Evaluation of biofilm formation in molecular identification E.coli strains that cause urinary tract infection in children and antibiotic resistance

doi:10.21203/rs.3.rs-5291421/v1

Download PDF

Research Article

Evaluation of biofilm formation in molecular identification E.coli strains that cause urinary tract infection in children and antibiotic resistance

https://doi.org/10.21203/rs.3.rs-5291421/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Escherichia coli is the primary causative agent of urinary tract infections (UTIs), which are among the most common illnesses in humans and frequently occur in children. Because this bacterium has biofilm formation and multi-drug resistance, and other factors, managing these infections is getting harder. The purpose of this study is to identify the E. coli strains that cause UTIs in children, and study the correlation of biofilm formation, and antibiotic resistance of E coli isolates found in Diyala, Iraq.

Patients and Methods:

It was collected 290 cases of UTI patients from Al-Batoul Teaching Hospital in Diyala, Iraq. The ages of these patients from 1 day to 12 years who were treated in the Paediatrics Department from February 2023 to January 2024. It was identify the strains of E. coli that cause UTIs by using PCR and sequencing methods and evaluated antimicrobial susceptibility of them by means of the Kirby-Bauer technique. The microtiter-plate assay were used to assess the production of biofilms.

Results

The predominant bacteria responsible for UTI in children were E. coli (40%), and it was showed that are the lowest persentage of bacteria causing UTI in this study are Klebsiella oxytoka and Psuedomonas aureginosa as appeared in 5% of cases. It was identify the strains of E. coli that cause UTI in the current study, which are E. coli Y8-2 (14.8%), E. coli 106K88 (19.3%), E. coli UA32 (11.4%), E. coli RM11911 (20.5%), and E. coli EC1704-1 (34%). E. coli EC1704-1 showed multidrug-resistant (MDR) to ciprofloxacin (100%), sulfamethoxazole-trimethoprim (100%), cephalosporins and penicillin (100%), and aminoglycosides (93.3%). E. coli Y8-2, E. coli 106K88, and E. coli UA32 appeared less resistant to antibiotics related to E. coli EC1704-1 and E. coli EC1704-1. In addition, it was shown that biofilm formation and antimicrobial resistance correlated negatively among the isolates, strong biofilm production strains were found in less resistant strains and weak in multidrug resistant strains.

Conclusion

E. coli is the predominant cause of UTI in children and it was identified the E coli strains which are the most common strains that cause UTI in Diyala, Iraq. This research highlights the dissemination of resistance in E. coli strains in Diyala, Iraq. The evident correlation between biofilm and resistance suggests a resistance cost on bacterial cells, and that strains with lower resistance may depend on biofilms to enhance their survival. This emphasizes the importance of considering biofilm formation ability during the treatment of E.coli infections to avoid therapeutic failure and infection recurrence.

