Aaptamine Counteracts Statin-Induced PCSK9 Elevation to Improve LDL Receptor Expression and Cholesterol Uptake

doi:10.21203/rs.3.rs-5292389/v1

Download PDF

Research Article

Aaptamine Counteracts Statin-Induced PCSK9 Elevation to Improve LDL Receptor Expression and Cholesterol Uptake

https://doi.org/10.21203/rs.3.rs-5292389/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Atherosclerosis arises from lipid accumulation and plaque formation, primarily driven by elevated levels of LDL-cholesterol (LDL-C). PCSK9 plays a critical role by degrading LDL receptors (LDL-R), which are responsible for the clearance of LDL-C from the bloodstream. Consequently, inhibiting PCSK9 represents a promising strategy to enhance LDL-R expression and promote LDL-C uptake. Statins are commonly used to treat high cholesterol by decreasing the production of cholesterol. However, they also raise PCSK9 levels, which may explain why some patients don't respond as well as they should to statins. Aaptamines, marine alkaloids with notable structural diversity and bioactivity, are known to regulate gene transcription. This study aimed to evaluate the effects of aaptamine in mitigating the statin-induced increase in PCSK9 expression, LDL-R levels, and LDL-C uptake. Cytotoxicity was assessed using the MTS assay for simvastatin, aaptamine, and their combination. PCSK9 mRNA levels were quantified by real-time PCR, while protein expression was analyzed via western blotting. Immunohistochemistry was employed to assess LDL-R levels and LDL-C uptake in liver cells. The results demonstrated that simvastatin significantly upregulated PCSK9 gene expression. However, co-treatment with aaptamine reduced PCSK9 expression by 94–61%. Additionally, aaptamine enhanced LDL-R protein levels and LDL-C uptake by 3.21-fold in cells co-treated with simvastatin. These results suggest that aaptamine lowers the rise in PCSK9 caused by statins and raises the expression of LDL-R, which helps liver cells get rid of LDL-C.

Atherosclerosis

PCSK9

Statin

Aaptamine

LDL-C

Marine Natural Compound

Higher total cholesterol levels have been linked to an increased risk of mortality from cardiovascular disease (CVD) (Mattiuzzi et al., 2020). Cardiovascular diseases (CVDs) encompass conditions such as hypertension, coronary heart disease, stroke, heart failure, and peripheral vascular disease. Statins are highly effective drugs for lowering lipid levels and are commonly prescribed for primary and secondary cardiovascular disease prevention (Talayero & Sacks, 2011). Statins are potent pharmaceuticals that effectively reduce cholesterol levels by explicitly targeting the overexpression of SREBP2, leading to an increase in both PCSK9 and LDLR transcription. Due to the presence of the SRE-1 motif in both the PCSK9 and LDLR promoter regions, the upregulation of SREBP2 by statins leads to an increase in the transcription of both PCSK9 and LDLR (Lee et al., 2021). Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a serine protease produced in the liver (Seidah et al., 2003). PCSK9 acts as a natural inhibitor of LDL receptors (LDLR) and regulates protein binding. Studies of their structures have shown that PCSK9 and LDLR interact directly. This stops LDLR from recycling, which causes it to break down in lysosomes (Habsah Mohamad et al., 2020). In liver cells, LDLR is responsible for the uptake of LDL-C from the bloodstream (P. F. Lebeau et al., 2022). Having more PCSK9 expression makes statins less effective at lowering LDL-C levels because higher PCSK9 levels stop statins from lowering cholesterol (Choi et al., 2017).

The maritime environment, which is still largely unexplored for potential medicinal uses, is home to a diverse range of creatures, including sponges and seaweeds, that coexist peacefully under challenging environmental circumstances (Nadar et al., 2022). Aaptamines become a special class of marine alkaloids that have drawn a lot of attention from researchers in many different fields due to their diverse biological activities and unique structural diversity (Chabowska et al., 2021), which include antioxidant (Habsah Mohamad et al., 2009) enzymatic inhibition (N. Utkina et al., 2021), antiviral (Rashid et al., 2018), anti-cancer (Nadar et al., 2022), Prior research has demonstrated that aaptamine enhances the transcriptional activity of the peroxisome proliferator response element (PPRE) found in the promoters of the target genes (N N Kamaruddin et al., 2022; Habsah Mohamad et al., 2017). However, to date, no fundamental studies have been carried out to investigate the effects of cotreatment of statin and aaptamine in regulating PCSK9, LDL-R, and expression, and LDL-C uptake by liver cells as well as to elucidate the molecular mechanisms of aaptamine in reducing PCSK9 and increasing LDL-R gene expression, as well as inducing the LDL-C uptake by liver cells by attenuating the inducible effects of statin on PCSK9.

Therefore, a fundamental study needs to be carried out to address that gap, precisely to determine the effects of cotreatment of aaptamine and statin on PCSK9 and LDL-R gene expression and uptake of LDL-C, to elucidate transcription factors that mediate the action of aaptamine in attenuating statin effects on PCSK9.

Cytotoxicity screening using MTS cell proliferation assay

The CellTiter 96™ AQueous One Solution Cell Proliferation Assay used as previously reported method (Chaudhry et al., 2021a; Chaudhry et al., 2021b). Aaptamine, simvastatin, and their cotreatment were tested for in vitro cytotoxicity on HepG₂ cells.

A single treatment of aaptamine (25 µg/mL) in a 1% (v/v) DMSO was also prepared, and 5 µL of aaptamine was then loaded into the wells separately, in triplicates. For cotreatment, Aaptamine (at a serial dilution of 3.125-25 µg/mL) in the presence of 10 µM simvastatin in a 1% (v/v) DMSO was prepared and 5 µL of each diluted respective solution was then loaded into the wells, separately, in triplicates. Cells treated with 1% (v/v) of DMSO served as the negative control, while wells with complete medium alone without any cells served as the background. After the treatment, the microplate was incubated for 24 hours at 37°C, 5% (v/v) CO₂ in 95% humidity. After 24 hours of incubation, 20 µL of MTS solution was added into each well, followed by 4 hours of additional incubation at 37°C in a 5% (v/v) CO₂ incubator. Cell viability was measured at 490 nm with a Spark multifunctional microplate reader.

