Molecular Epidemiological Studies of pfmdr-1 Gene in Plasmodium falciparum Among Undergraduates in A Private University in Lagos State

doi:10.21203/rs.3.rs-5311138/v1

Background

The prevalence of Plasmodium falciparum-resistant parasites remains one of the major challenges to malaria control and eradication in sub-Saharan Africa. Monitoring the molecular markers that confer resistance to various antimalarial drugs is important for tracking the prevalence of resistant parasites and optimizing the therapeutic longevity of current drugs. Morbidity and mortality among students remain quite high despite the availability of malaria management strategies. Therefore, the aim of this study is to determine the prevalence of malaria with its possible risk factors and the presence of pfmdr-1 genes and the drugs in which the mutant allele combinations N86Y, Y184F, S1034C and N1042D are sensitive to among undergraduates in Anchor University.

Method

Dried blood spots (DBS) were collected from 340 students after testing for the presence of Plasmodium falciparum parasites using RDT kits (On-site Rambo Rapid Detection Kit). The spots were subjected to DNA extraction. The extracted product was then amplified using the Nested PCR and the amplicons was runs on the gel to identify the presence and genotype of gene mutations base pairs. The data was analyzed using the SPSS versions 27 Software.

Results

The prevalence of malaria in this study was 20.59%. Female students that participated in the study showed higher percentage of malaria than the male, 75.7% and 24.3% respectively. Malaria was also reported in all age groups but the infection rate was highest in the 16–20 age groups (82.9%). 70.88% of the populations studied don’t make use of mosquito nets, and 28.24% don’t use insecticide. Among the P. falciparum positive patients, it was also observed that those who indulge in self-medication and those who didn’t complete their malaria-drugs dosage, presented a higher percentage of those positive for malaria. 66.67% of the population size uses drug combinations of Arthemether and Lumefantrine.

Conclusion

No mutant allele combinations of the molecular marker of pfmdr1 gene among the participants with P. falciparum was detected in the study.

Plasmodium falciparum

molecular marker

antimalarial drugs

mutant allele

Malaria is a life-threatening disease caused by the bite of an infective female Anopheles mosquitoes which transmit a parasite (Plasmodium falciparum and other species) from one person to another. Although, the disease is preventable and curable (1), malaria is a major global disease which is mostly common in the tropical and sub – tropical regions of the world including Sub – Saharan regions, South Asia, South America etc., and uncommon in the temperate regions though there may be a few numbers of malaria cases due to migration. According to the World Health Organization, an estimated number of 619,000 malaria death occurred globally in 2021 as compared to 625,000 malaria death in the first year of the pandemic (1). Globally, the number of malaria cases still rises daily, which has reached about 247 million cases as at 2021 as compared to 245 million cases in 2020 and 232 million cases in 2019 (1).

There are five major species of single-celled eukaryotic Plasmodium parasites that causes malaria in humans which include Plasmodium falciparum, Plasmodium malariae, Plasmodium vivax, Plasmodium ovale and Plasmodium knowlesi. Plasmodium falciparum and Plasmodium vivax are the most common species and are responsible for the largest public health burden (2). In addition, Plasmodium knowlesi, a type of malaria that naturally infects macaques in Southeast Asia, also infects humans, causing malaria that is transmitted from animal to human (zoonotic malaria) (3). In human, Plasmodium species which is transmitted by the infected female Anopheles mosquitoes grow and multiply firstly in the liver and then in the red blood cells. The parasites continue to grow inside the red blood cells and destroys them, releasing daughter parasites called merozoites which continues the cycle by invading other red blood cells. It is at this stage the symptoms of malaria start to develop in human and also, the parasite is ingested from the blood by the female Anopheles mosquitoes which transmit it to other humans through feeding (4). The symptoms of malaria which is developed as a result of infection from the Plasmodium species include fever and flu-like illness, including shaking chills, headache, muscle aches, tiredness, nausea, vomiting, and diarrhea. Malaria may cause anemia and jaundice because of the loss of red blood cells. If not promptly treated, the infection can become severe and may cause kidney failure, seizures, mental confusion, coma, and death (3). According to the 2022 World’s Malaria Report, The WHO estimated that there were 247 million malaria cases in 2021, up from 245 million in 2020, in 84 malaria-endemic nations (including the French Guiana territory) (1). 96% of malaria cases worldwide were reported from 29 countries, with Nigeria (27%), the Democratic Republic of the Congo (12%), Uganda (5%), and Mozambique (4%) accounting for nearly half of all cases. Globally, malaria mortality dropped steadily throughout the period 2000–2019, from 897,000 in 2000 to 577,000 in 2015 and to 568,000 in 2019. In 2020, malaria mortality increased by 10% compared with 2019, to an estimated 625,000. Estimated fatalities fell marginally in 2021 to 619,000. Between 2019 and 2021, 63,000 deaths were related to disruptions to key malaria services during the COVID-19 epidemic. In 2021, deaths from malaria occurred in four nations: Nigeria (31%), the Democratic Republic of the Congo (13%), Niger (4%), and the United Republic of Tanzania (4%).