16SrRNA

Escherichia coli strains

antibiotic resistance

Urinary tract infection

Biofilm formation

Urinary tract infections (UTIs) are the most common recognised bacterial infections, infecting 150 million persons annually around the world and often seen in children. Understanding the underlying infections and their patterns of antibiotic resistance in certain regions is crucial for providing the best possible care [1,2]. UTIs can cause short-term complications include fever, painful urination, lower abdomen discomfort, and may lead to irreversible kidney scarring [3]. Urinary tract infection is more prevalent in women than in males due to the close physical proximity of the urethra to the gastrointestinal hole. UTIs are sometimes inappropriately treated with antibiotics, especially in rural and small-town areas where urine culture testing is not available, leading to increased drug resistance [4]. Screening for susceptibility of the bacteria in each city is critical for producing essential data for antibiotic resistance [5,6]. UTI problems mostly involve kidney failure caused by severe renal damage and sepsis, which results from the infection spreading beyond the lower urinary tract to other areas of the body. Uncomplicated urinary tract infections (UTIs), such as acute uncomplicated cystitis and acute uncomplicated pyelonephritis, are common causes for seeking medical advice from a general practitioner in industrialized nations. These infections are often treated with antibiotics. Sensitivity analysis assesses the efficacy of antibiotics on isolated bacteria cultures. Antibiotic susceptibility testing is a crucial tool for doctors to select appropriate medications for patients with urinary tract infections [5]. The frequency of antibiotic resistance in E. coli causing UTIs in children in primary care is significant. Thus, it is crucial to analyze the treatment usage and antibiotic resistance patterns of bacteria in UTI patients. Various risk factors for UTI in children were identified, such as sex, ethnicity, vesicoureteral reflux, neurogenic bladder, phimosis, structural anomalies of the lower urinary tract, constipation, and the presence of LUTS. Several Lower Urinary Tract Symptoms (LUTS) such as urinary retention, increased residual urine volume, infrequent voiding, and delaying voiding have been linked to Urinary Tract Infections (UTI) [7]. In newborns, urinary tract infection might present with nonspecific symptoms such as poor feeding, diarrhea, failure to grow, vomiting, moderate jaundice, lethargy, fever, and hypothermia. In certain instances, UTI can progress to neonatal sepsis. Infants under 2 years old with UTI may have non-specific symptoms include fever, gastrointestinal issues such as vomiting, diarrhea, abdominal discomfort, or urine with a strong odor. In children older than 2 years, cystitis or pyelonephritis may present with typical symptoms. Pyelonephritis symptoms might include high fever, chills, and costovertebral discomfort and soreness. Children often urinate more frequently than adults due to their smaller bladders and higher fluid intake in proportion to their body size [8]. Escherichia coli is the predominant bacterium responsible for causing urinary tract infections in children. E. coli strains possess several genes encoding various virulence factors that significantly contribute to the bacteria's pathogenicity. The severity of a urinary tract infection depends on the virulence gene characterization of the invading E. coli strain. [9,10]. In addition, antimicrobial resistance (AMR) has become a major threat to world health. More than 2.8 million cases of antibiotic-resistant infections happen each year in the US alone, which kill more than 35,000 people every year (5). It is expected that AMR will cause 10 million deaths by the year 2050 [6,7]. The broad distribution of antibiotics urinary tract pathogen with resistance, such as E. coli, is driven by the widespread use of antibiotics for the treatment of UTIs [8]. Afterward, the course of treatment of UTIs has been increasingly difficult as a result of the multidrug-resistant (MDR), particularly in those suffering from repeated UTIs [9]. It was reported that pathogenic strains of E. coli are growing increasingly resistant to many antibiotic classes, such as β-lactams, tetracyclines, and fluoroquinolones, aminoglycosides, and trimethoprim-sulfamethoxazole [10, 11]. One characteristic that hinders the removal of bacteria during antibiotic therapy is biofilm development on biological surfaces. 3-dimensional multicellular biofilms are arranged groups that have the ability to adhere to both abiotic and biological surfaces and are coated with an extracellular polymeric substance [12,13]. E.coli cells may produce biofilms inside and on the surface of catheters [3, 14, 15]. Certain characteristics are peculiar to certain biofilms and are absent from among free-living cells, such as enhanced resistance to

nutritional deficits, pH variations, and other external stresses

both the emergence of host immunity and the substances that fight bacteria [4]. In-depth investigation into the connection the relationship between biofilm and antibiotic resistance incongruous results on forming capability.

Biofilm generation has been shown to improve resistant bacterium by a number of methods, including decreased expansion and reduced spreading rate of antimicrobials [14, 16]. On the other hand, some research revealed that bacterial cells that are resistant to antibiotics face a significant fitness cost, which could diminish their ability to form biofilms formation capacity. Biofilms might work independently of process, mostly used, for bacterial resistance by sensitive isolates as a method of surviving [17,18]. However, a lack of an obvious connection between resistance to antibiotics and ability to build biofilms

was documented [19,20]. Testing for antibiotic susceptibility is often carried out on planktonic cells without in terms of their capacity to create biofilms. A significant distinction in the sensitivity between implanted biofilms cells, as well as planktonic cells, that are part of the reports of the same strain exist [21,22]. When collectively, these Observations emphasise how crucial it is to take biofilm formation capacity into account as an essential bacterial factor in the treatment strategy for UTIs [23,24]. Hence, it is crucial to identify the E. coli strains responsible for UTIs in order to determine the most effective therapy for this illness in children and the corelation between antibiotic resistance and biofilm formation in Diyala, Iraq.