Quantitative Real-time PCR

HepG₂ cells were used to extract total cellular RNA, which was then lysed using a TRIzol reagent from ThermoFisher. The real-time polymerase chain reaction (qPCR) was conducted using the iTaq™ Universal SYBR™ Green One-Step Kit (Bio-Rad) master mix, following the instructions provided by the manufacturer. The gene primers utilised in this investigation are given in Table 1. Each reaction consisted of 150 nanograms of RNA treated with DNase, 10 millilitres of a 2x SYBR™ Green qPCR reaction mix from BIORAD, 0.6 millilitres of 10 millimolar concentrations of both the forward and reverse primers (as listed in Table 1), 0.25 millilitres of iScript reverse transcriptase for one-step qPCR, and nuclease-free water to bring the total reaction volume to 20 millilitres. The samples were each run three times. The One-step Real-Time PCR was performed using the CFX6 Real-Time PCR Detection System (Bio-Rad). The mRNA Cts of the target were standardised using the housekeeping gene β-actin (Jack et al., 2021).

Table 1

The nucleotide sequences of forward and reverse primers used in RT-PCR (Jack et al., 2021).
Primer	Oligos	Sequences (5’-3’)
PCSK9	Forward	GGCAGGTTGGCAGCTGTTT
	Reverse	CGTGTAGGCCCCGAGTGT
β-actin	Forward	TCACCCTGAAGTACCCCATC
	Reverse	CCATCTCTTGCTCGAAGTCC

Protein Extraction and Western Blot Analysis

The investigation entailed retrieving cytoplasmic proteins from HepG2 cells utilising the NE-PER Nuclear and Cytoplasmic Extraction Kit according to the manufacturer's instructions. The quantification of proteins was carried out utilising the Bradford Assay, which assessed the concentration of cytoplasmic proteins employing a Quick Start™ Bradford 1x dye reagent and a bovine serum albumin (BSA) protein standard set. The SPARK multifunctional microplate reader device measured the absorbance at 590 nm. A 10% (v/v) resolving gel and a 5% (v/v) stacking gel were used for SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The transfer of proteins from gels to membranes was accomplished by utilising Bio-Rad Trans-Blot™ Turbo™ Transfer System RTA Transfer Kits. The presence of protein bands was identified using the Pierce™ DAB (3,3'-diaminobenzidine tetrahydrochloride)) Substrate Kit. The density values of the target protein bands were analysed using ImageJ software.

LDL-C uptake and Immunofluorescence staining of LDLR and PCSK9

The LDLR's uptake of LDL-C was evaluated using an LDL uptake assay kit (Abcam™). The kit used a fluorescent probe to measure LDL uptake into cultured cells—human LDL coupled to DyLight™ 550. A secondary antibody coupled to DyLight™ 488 and an LDL receptor-specific polyclonal antibody was used as previously described method (Jack et al., 2021). Briefly, The 96-well plate's culture media was removed when the aaptamine, simvastatin 24-hour treatment was finished and replaced with 100 µL/well of LDL-Dylight™ 550 working solution. the LDL-DyLight™ 550 working solution was produced by diluting the substance 1:100 with MEM culture media. Similarly, for PCSK9, the rabbit anti-LDLR and anti-PCSK9 primary antibodies, as well as the goat anti-rabbit IgG secondary antibody conjugated to DyLight ^TM 488, were diluted separately with TBST in a ratio of 1:100 to create the antibody solutions. Finally, FITC-labelled LDLR and PCSK9 was seen and recorded by a Nikon Eclipse Ti2-E fluorescence microscope at emission and excitation 485/535 nm.

Statistical Analysis

The analyses were conducted three times for each sample, and the findings were averaged. The data were assessed using the analysis of variance and Duncan's New Multiple Range Test procedures within the statistical analysis system (SAS, 1985).

MTS Assay

We used the HepG₂ cell line from human hepatocellular carcinoma in this study. It was crucial to confirm that aaptamine did not exhibit cytotoxic activity toward these cells. To this end, we employed the MTS assay to evaluate the cytotoxic effects of aaptamine on HepG₂ cells. Figure 1a illustrates the percentage of cell growth across varying treatment concentrations. Cell viability was measured using the MTS assay, revealing that simvastatin led to a minimum growth of approximately 80% at a concentration of 0.5µM, while at 10µM, the growth rate increased to around 106%. The highest cell viability, 128%, was observed with lovastatin at a concentration of 6 µM. These findings indicate that none of the compounds tested, including simvastatin, lovastatin, and aaptamine, exhibited cytotoxicity in a dose-dependent manner up to a concentration of 10 µM. Then, we co-treated simvastatin 10µM with a serial dilution of aaptamine (3.125 µg/mL to 25µg/mL). The percentage of cell growth for cotreatment at all concentrations was above 80% (Fig. 1b). The single treatment of aaptamine (25µg/mL) also showed no cytotoxicity on HepG₂ cells when treated for 24 hours. Moreover, aaptamine showed cytotoxicity on the CEM-SS cell line with the IC₅₀ value (IC₅₀ 15.03µg/mL) (Shaari et al. 2009). However, our results are like Habsah Mohamad et al. (2017), reported that aaptamine did not show cytotoxicity on HepG₂. Similarly, Mullen et al. (2010) treated cell with simvastatin at 10µM with no cytotoxicity observed in the HepG₂ cells.

Aaptamine suppresses the expression of the PCSK9 gene in HepG ₂ cells.

As shown in Fig. 2a, aaptamine significantly reduced the PCSK9 mRNA expression at all concentrations as compared to that of untreated control. At the concentration of 3.125 µg/mL, aaptamine produced the maximum level of reduction at 99% of control. By contrast, when the cells were treated with 10 µM simvastatin, the mRNA expression of PCSK9 was increased significantly by 2.9-fold than that of untreated control. Interestingly, when the cells were cotreated with simvastatin and aaptamine (at concentrations of 3.125- 25µg/mL), the mRNA expression of PCSK9 was significantly decreased than that of untreated control with 12.5µM aaptamine produced the lowest levels of PCSK9 mRNA at 94% to that of control. The results indicate that aaptamine attenuated the inhibitory effect of statin on the gene expression of PCSK9.