Although malaria can be a deadly disease, illness and death from malaria can be prevented. Malaria can be managed through a combination of vector control approaches (such as insecticide spraying and the use of insecticide-treated bed nets) and drugs for both treatment and prevention (5). The use of drugs like chloroquine, artemisinin, mefloquine, etc. in the treatment of malaria has developed in the early period. Other techniques like Artemisinin Combination Therapies (ACT) haves been developed as the recent first-line drug in the treatment of malaria although other ways/inventions for the eradication of malaria is still coming up.

The widespread use of artemisinin-based combination therapies has contributed substantially to the declines in the number of malaria-related deaths. However, the emergence of drug resistance threatens to reverse this progress. Advances in our understanding of the underlying molecular basis of pathogenesis have fuelled the development of new diagnostics, drugs and insecticides. Several new combination therapies are in clinical development that have efficacy against drug-resistant parasites and the potential to be used in single-dose regimens to improve compliance. This ambitious programme to eliminate malaria also includes new approaches that could yield malaria vaccines or novel vector control strategies. However, despite these achievements, a well-coordinated global effort on multiple fronts is needed if malaria elimination is to be achieved (5). Over the last decade, antimalarial drug resistance has emerged as a threat to global malaria control efforts in the Greater Mekong subregion. Anti-malarial drug resistance is a substantial obstacle to chemotherapy for malaria in sub-Saharan Africa, in large part because Plasmodium falciparum developed drug resistance so quickly (6).

Plasmodium falciparum is the deadliest species of malaria which develops resistance to most of the various anti-malarial drugs as a result of the mutations that occurs in the various genes of the species. In various researches, different mutations have been detected in the following genes Pfcrt, PfKelch13, Pfdhfr, Pfmdr and Pfdhps which has led to the resistance of Plasmodium falciparum to Chloroquine, Artemisinin, Pyrimethamine, Multi-drug and Sulfadoxine respectively. The selection and spread of drug resistant P. falciparum is facilitated by the rapid genome replication rate and by a relatively high mutation rate per generation of the parasite (7, 8).Single nucleotide polymorphisms (SNPs) in the P. falciparum multidrug resistance gene (Pfmdr1) have been reported to regulate the sensitivity of the parasite to the long-acting partner drug in Artemisinin-based combination therapy (ACT) (9, 10). Anti-malarial drug resistance is created as a result of drug selection of spontaneous P. falciparum mutations that confer drug tolerance. The selection of drug-resistant P. falciparum and its spread are both influenced by the parasite's high mutation rate and quick genome replication rate (10). Antimalarial medication resistance develops as a result of a complicated interaction between the treatment given to infected individuals and the parasite exposure as it moves through its life cycle in the human host and the mosquito vector. In contrast to transmission to or from mosquitoes, the patient's blood contains a much higher concentration of parasites. Random single-point mutations, some of which can give resistance, happen 1–5 times per 109 ABS parasites (7, 11). Amplification of drug and solute efflux transporter genes, including Pfmdr-1, can lead to resistance to various antimalarial chemotypes and can happen as frequently as 1 in 107 parasites. Such a resistance mechanism, nevertheless, only causes a fewfold reduction in medication potency. The number of parasites present during a human blood stage infection can exceed 1012, giving a few parasites with treatment resistance the chance to survive drug exposure and, if spread, continue their life cycle. In contrast, only a few gametocytes are needed for transmission from an infected human to a mosquito. Since there are around 100 times fewer of these gametocytes than ABS parasites, there is less pressure for resistance (12, 11). Despite not being linked to artemisinin resistance, single nucleotide polymorphisms (SNPs) in the P. falciparum multidrug resistance gene (Pfmdr-1) have been found to affect how susceptible the parasite is to the long-acting partner drug in artemisinin-based combination therapy (ACT) (9). There is currently no conclusive evidence that the use of the ACT regimens artemether-lumefantrine (AL) and artesunate-amodiaquine (AS-AQ) in the sub-Saharan region has resulted in treatment failure for uncomplicated malaria. However, certain Pfmdr-1 genetic investigations have revealed opposing selective pressures after individual drug usage, in which parasites with five different single-nucleotide substitutions have been discovered to result in alterations to the amino acids at codons 86, 184, 1034, 1042, and 1246 (13Fançony et al., 2012). Studies conducted in different geographical areas of the world have suggested that the point mutation of tyrosine at codon 86 (N86Y) is related to chloroquine resistance. Several other pfmdr1 polymorphisms at 184F, 1034C, 1042D, and 1246Y are being implicated in altering the degree of chloroquine resistance (14). WHO is also concerned about reports of drug-resistant malaria in Africa, so regular monitoring of drug efficacy is needed to inform treatment policies in malaria-endemic countries, and to ensure early detection of, and response to, drug resistance (1).