Bactreial isolation and identification

It was collected 290 urine samples of children for cultures and sensitivity from February 2023 to January 2024. Information on age and gender were recorded. The study was done at the Paediatric department of Al-Batoul Teaching Hospital, Diyala province, Iraq. The clinical urine specimens were taken from the midstream and catheter-aspirated urine of individuals who had been diagnosed with urinary tract infections. Prior to the start of antimicrobial therapy. Positive urine cultures were defined as having a bacterial count of at least 105 CFU/mL [25]. The colonial morphology on a variety of culture media, such as blood agar, MacConkey agar (Oxoid, USA), and Cysteine Lactose Electrolyte Deficient (CLED) agar (Oxoid, USA), was used to first identify the isolated bacteria. Gram staining was also employed in this process. A number of common biochemical tests (methyl red test, KIA test, Vogues Proskauer test, indole test, citrate test, and urease test) were used to further validate the identification of E. coli [26]. Furthermore, using Matrix-Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF\MS) (MALDI Biotyper®, Bruker Daltonics, Germany), a dependable method for highly accurate bacterial identification, the identities of representative isolates of positively identified E. coli were verified [27]. For long-term preservation, the isolates were then kept in tryptic soy broth (TSB) supplemented with 20% glycerol at -80°C.

Antimicrobial susceptibility testing (AST)

It was tested the isolates' susceptibility to antibiotics by following the guidelines provided by the Clinical and Laboratory Standards Institute (CLSI 2020). It was determined how susceptible the isolates were to nineteen different antimicrobial drugs across thirteen different categories. Azithromycin, nitrofurantoin, tetracycline, chloramphenicol, imipenem, meropenem, cefozolin, cefuroxime, cefotaxime, ciprofloxacin, ceftazidime, gentamicin, amikacin, trimethoprim-sulfamethoxazole, aztreonam, ampicillin, and amoxicillin-clavulanic acid were among the agents employed in the Kirby-Bauer disc diffusion method. Classified isolates as multi-drug resistant (MDR) if they exhibited resistance to at least three antimicrobial classes. The method previously outlined [28] was used to calculate the multiple antibiotic resistance (MAR) indexes.

Molecular methods for E. coli detection

Using 16S-R and 16S-F primers, 16S rRNA was amplified by polymerase chain reaction (PCR), and molecular detection was applied to all 88 E. coli isolates. DNA was extracted from E. coli samples and then subjected to PCR analysis using the identified gene. The gene was amplified by polymerase chain reaction (PCR) using primers specific to 16S rRNA. F (AGAGTTTGATCCTGGCTCAG) and R (TACGGTTACCTTGTTACGACTT) were the primers used. This was followed by the verification of the amplified target genes using agarose gel electrophoresis [10,11].

DNA Sequencing

The amplified gene product was purified using a Sanger sequencing ABI3730XL for DNA sequencing before being delivered to the Macrogen Corporation in Korea for additional study. After receiving the data via email, powerful software was used to analyse it and identify the different strains of E. coli [12, 13].

Biofilm formation assay

As previously mentioned, the 96-well microtiter plate assay was used to assess the isolates' ability to produce biofilms [29]. Luria Bertani (LB) broth was used as the medium, and bacterial suspensions were shaken and cultured at 37°C for 18 to 24 hours. Subsequently, the suspensions were diluted 1: 100 to a final level of 200 µL in M63 medium containing 0.25% glucose. The inoculated microtiter plates were then incubated for 48 hours at 30°C without shaking. Sterile phosphate-buffered saline (PBS) was used to wash the wells after the culture was removed. Biofilms were dried at 65°C for ten minutes, then cleaned with PBS and dyed with 2% crystal violet (CV). Thereafter, 33% glacial acetic acid was used to dissolve the adhering CV, and to calculate the biofilm production capacity, the optical density at 580 nm (OD580) was measured using a microplate reader (SunriseTM, TECAN, Switzerland). The medium that was not inoculated acted as a negative control. The experiment was run in duplicate. The cutoff value (ODc) was determined as three standard deviation units over the average absorbance of the sterile media, as previously mentioned [30]. The isolates were then divided into four categories: moderate biofilm-producing isolates (2ODc ≥ OD ≤ 4ODc), strong biofilm-producing isolates (OD ≥ 4ODc), weak biofilm-producing isolates (ODc ≥ OD ≤ 2ODc), and non-biofilm-producing isolates (OD ≤ ODc) [31].

Statistical analysis

In order to do statistical analysis, the Graphpad Prism program (Graphpad, California, United States) was utilized. Analysis of variance (ANOVA) was performed in either a one-way or two-way fashion in order to compare the groups for the investigations.