Aaptamine attenuates the effect of statin on the protein expression of the PCSK9 in HepG ₂ cells.

Treatment with 20 µM of berberine sulfate (BBR) followed a notable decline in the relative protein levels of both premature and mature PCSK9 compared to the control group that did not receive any treatment. 10 µM Simvastatin did not produce any significant change in premature PCSK9 protein expression. In contrast, It was demonstrated that when the cells were treated with simvastatin 2.5 µM and 5.0 µM, the level premature PCSK9 protein expression was significantly increased than that of untreated control between 68% and 50%. (Fig. 2b). However, the mature protein expression of PCSK9 was significantly downregulated between 40–56% when treated with aaptamine. Interestingly, there was a 4-fold increase in mature PCSK9 protein expression as compared to the untreated control. However, 10 µM Simvastatin did not produce any significant change in premature PCSK9 protein expression. When HepG₂ cells were treated with a combination of simvastatin and aaptamine, the protein expression of both premature and mature PCSK9 was significantly downregulated as compared to the respective controls. Specifically, co-treatment with simvastatin and aaptamine significantly decreased the PCSK9 mature protein expression between 84% and 51% than that of untreated control with co-treatment with 6.25 µg/mL aaptamine produced the lowest levels of PCSK9. Aaptamine at 12.5 µg/mL and 25 µg/mL reduced to 81% and 80% of control, respectively. Premature PCSK9 protein expression was downregulated dose-dependently during the cotreatment, ranging from 28–53%. Aaptamine alone significantly downregulated the protein expression of both premature and mature PCSK9 (Fig. 2c) as compared to the untreated control. The premature protein expression of PCSK9 was drastically decreased than that of untreated control between 94% and 82%, with aaptamine 6.25 µg/mL and 12.5 µg/mL producing the lowest levels at 94%whereas aaptamine at 3.125 µg/mL and 25 µg/mL reduced premature PCSK9 protein level to 82% and 87%, respectively.

Aaptamine enhances the LDL-C uptake and upregulates LDLR expression while downregulating PCSK9 expression.

Aaptamine attenuates the action of statin in inducing the uptake of LDL-C. Aaptamine attenuates the action of statin in inducing the uptake of LDL-C. To determine the effects of co-treatment of aaptamine and statin on the levels of LDL receptor (LDLR) protein, HepG₂ cells were treated either with a single treatment of simvastatin (10 µM), aaptamine (3.125- 25µg/mL), and co-treatment of simvastatin with different concentrations of aaptamine.

As shown in Fig. 3a, immunohistochemistry staining with an antibody against LDLR demonstrated the intensity of FITC-stained HepG₂ cells was higher in cells treated with aaptamine as compared to untreated control indicating the amount of LDLR presence on the cell surface was increased in aaptamine-treated cells. Specifically, aaptamine increased the level of LDLR protein by 1.84-fold at 3.125 µg/ml and gradually decreased, however, still higher than to that of control by 1.25-fold at the highest concentration used (25 µg/ml). Interestingly, the level of LDLR protein presence on the cell surface of HepG₂ cells was slightly increased as compared to control by 1.16-fold When treated with statin which was still lower than to that of aaptamine-treated cells. When the cells were treated in combination with statin and aaptamine, it was found that co-treatment significantly increased the amount of LDLR protein on cell surface at all concentrations. The highest level of LDLR protein was found when 3.125 µg/ml of aaptamine was used in the co-treatment with 2.36-fold increase relative to control, followed by 6.28 µg/ml with 2.28-fold increase, 12.5 µg/ml at with 2.17-fold increase, and 25 µg/ml with 1.52-fold increase as compared to untreated control. As expected, the intensity of FITC-stained HepG₂ cells shows that there was a significant dose-dependent decrease in the amount of PCSK9 protein on the surface of HepG₂ cells treated with aaptamine with the lowest level of 39% to that of untreated control at 12.5 µg/ml. Simvastatin significantly increased the PCSK9 protein level by 1.48-fold which corresponds to the levels of mRNA and total protein content. Interestingly, in the co-treated cells, aaptamine attenuated an inducible effect of statin of the amount of cell surface PCSK9 (Fig. 3b). The lowest amount of PCSK9 protein was found when the cells were co-treated with statin and 25 µg/ml aaptamine of which the level of PCSK9 protein was reduced by 43% as compared to untreated control. However, it was still relatively higher than to that of aaptamine alone.

The As shown in Figs. 3a and 3c, there was a strong corresponding change of LDLR expression with the uptake of LDLC. There was a significant increase on LDLC uptake when the cells were treated individually with either aaptamine and statin with the inducible effect of statin was still lower than to that of aaptamine. Co-administration of simvastatin combined with aaptamine and statin resulted an increase in the uptake of LDLC, higher than to that of either with aaptamine or statin alone, reaching the highest rate of 3.21-fold increase when cells were exposed to statin and 6.25 µg/ml aaptamine. in the most pronounced cellular staining with LDL-DyLight™ 550, as evidenced by the maximum intensity of yellow fluorescence observed after 24 hours. A single administration of aaptamine resulted in a greater intensity of stained cells compared to the untreated control, but a lower intensity compared to cells that were co-treated. ImageJ analysis revealed that the levels of LDL-C absorption reached a peak of 221% (3.21 folds) when the cells were exposed to SA 6.25. On the other hand, the application of At the highest rate of LDLC uptake was 1.73-fold and XX-fold increase as compared to untreated control when cells were treated with aptamine 25 µg/mL aapatmine and 10 mM statin, respectively. treatments resulted in a 73.84% increase (1.73 folds) in LDL-C uptake compared to the untreated control. The BBR treatment resulted in a 52.06% increase in LDL-C uptake, which corresponds to a 1.52-fold increase, as shown in Fig. 3c. The qualitative and quantitative analysis revealed that in treatment with aaptamine, the appearance of a yellow signal in the treated cells was more vivid and intense compared to the untreated control. This suggests an augmentation in the uptake of LDL-C by HepG₂ cells.