Despite the availability of malaria control measures, the morbidity and mortality among students is still relatively high (15, 16). Carrying out a molecular epidemiological studies of Plasmodium falciparum resistance to existing malaria drugs among undergraduate in Anchor University, Lagos will aid to investigate the prevalence of malaria, its risk factors and the presence of the Plasmodium falciparum multi-resistant gene (Pfmdr-1), ascertaining the presence of the N84Y, Y184F, S1034C and N1042D mutations and what antimalarial drugs may be responsible.

STUDY SITE

Students were randomly selected from Anchor University. The Institution with Latitude 6.60241°, Longitude 3.24269° is located at Ayobo-Ipaja, Lagos State, South West Nigeria, West Africa.

MATERIALS

Gloves, Nose masks, RDT Test kits, Cotton wool, Ethanol, Whatman filter paper, QIAGEN kits, Micropipette tips, 1 x Taqman master mix, Primers, Agarose powder, Ethidium bromide, TBE Buffer, Eppendorf tubes, PCR tubes.

SAMPLE COLLECTION

SAMPLE SIZE

The sample size was obtained according to single population proportion formula: n = Z² × P (1 - P)/ d². Where n = sample size, Z = Standard normal deviation at 95% confidence interval which is 1.96. P = Proportion of the target population, d = Degree of precision (taken as 0.05) (16). From the formula, n was calculated to be 309.1. Adding 10% attrition rate to the calculated sample size (i.e. 309.1 + 30.91) = 340.01. Therefore, 340 students were sampled, consisting 251 females and 89 males, with age range of < 16–30 years.

SELECTION CRITERIA

Inclusion and exclusion criteria

Students who were symptomatic and symptomatic, but with uncomplicated malaria, and were willingly to donate their blood samples and to also fill the questionnaires, were randomly selected for the study; while those who were unwilling and currently on antimalarial drugs were excluded

Ethical approval:

Ethical approval for the study was obtained from Nigeria Institute of Medical Research (NIMR), Yaba, Lagos State. At the beginning of the study, the aims and procedures of the project was fully explained to the students and written informed consent was obtained from the volunteers.

Blood sample collection procedure/malaria test

After enrollment, blood samples of the participants were taken by finger prick. Malaria was tested using Rapid Diagnostic Test (RDT) kits. The RDT kit (Onsite malaria pf/pv Ab combo rapid test) was used according to manufacturer’s manual. The flat surface or work bench was swab with cotton wool dipped into 70 % of ethanol in order to sterilize it. Test cassettes was removed from foil pouch and placed on a flat, dry surface. Whole blood (20µL mark) was pipetted or inserted into the sample hole of the RDT cassette after a punch on the finger with Lancet devices (Pin). About 2-3 drops (60-80µL) of diluents buffer was added immediately and left for 15 minutes before reading the result. Three spots of blood samples were deposited on Whatman Grade GB003 filter paper (Whatman, GE Healthcare). Dried blood spots (DBS) were placed in an individual grip seal plastic (disposable) bag and was then stored at room temperature before molecular analysis.

Genomic DNA isolation

Genomic DNA was extracted using the QIAamp DNA Kit (Qiagen, Germany), following the manufacturer’s protocol. The extracted DNA was stored at – 20 °C before PCR testing (17).

Amplification of Pfmdr1 Genes

The extracted product was amplified to identify polymorphisms at codons 86, 184, 1034 and 1042 in pfmdr1 gene. The extracted DNA was amplified by nested PCRs. In the first rounds of PCR, 2 µl of genomic DNA, 12.5 µL of Taq Master Mix, 1 µL of each primer (10 µM) (Table 1) and 8.5 µL of ddH₂O was added. The second rounds of PCR, 2 µL of products from the first round was used, 25 µL of Taq Master Mix, 2 µL of each primer (10 µM), and 19 µL of ddH2O. The same amplification (Table 2) program was used for all reactions except the annealing temperature (52º C for the first round and 54º C for the second round): initial denaturation at 95º C for 3 min, followed by 35 cycles of 95º C for 30 s, annealing for 30 s, and 72º C for 1 min, and a final extension at 72º C for 5 min (18).

