

Discussion

Conclusion

Declarations

Ethics Approval

Disclosure

Funding

Author Contribution

Acknowledgement

References

Additional Declarations

Status:

Version 1