Atherosclerosis continues to be the leading cause of death in Malaysia and globally (Y. Andriani et al., 2019). The development and advancement of atherosclerotic plaque begin with the deposition of oxidized low-density lipoprotein cholesterol (LDL-C) in the subendothelial space, prompting cholesterol uptake by macrophages, which subsequently transform into lipid-laden foam cells. (Lusis 2000; Nurjannatul Naim Kamaruddin et al., 2021). It was demonstrated that at all concentrations, aaptamine significantly reduced the level of mRNA expression of PCSK9. In contrast, statin significantly increase the PCSK9 mRNA levels which was attenuated when aaptamine was co-introduced into the cells. It was well demonstrated that statin significantly raised the level of cell surface PCSK9 (Dong et al., 2019; Kim et al., 2020). It is in an agreement with this study, demonstrated that Statin was shown to increase the levels of mRNA expression of both PCSK9 and LDLR via increasing the binding (Dubuc G et al., 2004). The cells were treated with statin, the mRNA expression of PCSK9 was increased significantly to that of untreated control to almost 3-fold. Although, SRE is also present in LDLR promoter, but an increase in PCSK9 limits an increase in hepatic LDLR protein levels caused by statin, thus, may lead to a potentially undesirable constraint to statin therapeutic efficacy in lowering circulating LDL-C (S. Wang et al., 2019). Interestingly, when the cells were cotreated with simvastatin and aaptamine (concentration of 3.125- 25µg/mL), the mRNA expression of PCSK9 was decreased than to that of untreated control. These results were corroborated by Mohamad et al. (2020), that found aaptamine decreased PCSK9 promoter activity dose-dependently. Therefore, it is vital to investigate the role of aaptamine in attenuating the effects of statin in regulating the expression of PCSK9 and in inducing the expression of LDLR and LDLC uptake by liver cells These findings show that aaptamine may function as a PCSK9 inhibitor critical in preserving or raising the quantity of LDLR on the cell surface to promote LDL-C uptake. Evidence demonstrated that fenofibrate, a ligand for the peroxisome proliferator-activated receptor α (PPARα), reduces the amount of PCSK9 mRNA and protein in the liver of wild-type mice (Lambert et al., 2006). Furthermore, it has been demonstrated that the activation of PPARα inhibits the induction of PCSK9 by statins through the suppression of PCSK9 promoter activity (Kourimate et al., 2008). It was discovered that fractions derived from Acaudina molpadioides could decrease the activity of the promoter and the expression of PCSK9 mRNA (Jack et al., 2021). N-(2,3-dihydro-1H-inden-2-yl)-2-methoxybenzamide, a compound derived from methylbenzoate found in Acanthaster planci, was shown to suppress the transcriptional activity of PCSK9 in HepG₂ cells (Nurjannatul Naim Kamaruddin et al., 2021). Z. Yang et al. (2019) showed that fucoidan, derived from the brown seaweed Ascophyllum nodosum, significantly upregulates the expression of PPARα in the liver and ultimately enhances the transfer of lipids from plasma to the liver by activating SR-B1 and LDLR, while deactivating PCSK9. Additionally, it stimulates lipid metabolism by activating PPARα, LXRβ, ABC transporters, and CYP7A1 (Z. Yang et al., 2019).

In our study, statin treatment decreased premature PCSK9 protein expression but increased mature PCSK9 protein expression by 4-fold. When co-treated with simvastatin and aaptamine together, both premature and mature PCSK9 protein expressions were significantly downregulated. A single treatment of aaptamine significantly downregulated the protein expression of both premature and mature PCSK9 compared to the untreated control. PCSK9 undertakes autocatalytic cleavage during its maturation process in the endoplasmic reticulum (ER) After being synthesised in the liver, mature PCSK9 is promptly released into the bloodstream (P. F. Lebeau et al., 2022). An increase in cell surface LDLR was accompanied by an increase in LDLC uptake by liver cells when the cells were co-treated with aaptamine and statin]. Various other compounds were also demonstrated enhanced LDLC uptake via upregulating LDLR and downregulating PCSK9 Chae et al. (2018) reported, when HepG₂ cells were exposed to sauchinone, it increased the levels of LDLR mRNA, the synthesis of LDL-receptor protein, and the uptake of LDLC into the cells. The augmentation of PCSK9 levels also led to an increase in the LDLR protein's degradation rate. Some statins are known to elevate plasma PCSK9 levels, which partially reduces the impact of statins on LDLR expression (Chae et al., 2018).

The results aligned with our hypothesis that aaptamine may have a possible hypolipidemic effect by regulating PPARα. Furthermore, the ability of alkaloid aaptamine to suppress the release of PCSK9 increased its attraction. Aaptamine appeared to have a more pronounced impact than simvastatin in regulating the production of PCSK9. The findings indicate that aaptamine can potentially reduce the breakdown of LDLR by preventing the release of PCSK9. Consequently, it helps to maintain high amounts of LDLR on the surface of the liver and lowers the amount of non-HDL cholesterol in the bloodstream. Since in vitro research cannot accurately represent a living organism's conditions, further study of the above conclusions using animal investigations is necessary.

Ethical Approval

Not applicable

Consent to Participate

Not applicable

Consent to Publish

All authors have consent to publish

Author’s Contributions

AM Manuscript drafting, experiment analysis. GSC. Manuscript drafting, review, analysis. Y.Y.S. and T.T.S. review and offered valuable insights. All reviewed and checked the final draft of the manuscript.

Funding

The research is funded by the Fundamental Research Grant Scheme, Ministry of Higher Education Malaysia (FRGS/1/2021/STG01/ UMT/01/1).

Competing Interests

The authors declare that they have no conflict of interest.