Table 1: primers used for the amplification:

Plasmodium falciparum multi-resistant gene N84Y and Y184F		Product size	Plasmodium falciparum multi-resistant gene S1034C and N1042D		Product size
MDR1-1F	TTAAATGTTTACCTGCACAACATAGAAAATT	612	MDRFR3N1	GCATTTTATAATATGCATACTG	234
MDR1-1R	CTCCACAATAACTTGCAACAGTTCTTA	612	MDRFR3R1	GGATTTCATAAAGTCATCAAC	234
MDR1-2F	TGTATGTGCTGTATTATCAGGA	526	MDRFR3N2	GGTTTAGAAGATTATTTCTGTAA	201
MDR1-2R	CTCTTCTATAATGGACATGGTA	526	MDRFR3R1	GGATTTCATAAAGTCATCAAC	201

Table 2: Process of Amplification for the 1^st Round

1^st Round	DNA Template	2µl	Initial Denaturation at 95⁰C for 3 mins; Denaturation at 95⁰C for 30s, 52⁰C for 30s Annealing and 72⁰C for 1 min (Extension) for 35 Cycles; Final extension at 72⁰C for 5min.
	Master Mix	12.5µl
	Primer 1F	1µl
	Primer 1R	1µl
	ddH₂O	8.5µl
	Total	25µl
2^nd Round	DNA Template	2µl	Initial Denaturation at 95⁰C for 3 mins; Denaturation at 95⁰C for 30s, 54⁰C for 30s Annealing and 72⁰C for 1 min (Extension) for 35 Cycles; Final extension at 72⁰C for 5min
	Primer 1F	2µl
	Primer 1R	2µl
	ddH₂O	19µl
	Total	50µl

Gel electrophoresis

Two μL of each Polymerase chain reaction products was evaluated by electrophoresis on horizontal plate with 2% agarose gel containing 0.1 μG/mL ethidium bromide and visualized under ultraviolet (UV) light.

DATA ANALYSIS

Datasets obtained from this study were analyzed using Statistical Package for Social
Science (SPSS) version 27. All data was statistically analyzed and P values ˂ 0.05 was considered to be statistically significant. Overall descriptive statistics was carried out to select variables for consideration in multivariate regression models. Pearson’s Product Moment Correlation was used to test relationship between variables

The prevalence of Plasmodium falciparum-resistant parasites remains one of the major challenges to malaria control and eradication in sub-Saharan Africa. Monitoring the molecular markers that confer resistance to various antimalarial drugs is important for tracking the prevalence of resistant parasites and optimizing the therapeutic longevity of current drugs. Based on the sample collected from 340 students, 70 (20.59 %) students were malaria positive while 270 (79.41 %) were negative. According to this study, it was observed that those from the Yoruba ethnics group (55.7%) tends to have high prevalence of malaria than Igbo (14.3%), Hausa (4.3%) and other ethnic groups (25.7%) (Table 3). Also, among the participants, it was observed that those from the Faculty of Humanities, Social and Management Sciences (FHSMS) (58.6%) tends to have high prevalence of malaria when compared with other faculties: Faculty of Natural, Applied and Health Sciences (FNAHS) (41.4%) and Faculty of Environmental Sciences (FES) (0%). The students from 100 Levels tend to have high prevalence of malaria (31.4%) when compared with 200 Level, 300 Level, 400 Level and JUPEB with prevalence of 25.7%, 10%, 20% and 12.9% respectively. Among the age groups, age 16-20 (82.9 %) was recorded to have high percentage (82.9 %) of malaria than the other age groups, <16 (4.2 %), 21-25(12.9 %), 26-30(0 %) and >30(0 %) respectively, and this was statistically significant (P= 0.045). Lastly in terms of the gender, the females (75.7%) were recorded to have high prevalence of malaria than the males (24.3%) in this study.

Table 3: Socio-demographic data of participants

MALARIA PREVALENCE
Variables		Positive	Negative	Total	P-value
Ethnicity	Yoruba	39(55.7%)	149(55.2%)	188	0.057
Igbo	10(14.3%)	60(22.2%)	70
Hausa	3(4.3%)	4(1.5%)	7
Others	18(25.7%)	57(21.1%)	75
Total		70	270	340
Faculty	FNAHS	29(41.4%)	123(45.6%)	152	0.053
FHSMS	41(58.6%)	144(53.3%)	185
FES	0(0%)	3(1.1%)	3
Total		70	251	340
Level	100	22(31.4%)	123(45.6%)	145	0.053
200	18(25.7%)	34(12.6%)	52
300	7(10%)	25(9.3%)	32
400	14(20%)	60(22.2%)	74
JUPEB	9(12.9%)	28(10.4%)	37
Total		70	270	340
Age	<16	3(4.2%)	20(7.4%)	23	0.045
16-20	58(82.9%)	202(74.8%)	260
21-25	9(12.9%)	44(16.3%)	53
26-30	0(0%)	3(1.1%)	3
>30	0(0%)	1(0.4%)	1
Total		70	270	340
Gender	Female	53(75.7%)	198(73.3%)	251	0.053
Male	17(24.3%)	72(26.7%)	89		0.053
Total		70	270	340

GENERAL KNOWLEDGE ABOUT MALARIA

According to this study, it was recorded that 100% of the participants have heard about malaria. 49.12% of the participants heard it from home and 32.35% of the participants heard from hospital (Fig. 1). 70% of the participants have had malaria in the last 12 months and 30% didn’t, while 34.12%, 30.39%, 13.82% and 21.76% of participants had malaria once, twice, thrice and more than thrice respectively.