Isolation and Identification of E.coli

In order to confirm an initial clinical diagnosis of urinary tract infection, urine samples were collected from 290 pediatric patients ranging in age from 0 to 12 years old. These samples were cultured immediatly. Among male and female patients who were suspected of having a urinary tract infection (UTI), the percentages of confirmed UTI were 93 (32.1%) and 197 (67.9%), respectively, and it can seen the numbers of female with UTI are more increased than in male as shown in Fig. 1. According to the findings of the current study, the incidence of infections was significantly greater in female patients compared to male patients. Similary, it was reported that the same prevalence in male and female within the first year of age and increased the UTI infection in female compare with male after the first year of live [14]. In addition, it was shown during this study that the risk ages for UTI are after 8 years old, and this data similar to the other studies were reported that UTIs are believed to be caused by a shorter distance between the anus (the typical source of uropathogens) and the urethral meatus, the longer length of the male urethra, and the antibacterial activity of prostatic fluid in males [15]. This condition is more widespread in the female population that is young and middle-aged.

In addition, the patients were divided into 4 age groups, and the results appear that the percentage of infection was increased in the ages from 8 to 12 years old (49.7%), and decreased within first years of age as shown in Fig. 2. It was shown that both gender and age of the patients had a significant impact on the prevalence of the condition.

This study aimed to identify the strains of E.coli that cause UTI in children and the antibiotic sensitivity pattern of these isolates and to provide recommendations about antibiotics for use in pediatric patients who were admitted to the Pediatric department of Al-Batoul Teaching Hospital, which is a care hospital located in Baquba, Iraq, In addition, the current study aimed to determine the correlation between their antibiotic resistance and biofilm formation. Several bacteria that causes UTI in children and it was chosen E. coli for antimicrobial susceptibility testing and molecular identification due to the high percentage of this bacterium to cause UTI.

The results of this study showed that there are six different types of bacteria were caused UTI in children and the most common bacteria that cause this infection are E coli 88 (40%), and then Klebsiella pneumoniae 60 (27.3%) and Proteus spp 38 (17.3%). It was appeared that Staphylococcus saprophyticus, Kebsiella oxytoka and Psuedomonas aureginosa have the lowest percentage of bacteria to cause UTI in children as appeared in 12 (5.4%), 11 (5%) and 11 (5%), respectively of cases. as shown in Fig. 3.

Molecular detection and sequencing

In this study, molecular identification of E. coli was done using 16SrRNA that amplified via PCR by using the spesific primers and the results showed amplified 1500 bp PCR product as the same size with target gene as shown in Fig. 4.

In order to determine the strains of E. coli which are responsible for urinary tract infections (UTIs), the PCR products were purified and then sent for sequencing. According to the findings, there are several strains of this bacteria that cause urinary tract infections in children, which are E. coli Y8-2 13 (14.8%), E. coli 106K88 (19.3%), E. coli UA32 (11.4%), E. coli RM11911 (20.5%), and E. coli EC1704-1 (34%) as shown in Fig. 5.

In accordance with the findings of earlier research, which revealed that E. coli was present in 75–90% of UTI isolates, it was demonstrated that E. coli was the bacterium that caused the majority of UTIs and molecular identification for the E. coli isolates was done using 16S rRNA that is the housekeeping gene of most types of bacteria [21,22,23], thus these findings are essential due to identify the strains of this bacterium which leads to control and prevention of this infection in children.

Antibiotic susceptibility and biofilm formation of E.coli strains

Furthermore, the antibiotic sensitivity test was done for E. coli strains, which are the most frequent causes of UTI in children and the results showed that E. coli EC1704-1 and E.coli RM11911were multi drug resistant, which showed resistant against most of the tested antibiotices. How ever, E.coli Y8-2, E.coli106K88, and E.coli UA32 appeared less resistant against the antibiotics that were used in this study compare with the first two strains as shown in Table 1. The antibiotic sensitivity test was done for E. coli strains, and the results showed that E. coli EC1704-1 and E.coli RM11911were multi drug resistant, which showed resistant against most of the tested antibiotices. However, E.coli Y8-2, E.coli106K88, and E.coli UA32 appeared less resistant against the antibiotics that were used in this study. It is possible that this is due to the fact that the route of medication administration is simple, as well as the fact that bacteria in the juvenile population are sensitive to antibiotics. Because of the nature of antibiotics and treatment recommendations for the route of drug administration in children, almost all of the medications were given intravenously [16,17]. This may have been the basis for the medication administration. Before deciding on a treatment plan for urinary tract infections (UTIs), it is strongly recommended to do an antibiotic sensitivity test. It is the only method to ensure that the treatment plan remains on track, and it should be carried out on a regular basis in order to monitor the development of antibiotic resistance in the various clinical settings used. Target gene mutations and the acquisition of resistance genes by mobile genetic elements such integrons and plasmids, which can confer co-resistance to many antimicrobial agents [32,33], are the primary causes of antimicrobial resistance. Additionally, biofilm formation offers a further defence mechanism that allows the encased bacterial cells to evade harsh ambient conditions and the damaging effects of antimicrobial agents [34]. A potential link between acquired antimicrobial resistance and virulence has been suggested by the fact that both virulence and antimicrobial resistance genes can be transferred together through plasmids or other transferable genetic elements, in addition to the ability of acquired resistance, such as fluoroquinolone (FQ) resistance, to influence gene expression among resistant isolates [16].