Availability of data and materials

Yes, available upon request

Andriani, H., Usman, H. A., Dewayani, B. M., Hernowo, B. S., & Bashari, M. H. (2020). Aaptos suberitoides extract inhibits cell migration in triple negative breast cancer and decreases nf-κb and mmp-9. Tropical Journal of Natural Product Research. https://doi.org/10.26538/tjnpr/v4i11.13
Andriani, Y., Pangestika, I., Oksal, E., Mohamad, H., Amir, H., Muhammad, T. S. T., & Wahid, M. E. A. (2019). Anti-atherosclerosis potency of Pandanus tectorius fruit rich by trangeretin and ethyl trans-caffeate, and their cytotoxicity against HepG2 cell line. IOP Conference Series: Materials Science and Engineering. https://doi.org/10.1088/1757-899X/509/1/012155
Benjannet, S., Rhainds, D., Hamelin, J., Nassoury, N., & Seidah, N. G. (2006). The proprotein convertase (PC) PCSK9 is inactivated by furin and/or PC5/6A: Functional consequences of natural mutations and post-translational modifications. Journal of Biological Chemistry, 281(41), 30561–30572. https://doi.org/10.1074/jbc.M606495200
Boik, J. (2001). Natural compounds in cancer therapy. In International Journal Of Pharmaceutical Medicine (Vol. 15, Issue 5). https://doi.org/10.2165/00124363-200110000-00017
Botelho, P. B., Guimarães, J. P., Mariano, K. R., Afonso, M. da S., Koike, M. K., Lottenberg, A. M. P., & Castro, I. A. (2015). Effect of echium oil combined with phytosterols on biomarkers of atherosclerosis in LDLr-knockout mice: Echium oil is a potential alternative to marine oils for use in functional foods. European Journal of Lipid Science and Technology, 117(10), 1561–1568. https://doi.org/10.1002/ejlt.201500004
Chaudhry, GES, Sohimi, NKA, Muhammad H, Zafar MN, et al., 2021b. Xylocarpus moluccensis induces cytotoxicity in human hepatocellular carcinoma HepG2 cell line via activation of the extrinsic pathway. Asian Pacific Journal of Cancer Prevention, vol. 22, S. 1, pp. 17-24. https://dx.doi.org/10.31557/APJCP.2021.22.S1.17
Chaudhry, GE, Islamiah, Zafar, MN, Bakar, K, et al., Sung YY, Muhammad, TST 2021a. Induction of apoptosis by Acanthaster planci sp., and Diadema setosum sp., fractions in human cervical cancer cell line, HeLa. Asian Pacific Journal of Cancer Prevention, vol. 22, no. 5, pp. 1365–1373. https://dx.doi.org/10.31557/APJCP.2021.22.5.1365
Chabowska, G., Barg, E., & Wójcicka, A. (2021). Biological activity of naturally derived naphthyridines. Molecules, 26(14). https://doi.org/10.3390/molecules26144324
Chae, H. S., You, B. H., Kim, D. Y., Lee, H., Ko, H. W., Ko, H. J., Choi, Y. H., Choi, S. S., & Chin, Y. W. (2018). Sauchinone controls hepatic cholesterol homeostasis by the negative regulation of PCSK9 transcriptional network. Scientific Reports, 8(1), 1–14. https://doi.org/10.1038/s41598-018-24935-6
Choi, H. K., Hwang, J. T., Nam, T. G., Kim, S. H., Min, D. K., Park, S. W., & Chung, M. Y. (2017). Welsh onion extract inhibits PCSK9 expression contributing to the maintenance of the LDLR level under lipid depletion conditions of HepG2 cells. Food and Function, 8(12), 4582–4591. https://doi.org/10.1039/c7fo00562h
Coppinger, C., Movahed, M. R., Azemawah, V., Peyton, L., Gregory, J., & Hashemzadeh, M. (2022). A Comprehensive Review of PCSK9 Inhibitors. In Journal of Cardiovascular Pharmacology and Therapeutics. https://doi.org/10.1177/10742484221100107
Dong, B., Wu, M., Li, H., Kraemer, F. B., Adeli, K., Seidah, N. G., Park, S. W., & Liu, J. (2010). Strong induction of PCSK9 gene expression through HNF1α and SREBP2: Mechanism for the resistance to LDL-cholesterol lowering effect of statins in dyslipidemic hamsters. Journal of Lipid Research, 51(6), 1486–1495. https://doi.org/10.1194/jlr.M003566
Dong, Z., Zhang, W., Chen, S., & Liu, C. (2019). Silibinin A decreases statin‑induced PCSK9 expression in human hepatoblastoma HepG2 cells. In Molecular Medicine Reports (Vol. 20, Issue 2, pp. 1383–1392). https://doi.org/10.3892/mmr.2019.10344
Duan, Y., Chen, Y., Hu, W., Li, X., Yang, X., Zhou, X., Yin, Z., Kong, D., Yao, Z., Hajjar, D. P., Liu, L., Liu, Q., & Han, J. (2012). Peroxisome proliferator-activated receptor γ activation by ligands and dephosphorylation induces proprotein convertase subtilisin kexin type 9 and low density lipoprotein receptor expression. Journal of Biological Chemistry, 287(28), 23667–23677. https://doi.org/10.1074/jbc.M112.350181
Dyck, G. J. B., Raj, P., Zieroth, S., Dyck, J. R. B., & Ezekowitz, J. A. (2019). The effects of resveratrol in patients with cardiovascular disease and heart failure: A narrative review. International Journal of Molecular Sciences, 20(4), 1–28. https://doi.org/10.3390/ijms20040904
Dyshlovoy, S. A., Fedorov, S. N., Shubina, L. K., Kuzmich, A. S., Bokemeyer, C., Keller-Von Amsberg, G., & Honecker, F. (2014). Aaptamines from the marine sponge Aaptos sp. display anticancer activities in human cancer cell lines and modulate AP-1-, NF- B-, and p53-dependent transcriptional activity in mouse JB6 Cl41 cells. In BioMed Research International (Vol. 2014). https://doi.org/10.1155/2014/469309