Risk factors that encourage the spread of malaria among the participants

From the study, 70.88%, 28.24%, 69.41% and 51.76% (Fig. 2) participants didn’t use the mosquito nets, insecticides, mosquito repellent cream and antimalarial preventive drugs respectively. These are possible risk factors for the prevalence of malaria in this Institution.

Treatment attitude

In this study, it was observed that 24.7%, 5.88% and 15.29% of the participants used Coartem, Hydroxylchloroquine and Lokmal-QS respectively as antimalaria drugs, once, twice thrice and more than thrice (Fig. 3), and 73.53% of the participants used these drugs while 26.47% of the participants didn’t when they fall sick (Tab.4). In spite of the prevalence of malaria, participants exhibited different attitude (Fig. 4) such as not visiting the health centre when sick and incomplete usage of antimalaria drugs, which potent a danger in the fight against the disease. For instance, it was observed that although some individuals were found to be positive for Plasmodium falciparum (symptomatic and asymptomatic), yet they didn’t visit the health centre. 55.1% of those who had malaria parasite after testing did not visit the health center, 26.1% didn’t use antimalarial drugs and 49.3% of those positive and visited the health centre did not complete their dosage as prescribed by the physicians (Tab. 5). These attitudes may predispose the parasite to resistance to the antimalarial drugs and eventual endanger the lives of participants, and the University community, to the deleterious impact of malaria.

Table 4: Frequency of malaria drugs used with different active ingredients

Antimalarial Drugs Used	Active Ingredients	Percentage Usage (%)
Coartem	Artemether-Lumefantrine	24.71
Lokmal-QS	Artemether-Lumefantrine	15.29
Vatem	Artemether-Lumefantrine	2.06
Mikatem	Artemether-Lumefantrine	0.59
P-Alaxin	Dihydroartemisin-Piperaquine.	1.47
Artequick	Artemisinin-Piperaquine-Primaquine	0.59
Amatem Softgel	Artemether-Lumefantrine	15.00
Lonart	Artemether-Lumefantrine	3.53
Lumartem	Artemether-Lumefantrine	0.29
Hydroxychloroquine	Hydroxychloroquine Sulfate	5.88
Chloroquine	Chloroquine Phosphate	1.18

Table 5: Factors that may predispose malaria and resistance to the antimalarial drugs

Variables		*Plasmodium falciparum*
Variables		Positive	Negative	Total
Do you always visit the Health Centre when you want to treat malaria?	Yes	31(44.9%)	133(49.1%)	164
	No	38(55.1%)	138(50.9%)	176
Total		69	271	340
Do you often use Anti-Malarial drugs when you fall sick?	Yes	51(73.9%)	199(73.4%)	250
Do you often use Anti-Malarial drugs when you fall sick?	No	18(26.1%)	72(26.6%)	90
Total		69	271	340
Do you often complete you Dosage as prescribed?	Yes	35(50.7%)	126(46.5%)	161
Do you often complete you Dosage as prescribed?	No	34(49.3%)	145(53.5%)	179
Total		69	271	340

Although about 66.7% of the participants used antimalarial drugs containing Arthemether and Lumefantrine as their active ingredients’ combination (Tab. 4), and yet some of them tend to have malaria more than thrice in a year (Fig. 3). The excessive use of the drug combination may probably subject Plasmodium falciparum to pressure which might make the parasite developed a resistance gene against the drugs.

Results for the extraction and amplifications

Each of the extracted DNA was checked on the nanospectrophotometer to know the purity of each extracted DNA samples. The extracted DNA was then amplified using the Nested PCR and the amplicons was then run on the gel but no results was obtained which could probably be because the primers that were used to amplify Pfmdr gene may not be present.

In this study, the prevalence of malaria was 20.59% (70/340), with the highest prevalence due to Plasmodium falciparum 20.29%, followed by Plasmodium vivax 0.08%. This study included 89 males and 251 females and malaria was reported in all age groups but the infection rate was highest in the 16–20 age groups. Most of the students in the institution fall under this age bracket. This is similar to a study done by Duguma et al. (19), with a prevalence of 20.72%, which included 208 males and 231 females with malaria being reported in all age groups but the infection rate was highest in the 25–34 age groups.