Table 1

Percentages of antibiotic resistance (%) of *E. coli* strains that isolated from UTI patients against the tested antibiotics.
Antibiotic category	Antimicrobial agent	E.coli Y8-2	E.coli 106K88	E.coli UA32	E.coli RM11911	E.coli EC1704-1
Non-Extended spectrum cephalosporin	Cefazolin cefuroxime	0.00 0.00	5.9 47	0.00 10	77.8 83.3	100 100
Extended spectrum cephalosporin	Cefotaxime ceftazidime	7.7 0.00	11.8 11.8	10 10	83.3 72.2	100 93.3
Fluoroquinolones	ciprofloxacin	0.00	0.00	10	100	100
Folate pathway inhibitors	Trimethoprim-sulfamethoxazole	30.8	41.2	0.00	100	100
Aminoglycosides	Gentamicin Amikacin	15.4 7.7	47.1 5.9	40 10	83.3 100	93.3 93.3
Carbapenems	Imipenem Meropenem	0.00 0.00	5.9 0.00	20 0.00	83.3 44.4	83.3 50
Monobactams	Aztreonam	15.4	5.9	0.00	55.6	66.7
Penicillins	Ampicillin	23.1	41.2	70	100	100
Penicillin-Betalactamase inhibitor	Amoxicillin- clavulanic acid	23.1	5.9	0.00	100	100
Phenicols	Chloramphenicol	0.00	0.00	20	33.3	50
Tetracycines	Tetracycine	7.7	29.4	20	55.6	16.7
Macrolide	Azithromycin	7.7	11.8	0.00	11.1	33.3
Nitrofurans	Nitrofurantoin	0.00	5.9	10	22.2	16.7

Biofilm formation was done for E.coli strains that identified in this study, the 96-well microtiter plate assay, the gold standard for estimating the biofilm formation capacity, was used to assess the biofilm formation capacity of E coli strains in M63 broth [31]. The strains were then separated into three groups including, weak, moderate, and strong. Of the strains, E.coli EC1704-1 and E.coli RM11911 created weak biofilms, E. coli UA32 produced moderate biofilms, and E. coli 106K88 and E. coli Y8-2 produced strong biofilms.

It was analysed the distribution of resistance phenotypes in respect to biofilm development categories in order to determine whether resistance to antibiotics and biofilm formation are associated. According to our research, two strains that met the criteria for being strong biofilm formers were not multi-drug resistant, whereas the remaining 3 strains showed moderate and weak biofilm formation. All of the strains that had weak develop biofilms appeared multi-drug resistant. According to this distribution, strains with high resistance tended to manufacture weaker biofilms, whereas stronger biofilm formers were associated with a lower likelihood of becoming multi-drug resistant. This correlation was found to be statistically significant (P < 0.0001).

It was shown in this study that the biofilm formation is negatively correlated with antibiotic resistance. It has previously been documented that the biofilm-forming ability of uropathogenic E.coli is negatively impacted by acquired antibiotic resistance [35]. Similarly, Poursina and colleagues [36] found that multi-drug resistance (MDR) isolates were found in negative and weak biofilm-producing UPEC isolates, but non-MDR isolates made up 69.2% of the strong biofilm-producing isolates. The biofilm architecture uses a number of surface appendages, including as fimbriae, as well as additional non-fimbrial proteins, as a supporting framework. The expression of these organelles may be impacted by the development of antibiotic resistance, which would be detrimental to the ability to create biofilms [31]. Similarly, it has been previously observed that the acquisition of genes producing ESBL enzymes negatively affects the ability of E. coli and Pseudomonas aeruginosa build biofilms [37]. This implies that biofilm formation is a method that helps bacteria to get better survival, especially with bacteria less antibiotic resistant and this may be due to the reduced exposure to multiple antibiotics [31,38]. All of these findings support the theory that uropathogenic to E.coli isolates' ability to form biofilms is negatively impacted by the development of antibiotic resistance.