Dyshlovoy, S. A., Venz, S., Shubina, L. K., Fedorov, S. N., Walther, R., Jacobsen, C., Stonik, V. A., Bokemeyer, C., Balabanov, S., & Honecker, F. (2014). Activity of aaptamine and two derivatives, demethyloxyaaptamine and isoaaptamine, in cisplatin-resistant germ cell cancer. Journal of Proteomics, 96, 223–239. https://doi.org/10.1016/j.jprot.2013.11.009
Frye, S. V. (2010). The art of the chemical probe. Nature Chemical Biology, 6(3), 159–161. https://doi.org/10.1038/nchembio.296
Gong, K., Miao, S., Yang, L., Wu, Y., Guo, J., Chen, W., Dai, J., Du, J., & Xi, S. (2020). Aaptamine attenuates the proliferation and progression of non-small cell lung carcinoma. Pharmaceutical Biology, 58(1), 1044–1054. https://doi.org/10.1080/13880209.2020.1822420
Hughes, J. P., Rees, S. S., Kalindjian, S. B., & Philpott, K. L. (2011). Principles of early drug discovery. British Journal of Pharmacology, 162(6), 1239–1249. https://doi.org/10.1111/j.1476-5381.2010.01127.x
Hwang, J. T., Kim, H. J., Choi, H. K., Park, J. H., Chung, S., & Chung, M. Y. (2020). Butein synergizes with statin to upregulate low-density lipoprotein receptor through HNF1 α-mediated PCSK9 inhibition in HepG2 cells. Journal of Medicinal Food, 23(10), 1102–1108. https://doi.org/10.1089/jmf.2020.4761
Jack, A., Mohd, M. A., Kamaruddin, N. N., Mohd Din, L. H., Hajri, N. A., & Tengku Muhammad, T. S. (2021). Acaudina molpadioides mediates lipid uptake by suppressing PCSK9 transcription and increasing LDL receptor in human liver cells. Saudi Journal of Biological Sciences, 28(12), 7105–7116. https://doi.org/10.1016/j.sjbs.2021.08.003
Kamaruddin, N N, Din, L. H. M., Jack, A., Manan, A. F. A., Mohamad, H., & Muhammad, T. S. T. (2022). Acanthaster planci Inhibits PCSK9 Gene Expression via Peroxisome Proliferator Response Element (PPRE) and Activation of MEK and PKC Signaling Pathways in Human Liver Cells. Pharmaceuticals, 15(3). https://doi.org/10.3390/ph15030269
Kamaruddin, Nurjannatul Naim, Hajri, N. A., Andriani, Y., Abdul Manan, A. F., Tengku Muhammad, T. S., & Mohamad, H. (2021). Acanthaster planci inhibits pcsk9 and lowers cholesterol levels in rats. Molecules, 26(16). https://doi.org/10.3390/molecules26165094
Kim, H. J., Lee, J., Chung, M. Y., Hong, S., Park, J. H., Lee, S. H., Park, S. W., Choi, H. K., & Hwang, J. T. (2020). Piceatannol reduces resistance to statins in hypercholesterolemia by reducing PCSK9 expression through p300 acetyltransferase inhibition. Pharmacological Research, 161, 105205. https://doi.org/10.1016/j.phrs.2020.105205
Kourimate, S., Le May, C., Langhi, C., Jarnoux, A. L., Ouguerram, K., Zaïr, Y., Nguyen, P., Krempf, M., Cariou, B., & Costet, P. (2008). Dual mechanisms for the fibrate-mediated repression of proprotein convertase subtilisin/kexin type 9. Journal of Biological Chemistry, 283(15), 9666–9673. https://doi.org/10.1074/jbc.M705831200
Lambert, G., Jarnoux, A. L., Pineau, T., Pape, O., Chetiveaux, M., Laboisse, C., Krempf, M., & Costet, P. (2006). Fasting induces hyperlipidemia in mice overexpressing proprotein convertase subtilisin kexin type 9: Lack of modulation of very-low-density lipoprotein hepatic output by the low-density lipoprotein receptor. Endocrinology, 147(10), 4985–4995. https://doi.org/10.1210/en.2006-0098
Lebeau, P., Al-Hashimi, A., Sood, S., Lhoták, Š., Yu, P., Gyulay, G., Paré, G., Wayne Chen, S. R., Trigatti, B., Prat, A., Seidah, N. G., & Austin, R. C. (2017). Endoplasmic reticulum stress and Ca2+ depletion differentially modulate the sterol regulatory protein PCSK9 to control lipid metabolism. Journal of Biological Chemistry. https://doi.org/10.1074/jbc.M116.744235
Lebeau, P. F., Byun, J. H., Platko, K., Saliba, P., Sguazzin, M., MacDonald, M. E., Paré, G., Steinberg, G. R., Janssen, L. J., Igdoura, S. A., Tarnopolsky, M. A., Wayne Chen, S. R., Seidah, N. G., Magolan, J., & Austin, R. C. (2022). Caffeine blocks SREBP2-induced hepatic PCSK9 expression to enhance LDLR-mediated cholesterol clearance. Nature Communications. https://doi.org/10.1038/s41467-022-28240-9
Lee, E., Zhang, X., Noda, T., Miyamoto, J., Kimura, I., Tanaka, T., Sakurai, K., Hatano, R., & Miki, T. (2021). Lecithin inclusion by α-cyclodextrin activates SREBP2 signaling in the gut and ameliorates postprandial hyperglycemia. International Journal of Molecular Sciences. https://doi.org/10.3390/ijms221910796
Li, G., Yan, C. Y., Wen, D. G., Ding, Q., & Zhang, Y. F. (2004). Enhancement effect of interferon gamma on the sensitivity of RT4 bladder cancer cells to 5’-deoxy-5-fluorouridine,and 5-fluorouracil through up-regulation of PD-ECGF/TP. Ai Zheng = Aizheng = Chinese Journal of Cancer.
Li, Hai, Dong, B., Park, S. W., Lee, H. S., Chen, W., & Liu, J. (2009). Hepatocyte nuclear factor 1α plays a critical role in PCSK9 gene transcription and regulation by the natural hypocholesterolemic compound berberine. Journal of Biological Chemistry, 284(42), 28885–28895. https://doi.org/10.1074/jbc.M109.052407
Li, Hui hui, Li, J., Zhang, X. jing, Li, J. meng, Xi, C., Wang, W. qiong, Lu, Y. li, & Xuan, L. jiang. (2020). 23,24-Dihydrocucurbitacin B promotes lipid clearance by dual transcriptional regulation of LDLR and PCSK9. Acta Pharmacologica Sinica. https://doi.org/10.1038/s41401-019-0274-0