The malaria prevalence found in this study (20.59%) was lower compared to studies conducted in different parts of the world, including various areas in Nigeria 419/1173 (35.7%) (20), India (36.6%) (21), Malaysia 410/1222 (33.6%) (22), and Kenya 325/1158 (28%) (23). It is also comparable to findings from Rwanda 175/769 (22.8%) (24), East Shewa Ethiopia 170/830 (20.5%) (25), Arba Minch South Ethiopia 60/271 (22.1%) (26) South West Ethiopia 20.7% (91/439) (19), and much higher compared to studies from North-West Ethiopia 296/4077 (7.3%), 26/735 (3.5%) (27). These variations may be due to the differences in the geographical location and climate conditions of the study areas. The result of these studies showed that malaria is still a serious public health concern in different locations of these countries, so the information obtained can be used to devise means (control and prevention strategies) to prevent further suffering of people from this disease.

Although most of the study participants agreed that the usage of insecticide is a powerful vector control tool for the prevention of malaria transmission because they believed it has the potency to reduce the prevalence of malaria, about 24.26% do not use insecticide (Fig. 2), yet the study recorded a high prevalence of malaria. This is in contrast to the study conducted by Duguma et al. (19), 51.5% study participants responded that their houses were not sprayed with insecticide when compared to those whose house was sprayed (4.8%), which may explain the relatively high malaria prevalence (15.9%) in their study. Likewise, most of the participants had Insecticide Treated Nets (ITN), but only about 29.12% used them in their various hostels as others gave different reasons why it was not used. This attitude reveals that ITN ownership by itself is not a guarantee of its usage. Usage of ITN can actually reduce prevalence of malaria as it was found in a study in carried out in Kenya where there was approximately 92.11% of mosquito bed net usage, and malaria prevalence was observed to be lower among households that used ITNs (8.05%) compared to those that did not use them (23.11%) (28).

It was observed in this study that some participants who were positive for malaria parasite and yet they neither visited the health center (55.1%) nor completed their dosage (49.3%). The incomplete usage, which some of indulge in was a result of the unpleasant nature of the prescribed drugs and/or signs of improvement make them to discard the remaining drugs. This can be a possible risk factor that predisposes resistance to antimalarial drugs.

This study did not detect molecular markers of pfmdr 1 associated with resistance to ACT in malaria treatment. The absence of pfmdr1 gene in the extracted DNA of P. falciparum isolates is similar to the studies conducted by Menard et al., (29) and Davlantes et al., (30) who also reported absence of the gene among the participants absence. In contrast, low frequencies were reported by Witkowski et al., (31), Mvumbi et al., (32) and Nguetse et al., (33) while Adamu et al., (34) reported a high prevalence of pfmdr1 pfmdr1 N86Y, Y184F and D1246Y in the Northern part of Nigeria as well as Dokomajilar et al. (35) after treatment with ACT.

The high prevalence of malaria in this Institution in spite of various efforts to curb it, led to assessment molecular markers that may play a role in anti-malarial resistance. From the forthgoing, it can be said that other factors that were not assessed by this study may contribute to high prevalence of malaria in this Institution.

This study was carried out in order to contribute to the ongoing surveillance of
resistance to current anti-malarial drugs as recommended, by WHO (36), to track the emergence and spread of P. falciparum resistance in malaria management.

The overall malaria prevalence in the study was 20.59% (70), which proves that malaria remains a major health problem in the area with Plasmodium falciparum as the predominant species in the study area. Improving the habits of mosquitos Nets and Insecticides usage in the community through health information dissemination may help to prevent transmission. Although, Pfmdr gene was not amplified by the primers used in this study, further research with diver forms of primers are needed to be carried out in order to detect the presence of Pfmdr gene and the other genes responsible for the antimalarial resistance.

P. falciparum – Plasmodium falciparum

DNA – Deoxyribonucleic Acid

Pfmdr – Plasmodium falciparum multidrugs resistance

Pfcrt – Plasmodium falciparum chloroquine resistance transporter

Pfdhfr – Plasmodium falciparum dihydrofolate reductase

Pfdhps – Plasmodium falciparum dihydropteroate synthase

PfKelchl3 – Plasmodium falciparum Kelch l3

ACT – Artemisinin Combination Therapy

WHO – World Health Organization

Ethics approval and consent to participate

Ethical approval for the study was obtained from Nigeria Institute of Medical Research (NIMR), Yaba, Lagos State. At the beginning of the study, the aims and procedures of the project was fully explained to the students and written informed consent was obtained from the volunteers.

Consent for Publication

All authors have given their consent for the publication of this article in your journal.
Availability of data and materials

The authors consent that the data used in this study are available and will be provided if requested by the editor.
Competing interests

All authors declare that there is no conflict of interest as regards this study.
Funding
All authors declare that the research was self-funded, and was not funded by any organization/institution.
Authors' Contributions

Adebayo Dorcas and Nwaoha Esther: Carried out the research, wrote the main manuscript and analyzed some data; Azeez G. Ibrahim: Supervised the project, corrected the article, plotted tables and patterns; Omolola Bassey: Supervised the project. All authors reviewed the manuscript.