Within the pediatric population, E. coli is the most important bacteria that causes urinary tract infections (UTIs), and it was found that the UTI occur in female more than in males spescially in the ages after 8 years old. In addition, it was determined the E coli strains that cause UTI and they are E. coli Y8-2 (14.8%), E. coli 106K88 (19.3%), E. coli UA32 (11.4%), E. coli RM11911 (20.5%), and E. coli EC1704-1 (34%). It was shown in this study that there is a negative correlation between antibiotic resistant phenotype and biofilm formation capacity. The findings of this study contribute to more understanding of the pathogenic potential of E. coli strains that can lead to severe cases of UTIs. Furthermore, it was recommended more studies about the identified E. coli strains in this study to control and prevention of this infection and reduce its complications. In addition, it should identify the regulation of biofilm formation genes in these bacteria in the present of antibiotics.

Acknowledgements The authors gratitude to the members of the Paediatric department of Al-Batoul Teaching Hospital, a healthcare facility in Diyala city, Iraq and the members of the Molecular Biology Laboratory in the department of microbiology, college of medicine, University of Diyala, Diyala, Iraq for their efficient collaboration. Also, the authors would like to thank University of Diyala (جامعة ديالى – University of Diyala – UOD) Diyala, Iraq for its support to complete this work.

Author contributions All authors contributed equally in writing— original draft preparation, all authors have read and agreed to the published version of the manuscript.

Funding This study was done using self funding and without any other funding.

Data availability No Data associated in the manuscript.

Ethics approval and consent to participate The study protocol was approved by the ethical committee of the Paediatric department of Al-Batoul Teaching Hospital, a healthcare facility, Diyala, Iraq. The study was conducted and samples were collected after receiving approval from the University of Diyala/ College of Medicine’s research tasks and ethics committee on January 1, 2023 (Ref.: 2024ASM878). This study involved the E.coli’s from patients who are suffering from UTI at Paediatric department of Al-Batoul Teaching Hospital, Diyala province, Iraq. All authors agree to publish this work.

Research involving human participants and/or animals This study involved the E. coli’s from patients who are suffering from Urinary tract infection at Al-Batoul Teaching Hospital, Diyala, Iraq.

Informed consent All patients gave their written informed consents before inclusion, written informed consent has been obtained from the patient(s) to publish this paper.

Competing interests The authors declare no competing interests.