Li, Q., Zhang, P., Wang, P., Yu, H., Sun, F., Hu, W., Wu, W., Zhang, X., Chen, F., Chu, Z., Zhang, J., Chen, S., & Lin, H. (2015). The Cytotoxic and Mechanistic Effects of Aaptamine on Hepatocellular Carcinoma. Anti-Cancer Agents in Medicinal Chemistry. https://doi.org/10.2174/1871520614666141114201027
López-Miranda, J., & Pedro-Botet, J. (2021). Therapeutic targets in the treatment of dyslipidaemias: From statins to PCSK9 inhibitors. Unmet needs. Clinica e Investigacion En Arteriosclerosis, 33, 46–52. https://doi.org/10.1016/j.arteri.2020.12.005
Lusis, A.J. Atherosclerosis. Nature 2000, 407, 233–241
Malich, G., Markovic, B., & Winder, C. (1997). The sensitivity and specificity of the MTS tetrazolium assay for detecting the in vitro cytotoxicity of 20 chemicals using human cell lines. Toxicology. https://doi.org/10.1016/S0300-483X(97)00151-0
Masood, S, Zafar, MN, Chaudhry GS, Muhammad, et al., 2019. Synthesis, characterization and anti-cancer properties of water-soluble bis (PYE) pro-ligands and derived palladium (II) complexes. Dalton Transactions, vol. 48, no. 41, pp. 15408-15418. https://dx.doi.org/10.1039/C9DT019S3E
Mattiuzzi, C., Sanchis-Gomar, F., & Lippi, G. (2020). Worldwide burden of LDL cholesterol: Implications in cardiovascular disease. Nutrition, Metabolism and Cardiovascular Diseases, 30(2), 241–244. https://doi.org/10.1016/j.numecd.2019.09.008
Mohamad, H, Razak, M. F. A., Kamaruddin, N. N., Din, L. H. M., Asari, A., Andriani, Y., Mustafa, S. F. Z., Saidin, J., Aluwi, M. F. F. M., Latip, J., & Muhammad, T. S. T. (2020). PCSK9 inhibitory activity of marine-derived compounds, aaptaminoids, and benzamide originated from Aaptos aaptos and Acanthaster planci as a potential treatment for atherosclerosis. Journal of Applied Pharmaceutical Science, 10(8), 111–123. https://doi.org/10.7324/JAPS.2020.10813
Mohamad, Habsah, Rashid, Z. M., Shaari, K., Latip, J., Lajis, M. N. H., & Ali, A. M. (2009). Antibacterial and DPPH free radical-scavenging activities of methanolic extracts of aaptos sp. (marine sponges). Pertanika Journal of Tropical Agricultural Science, 32(1), 43–50.
Mohamad, Habsah, Razak, M. F. A., Kamaruddin, N. N., Din, L. H. M., Asari, A., Andriani, Y., Mustafa, S. F. Z., Saidin, J., Aluwi, M. F. F. M., Latip, J., & Muhammad, T. S. T. (2020). PCSK9 inhibitory activity of marine-derived compounds, aaptaminoids, and benzamide originated from Aaptos aaptos and Acanthaster planci as a potential treatment for atherosclerosis. Journal of Applied Pharmaceutical Science, 10(8), 111–123. https://doi.org/10.7324/JAPS.2020.10813
Mohamad, Habsah, Rosmiati, Muhammad, T. S. T., Andriani, Y., Bakar, K., Ismail, N., Saidin, J., Latip, J., Musa, N., & Parenrengi, A. (2017). Potential secondary metabolites from marine sponge Aaptos aaptos for atherosclerosis and vibriosis treatments. Natural Product Communications, 12(8), 1227–1230. https://doi.org/10.1177/1934578x1701200819
Mullen, P. J., Lüscher, B., Scharnagl, H., Krähenbühl, S., & Brecht, K. (2010). Effect of simvastatin on cholesterol metabolism in C2C12 myotubes and HepG2 cells, and consequences for statin-induced myopathy. Biochemical Pharmacology, 79(8), 1200–1209. https://doi.org/10.1016/j.bcp.2009.12.007
Nadar, V. M., Manivannan, S., Chinnaiyan, R., Govarthanan, M., & Ponnuchamy, K. (2022). Review on marine sponge alkaloid, aaptamine: A potential antibacterial and anticancer drug. Chemical Biology and Drug Design, 99(1), 103–110. https://doi.org/10.1111/cbdd.13932
Nawaka, N., Wanmasae, S., Makarasen, A., Dechtrirat, D., Techasakul, S., & Jeenduang, N. (2022). Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells. International Journal of Molecular Sciences. https://doi.org/10.3390/ijms232214299
Nichols, G. A., Philip, S., Reynolds, K., Granowitz, C. B., & Fazio, S. (2018). Increased cardiovascular risk in hypertriglyceridemic patients with statin-controlled LDL cholesterol. Journal of Clinical Endocrinology and Metabolism. https://doi.org/10.1210/jc.2018-00470
Nichols, G. A., Philip, S., Reynolds, K., Granowitz, C. B., & Fazio, S. (2019). Increased residual cardiovascular risk in patients with diabetes and high versus normal triglycerides despite statin-controlled LDL cholesterol. Diabetes, Obesity and Metabolism. https://doi.org/10.1111/dom.13537
Norata, G. D., Tibolla, G., & Catapano, A. L. (2014). Targeting PCSK9 for hypercholesterolemia. Annual Review of Pharmacology and Toxicology, 54, 273–293. https://doi.org/10.1146/annurev-pharmtox-011613-140025
Pham, C. D., Hartmann, R., Müller, W. E. G., De Voogd, N., Lai, D., & Proksch, P. (2013). Aaptamine derivatives from the indonesian sponge Aaptos suberitoides. Journal of Natural Products, 76(1), 103–106. https://doi.org/10.1021/np300794b
Rashid, Z., Ali, A., Douzenel, P., Bourgougnon, N., Shaari, K., Andriani, Y., Tengku Muhammad, T., & Mohamad, H. (2018). Phenolics, fatty acids composition and biological activities of various extracts and fractions of Malaysian Aaptos aaptos. Asian Pacific Journal of Tropical Biomedicine, 8(11), 554–564. https://doi.org/10.4103/2221-1691.245971
Roy, A. (2018). Early probe and drug discovery in academia: A minireview. High-Throughput, 7(1), 1–14. https://doi.org/10.3390/ht7010004