Acknowledgements
We wish to appreciate the participants for taking part in the study, Prof Onikepe Folarin from Redeemer University, Ede who permitted us to carry out the molecular aspect of the study in her laboratory and Miss Oluwakemi Taylor for her technical assistance.

World Malaria report 2022. WHO, 2022 World Health Organization 2022 www.who.int/news-room/fact-sheets/detail/malaria
Cowman, A. F., Healer, J., Marapana, D., & Marsh, K. (2016) Malaria: Biology and Disease. Cell, 167(3), 610–624. https://doi.org/10.1016/j.cell.2016.07.055
Centre for Diseases Control and Prevention. CDC, 2022 www.cdc.gov/malaria/about
Centre for Diseases Control and Prevention. CDC, 2020 www.cdc.gov/malaria/about/biology
Phillips, M., Burrows, J., Manyando, C., van Huijsduijnen, R., Van Voorhis , W.C. & Wells, T.N.C. (2017) Malaria. Nat Rev Dis Primers3, 17050.
Sinha S, Medhi B and Sehgal R: Challenges of drug-resistant malaria. Parasite, 2014, 21, 61.
Bopp, S. E. R., Manary, M. J., Bright, A. T., Johnston, G. L., Dharia, N. V., Luna, F. L., McCormack, S., Plouffe, D., McNamara, C. W., Walker, J. R., Fidock, D. A., Denchi, E. L., & Winzeler, E. A. (2013). Mitotic Evolution of Plasmodium falciparum Shows a Stable Core Genome but Recombination in Antigen Families. PLoS Genetics, 9(2), e1003293. https://doi.org/10.1371/journal.pgen.1003293
Culleton, R. L., & Abkallo, H. M. (2015). Malaria parasite genetics: doing something useful. Parasitology International, 64(3), 244–253. https://doi.org/10.1016/j.parint.2014.07.006
Veiga, M. I., Dhingra, S. K., Henrich, P. P., Straimer, J., Gnädig, N., Uhlemann, A. C., Martin, R. E., Lehane, A. M., & Fidock, D. A. (2016). Globally prevalent PfMDR1 mutations modulate Plasmodium falciparum susceptibility to artemisinin-based combination therapies. Nature Communications, 7(1). https://doi.org/10.1038/ncomms11553
Adamu, A., Jada, M. S., Haruna, H. M. S., Yakubu, B. O., Ibrahim, M. A., Balogun, E. O., Sakura, T., Inaoka, D. K., Kita, K., Hirayama, K., Culleton, R., & Shuaibu, M. N. (2020). Plasmodium falciparum multidrug resistance gene-1 polymorphisms in Northern Nigeria: implications for the continued use of artemether-lumefantrine in the region. Malaria Journal, 19(1). https://doi.org/10.1186/s12936-020-03506-z
Duffey M, Blasco B, Burrows J N, Wells T.N.C. Fidock D A and Leroy D. 2021. Assessing Risks of Plasmodium falciparum Resistance to Select Next-Generation Antimalarials Trends Parasitol. 2021 Aug; 37(8): 709–721. doi: 10.1016/j.pt.2021.04.006
Blasco, B., Leroy, D., Fidock, D.A. & BenjaminBlasco, D.L. 2017 Antimalarial drug resistance: linking Plasmodium falciparum parasite biology to the clinic. Nat
Med.23:917–28
Fançony C., Gamboa D., Sebastião Y., Hallett R., Sutherland C., Sousa-Figueiredo J.C., Nery S.V. Various pfcrt and pfmdr1 genotypes of Plasmodium falciparum cocirculate with P. malariae, P. ovale spp., and P. vivax in northern Angola. Antimicrob. Agents Chemother. 2012;56:5271–5277.
Das, S., Tripathy, S., Chattopadhayay, S., Das, B., Kar Mahapatra, S., Hati, A. K., & Roy, S. (2017). Progressive increase in point mutations associates chloroquine resistance: Even after withdrawal of chloroquine use in India. International Journal for Parasitology: Drugs and Drug Resistance, 7(3): 251–261. https://doi.org/10.1016/j.ijpddr.2017.06.002
Kituyi IR (2018) Malaria Prevalence and associated factors among children below the age five years attending Nakaloke Health Center Iii In Nakaloke Town Council, Mbale District (Doctoral dissertation, International Health Sciences University).
Afolayan T, Tanimowo WO, Ibrahim AG, Oduwa H (2023) Assessment of the Knowledge,Attitude, Practices and Malaria Prevalence among Undergraduates. Int J Trop Dis 6:069. doi. org/10.23937/2643-461X/1710069.