Flores-Mireles AL, Walker JN, Caparon M, & Hultgren SJ (2015) Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nature reviews microbiology 13: 269-284. https://doi.org/10.1038/nrmicro3432.
Malik MN, Saeed MF, Komal T, Akhter MK, Zulfiqar T, & Ahmad S (2021) Frequency of Common Causative Organisms of Urinary Tract Infection in Children with Acute Febrile Illness. Age (years) 5: 2-83.
Lee ALH, Leung ECM, Lee MKP, & Lai RWM (2021) Diagnostic stewardship programme for urine culture: impact on antimicrobial prescription in a multi-centre cohort. Journal of Hospital Infection, 108: 81-89. https://doi.org/10.1016/j.jhin.2020.10.027.
Al-Zahrani JM, Aldiab A, Aldossari KK, Al-Ghamdi S, Batais MA, Javad S, Nooruddin S, Zahid N, Razzak HA, & El-Metwally A (2019) Prevalence of Prediabetes, Diabetes and Its Predictors among Females in Alkharj, Saudi Arabia: A Cross-Sectional Study. Annals of global health 85: 109. https://doi.org/10.5334/aogh.2467.
Ahmed SS, Shariq A, Alsalloom AA, Babikir IH & Alhomoud BN (2019) Uropathogens and their antimicrobial resistance patterns: Relationship with urinary tract infections. International journal of health sciences 13: 48–55.
Darwich N, Samaha, Al Nuqaidan H, Tassi A, and Fawaz M (2020) Surveillance Of Multidrug-Resistant Uropathogenic Escherichia Coli In Hospitalized Patients And Community Settings In The South Of Lebanon, Bau Journal - Health and Wellbeing 3: 5.
https://doi.org/10.54729/2789-8288.1051.
Sood S & Gupta R (2012) Antibiotic resistance pattern of community acquired uropathogens at a tertiary care hospital in Jaipur, Rajasthan. Indian journal of community medicine 37: 39-44. https://doi.org/ 10.4103/0970-0218.94023.
Mori R, Lakhanpaul M, & Verrier-Jones K (2007) Diagnosis and management of urinary tract infection in children: summary of NICE guidance. Bmj 335: 395-397. https://doi.org/10.1136/bmj.39286.70089.
Zdziarski J, Svanborg C, Wullt B, Hacker J, & Dobrindt U (2008) Molecular basis of commensalism in the urinary tract: low virulence or virulence attenuation?. Infection and immunity 76: 695-703. https://doi.org/10.1128/iai.01215-07.
Yun KW, Kim HY, Park HK, Kim W, & Lim IS (2014) Virulence factors of uropathogenic Escherichia coli of urinary tract infections and asymptomatic bacteriuria in children. Journal of MicrobiologyImmunology and Infection 47: 455-461. https://doi.org/10.1016/j.jmii.2013.07.010.
Motib AS, Al-Bayati FA, Manzoor I, Shafeeq S, Kadam A, Kuipers OP, ... & Yesilkaya H (2019) TprA/PhrA quorum sensing system has a major effect on pneumococcal survival in respiratory tract and blood, and its activity is controlled by CcpA and GlnR. Frontiers in cellular and infection microbiology 9: 326.https://doi.org/10.3389/fcimb.2019.00326.
Jassim SH, & Motib AS (2021) Evaluation of Biofilm Formation in Klebsiella Pneumoniae and Antibiotic Resistance. Indian Journal of Forensic Medicine & Toxicology 15: 2. https://doi.org/10.37506/ijfmt.v15i2.14901.
Jameel NH, Motib, AS, & Athab AM (2020) Molecular detection of Helicobacter pylori and its association with vitamin B12 deficiency. Biochemical & Cellular Archives 20: 1. https://doi.org/10.35124/bca.2020.20.1.55.
Saleh RM, & Motib AS (2023) Molecular detection of OprD and ExoA in Pseudomonas aeruginosa and antibiotics resistance. In AIP Conference Proceedings 2475:1. https://doi.org/10.1063/5.0103074.
Tullus K & Shaikh N (2020) Urinary tract infections in children. The Lancet 395: 1659-1668. https://doi.org/10.1016/S0140-6736(20)30676-0.
Renko M, Salo J, Ekstrand M, Pokka T, Pieviläinen O, Uhari M & Tapiainen T (2022) Meta-analysis of the risk factors for urinary tract infection in children. The Pediatric infectious disease journal 41:787-792. https://doi.org/10.1097/INF.0000000000003628.
Joya M, Aalemi AK, & Baryali AT (2022) Prevalence and Antibiotic Susceptibility of the Common Bacterial Uropathogen Among UTI Patients in French Medical Institute for Children. Infection and Drug Resistance 15: 4291–4297. https://doi.org/10.2147/IDR.S353818.
Alanazi MQ, Alqahtani FY & Aleanizy FS (2018) An evaluation of E. coli in urinary tract infection in emergency department at KAMC in Riyadh, Saudi Arabia: retrospective study. Ann Clin Microbiol Antimicrob 17: 3. https://doi.org/10.1186/s12941-018-0255-z.
Shaji S, Vinayakumar ST, & Shaji S (2021) A Study on Antibiotic Sensitivity Pattern in Children Hospitalized for Urinary Tract Infection in a Tertiary Care Hospital in South India. Indian Journal of Pharmacy Practice 14:174-179.
Qadir S, Memon S, Chohan MN & Memon Y (2021) Frequency of Vitamin-D deficiency in children with Urinary tract infection: A descriptive cross-sectional study. Pakistan journal of medical sciences 37: 1058–1062. https://doi.org/10.12669/pjms.37.4.3896.
Gondim R, Azevedo R, Braga AANM, Veiga ML & Barroso Jr U (2018) Risk factors for urinary tract infection in children with urinary urgency. International braz j urol 44: 378-383. https://doi.org/10.1590/S1677-5538.IBJU.2017.0434.