Seidah, N. G., Benjannet, S., Wickham, L., Marcinkiewicz, J., Bélanger Jasmin, S., Stifani, S., Basak, A., Prat, A., & Chrétien, M. (2003). The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): Liver regeneration and neuronal differentiation. Proceedings of the National Academy of Sciences of the United States of America, 100(3), 928–933. https://doi.org/10.1073/pnas.0335507100
Shaari, K., Kee, C. L., Rashid, Z. M., Tan, P. J., Abas, F., Raof, S. M., Zainal, Z., Lajis, N. H., Mohamad, H., & Ali, A. M. (2009). Cytotoxic aaptamines from Malaysian Aaptos aaptos. Marine Drugs, 7(1). https://doi.org/10.3390/md7010001
Smit, R. A. J., Trompet, S., Leong, A., Goodarzi, M. O., Postmus, I., Warren, H., Theusch, E., Barnes, M. R., Arsenault, B. J., Li, X., Feng, Q. P., Chasman, D. I., Cupples, L. A., Hitman, G. A., Krauss, R. M., Psaty, B. M., Rotter, J. I., Cessie, S. le, Stein, C. M., & Jukema, J. W. (2020). Statin-induced LDL cholesterol response and type 2 diabetes: a bidirectional two-sample Mendelian randomization study. Pharmacogenomics Journal. https://doi.org/10.1038/s41397-019-0125-x
Štern, A., Furlan, V., Novak, M., Štampar, M., Kolenc, Z., Kores, K., Filipič, M., Bren, U., & Žegura, B. (2021). Chemoprotective effects of xanthohumol against the carcinogenic mycotoxin aflatoxin b1. Foods. https://doi.org/10.3390/foods10061331
Stonik, V. A., & Fedorov, S. N. (2014). Marine low molecular weight natural products as potential cancer preventive compounds. Marine Drugs, 12(2), 636–671. https://doi.org/10.3390/md12020636
Talayero, B. G., & Sacks, F. M. (2011). The role of triglycerides in atherosclerosis. Current Cardiology Reports, 13(6), 544–552. https://doi.org/10.1007/s11886-011-0220-3
Tran, H. N. K., Kim, M. J., & Lee, Y. J. (2022). Scalarane Sesterterpenoids Isolated from the Marine Sponge Hyrtios erectus and their Cytotoxicity. Marine Drugs. https://doi.org/10.3390/md20100604
Utkina, N. K. (2009). Antioxidant activity of aromatic alkaloids from the marine sponges Aaptos aaptos and Hyrtios SP. Chemistry of Natural Compounds, 45(6), 849–853. https://doi.org/10.1007/s10600-010-9490-z
Utkina, N., Likhatskaya, G., Malyarenko, O., Ermakova, S., Balabanova, L., Slepchenko, L., & Bakunina, I. (2021). Effects of sponge-derived alkaloids on activities of the bacterial α-d-galactosidase and human cancer cell α-n-acetylgalactosaminidase. In Biomedicines (Vol. 9, Issue 5). https://doi.org/10.3390/biomedicines9050510
Violi, F., Nocella, C., Loffredo, L., Carnevale, R., & Pignatelli, P. (2022). Interventional study with vitamin E in cardiovascular disease and meta-analysis. Free Radical Biology and Medicine, 178(November 2021), 26–41. https://doi.org/10.1016/j.freeradbiomed.2021.11.027
Wang, J., Wang, Y., Yang, X., Lin, P., Liu, N., Li, X., Zhang, B., & Guo, S. (2021). Purification, structural characterization, and PCSK9 secretion inhibitory effect of the novel alkali-extracted polysaccharide from Cordyceps militaris. International Journal of Biological Macromolecules, 179(1), 407–417. https://doi.org/10.1016/j.ijbiomac.2021.02.191
Wang, S., Xiu, J., Liao, W., Liao, Y., & Bin, J. (2019). Relative effect of current intensive lipid-lowering drugs on cardiovascular outcomes in secondary prevention: A meta-analysis of 12 randomized trials. Circulation Journal. https://doi.org/10.1253/circj.CJ-18-1321
Wen, Z. H., Kuo, H. M., Shih, P. C., Hsu, L. C., Chuang, J. M. J., Chen, N. F., Sun, H. W., Liu, H. T., Sung, C. S., & Chen, W. F. (2023). Isoaaptamine increases ROS levels causing autophagy and mitochondria-mediated apoptosis in glioblastoma multiforme cells. Biomedicine and Pharmacotherapy, 160(January), 114359. https://doi.org/10.1016/j.biopha.2023.114359
Wu, C. F., Lee, M. G., El-Shazly, M., Lai, K. H., Ke, S. C., Su, C. W., Shih, S. P., Sung, P. J., Hong, M. C., Wen, Z. H., & Lu, M. C. (2018). Isoaaptamine induces T-47D cells apoptosis and autophagy via oxidative stress. Marine Drugs, 16(1), 1–18. https://doi.org/10.3390/md16010018
Yang, H. xian, Zhang, M., Long, S. yin, Tuo, Q. hui, Tian, Y., Chen, J. xiong, Zhang, C. ping, & Liao, D. fang. (2020). Cholesterol in LDL receptor recycling and degradation. In Clinica Chimica Acta. https://doi.org/10.1016/j.cca.2019.09.022
Yang, Z., Liu, G., Wang, Y., Yin, J., Wang, J., Xia, B., Li, T., Yang, X., Hou, P., Hu, S., Song, W., & Guo, S. (2019). Fucoidan A2 from the Brown Seaweed Ascophyllum nodosum Lowers Lipid by Improving Reverse Cholesterol Transport in C57BL/6J Mice Fed a High-Fat Diet. Journal of Agricultural and Food Chemistry, 2–11. https://doi.org/10.1021/acs.jafc.9b01321

Download PDF

Version 1

posted

You are reading this latest preprint version

Aaptamine Counteracts Statin-Induced PCSK9 Elevation to Improve LDL Receptor Expression and Cholesterol Uptake

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cytotoxicity screening using MTS cell proliferation assay

Quantitative Real-time PCR

Protein Extraction and Western Blot Analysis

LDL-C uptake and Immunofluorescence staining of LDLR and PCSK9

Statistical Analysis

Results

MTS Assay

Discussion

Conclusion

Declarations

References

Status:

Version 1