Azeez AJ & Kamel FH (2022). Molecular detection of static magnetic field forces on uropathogenic Escherichia coli number and fermentation activities. Diyala Journal of Medicine 23: 152-161. https://doi.org/10.26505/djm.v23i2.955.
Hameed ZR, Motib AS & Abbas AF (2021) Adaptability of Biofilm Formation in Streptococcus Pneumoniae to Various Growth Conditions. Indian Journal of Forensic Medicine & Toxicology 15: 3594-3599. https://doi.org/10.37506/ijfmt.v15i2.14931.
Nordoff J (2.21) Patient-centred prescribing, autonomy and concordance. Journal of Paramedic Practice 13: 272-274. https://doi.org/10.12968/jpar.2021.13.7.272.
Tohi Y, Fujiwara K, Harada S, Matsuda I, Ito A, Yamasaki M, … Sugimoto M (2021) Positive Culture Prior to Transperineal Prostate Biopsy Was Not Associated with Post-Biopsy Febrile Urinary Tract Infection Development. Research and Reports in Urology 13: 691–698. https://doi.org/10.2147/RRU.S333724.
Hasan ARS, Al-Azawi ZH, & Asa'd R (2015) Microbial contamination associated with computer keyboards and mouse devices in Diyala University. Diyala Journal of Medicine 8: 66-72.
Topić Popović N, Kazazić SP, Bojanić K, Strunjak-Perović I, Čož-Rakovac R (2023) Sample preparation and culture condition effects on MALDI-TOF MS identification of bacteria: A review. Mass Spectrom Rev. https://doi.org/10.1002/mas.21739.
Adzitey F, Yussif S, Ayamga R, Zuberu S, Addy F, Adu-Bonsu G, ... & Kobun R (2022) Antimicrobial susceptibility and molecular characterization of Escherichia coli recovered from milk and related samples. Microorganisms 10: 1335.https://doi.org/10.3390/microorganisms10071335.
Ballén V, Gabasa Y, Ratia C, Sánchez M, Soto S (2022) Correlation between antimicrobial resistance, virulence determinants, and biofilm formation ability among extraintestinal pathogenic Escherichia coli strains isolated in Catalonia, Spain. Front Microbiol 11: 803862. https://doi.org/10.3389/fmicb.2021.803862.
Stepanović S, Vuković D, Hola V, Bonaventura GD, Djukić S, Ćirković I & Ruzicka F (2007) Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. Apmis 115: 891-899. https://doi.org/10.1111/j.1600-0463.2007.apm_630.x.
Poursina F, Sepehrpour S, & Mobasherizadeh S (2018) Biofilm formation in nonmultidrug-resistant Escherichia coli isolated from patients with urinary tract infection in Isfahan, Iran. Advanced Biomedical Research 7: 40. https://doi.org/ 10.4103/abr.abr_116_17.
Shariff VAAR, Shenoy MS, Yadav T, & MR (2013) The antibiotic susceptibility patterns of uropathogenic Escherichia coli, with special reference to the fluoroquinolones. Journal of clinical and diagnostic research : JCDR, 7: 1027–1030. https://doi.org/10.7860/JCDR/2013/4917.3038.
Kadry AA, Serry FM, El-Ganiny AM, & El-Baz AM (2017) Integron occurrence is linked to reduced biocide susceptibility in multidrug resistant Pseudomonas aeruginosa. British Journal of Biomedical Science 74: 78–84. https://doi.org/10.1080/09674845.2017.1278884.
Stewart PS (2002) Mechanisms of antibiotic resistance in bacterial biofilms. International Journal of Medical Microbi ology 292: 107-113. https://doi.org/10.1078/1438-4221-00196.
Yamane T, Enokida H, Hayami H, Kawahara M, Nakagawa M (2011) Genome-wide transcriptome analysis of f luoroquinolone resistance in clinical isolates of Escherich ia coli. International Journal of Urology 19: 360-368. https://doi.org/10.1111/j.1442-2042.2011.02933.x.
Qi L, Li H, Zhang C, Liang B, Li J, Wang L, ... & Song H (2016) Relationship between antibiotic resistance, biofilm formation, and biofilm-specific resistance in Acinetobacter baumannii. Frontiers in microbiology 7: 483. https://doi.org/10.3389/fmicb.2016.00483.
Soto SM, Smithson A, Martinez JA, Horcajada JP, Mensa J, Vila J (2007) Biofilm formation in uropathogenic Escherichia coli strains: Relationship with prostatitis, uro virulence factors and antimicrobial resistance. The Journal of Urology. 177: 365–368. https://doi.org/10.1016/j.juro.2006.08.081.
Gallant CV, Daniels C, Leung JM, Ghosh AS, Young KD, Kotra LP, & Burrows, LL (2005) Common β‐lactamases inhibit bacterial biofilm formation. Molecular microbiology 58: 1012-1024. https://doi.org/10.1111/j.1365-2958.2005.04892.x.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluation of biofilm formation in molecular identification E.coli strains that cause urinary tract infection in children and antibiotic resistance

Status:

Version 1

Abstract

Background

Patients and Methods:

Results

Conclusion

Figures

Introduction

Patients and methods

Bactreial isolation and identification

Antimicrobial susceptibility testing (AST)

DNA Sequencing

Biofilm formation assay

Statistical analysis

Results

Molecular detection and sequencing

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1