Humphreys GS, Merinopoulos I, Ahmed J, Whitty CJM, Mutabingwa TK, Sutherland CJ, et al. Amodiaquine and artemether-lumefantrine select distinct alleles of the Plasmodium falciparum mdr1 gene in Tanzanian children treated for uncomplicated malaria. Antimicrob Agents Chemother. 2007;51:991–7.
She, D., Wang, Z., Liang, Q., Lu, L., Huang, Y., Zhang, K., An, D., & Wu, J. (2020). Polymorphisms of pfcrt, pfmdr1, and K13-propeller genes in imported falciparum malaria isolates from Africa in Guizhou province, China. BMC Infectious Diseases, 20(1). https://doi.org/10.1186/s12879-020-05228-8
Duguma, T. A., Tekalign, E., Muleta, D., & Simieneh, A. (2022). Malaria prevalence and risk factors among patients visiting Mizan Tepi University Teaching Hospital, Southwest Ethiopia. PLOS ONE, 17(7), e0271771. https://doi.org/10.1371/journal.pone.0271771
Umaru, M. L., & Uyaiabasi, G. N. (2015). Prevalence of malaria in patients attending the general hospital Makarfi, Makarfi Kaduna–State, North-Western Nigeria. American journal of infectious Diseases and Microbiology, 3(1), 1-5.
Dayanand, K. K., Punnath, K., Chandrashekar, V., Achur, R. N., Kakkilaya, S. B., Ghosh, S. K., ... & Gowda, D. C. (2017). Malaria prevalence in Mangaluru city area in the southwestern coastal region of India. Malaria journal, 16, 1-10.
Ramdzan, A. R., Ismail, A., & Zanib, Z. M. (2020). Prevalence of malaria and its risk factors in Sabah, Malaysia. International Journal of Infectious Diseases, 91, 68-72.
Jenkins, R., Omollo, R., Ongecha, M., Sifuna, P., Othieno, C., Ongeri, L., ... & Ogutu, B. (2015). Prevalence of malaria parasites in adults and its determinants in malaria endemic area of Kisumu County, Kenya. Malaria journal, 14, 1-6.
Rulisa, S., Kateera, F., Bizimana, J. P., Agaba, S., Dukuzumuremyi, J., Baas, L., ... & de Vries, P. J. (2013). Malaria prevalence, spatial clustering and risk factors in a low endemic area of Eastern Rwanda: a cross sectional study. PloS one, 8(7), e69443.
Tadesse, F., Fogarty, A. W., & Deressa, W. (2018). Prevalence and associated risk factors of malaria among adults in East Shewa Zone of Oromia Regional State, Ethiopia: a cross-sectional study. BMC public health, 18(1), 1-8.
Abossie, A., Yohanes, T., Nedu, A., Tafesse, W., & Damitie, M. (2020). Prevalence of malaria and associated risk factors among febrile children under five years: a cross-sectional study in Arba Minch Zuria district, South Ethiopia. Infection and drug resistance, 363-372.
Tarekegn, M., Tekie, H., Dugassa, S., & Wolde-Hawariat, Y. (2021). Malaria prevalence and associated risk factors in Dembiya district, North-western Ethiopia. Malaria Journal, 20, 1-11.
Sultana, M., Sheikh, N., Mahumud, R. A., Jahir, T., Islam, Z., & Sarker, A. R. (2017). Prevalence and associated determinants of malaria parasites among Kenyan children. Tropical medicine and health, 45, 1-9.
Menard S, Morlais I, Tahar R, Sayang C, Mayengue P, Iriart X, et al. Molecular monitoring of Plasmodium falciparum drug susceptibility at the time of the introduction of artemisinin‑based combination therapy in Yaoundé, Cameroon: Implications for the future. Malar J. 2012;11:113.
Davlantes E, Dimbu PR, Ferreira CM, Florinda Joao M, Pode D, Félix J, et al. Efficacy and safety of artemether–lumefantrine, artesunate–amodiaquine, and dihydroartemisinin–piperaquine for the treatment of uncomplicated Plasmodium falciparum malaria in three provinces in Angola, 2017. Malar J. 2018;17:144.
Witkowski B, Nicolau M‑L, Soh PN, Iriart X, Menard S, Alvarez M, et al. Plasmodium falciparum isolates with increased pfmdr1 copy number circulate in West Africa. Antimicrob Agents Chemother. 2010;54:3049–51.
Mvumbi DM, Bobanga TL, Kayembe J‑MN, Mvumbi GL, Situakibanza HN‑T, Benoit‑Vical F, et al. Molecular surveillance of Plasmodium falciparum resistance to artemisinin‑based combination therapies in the Democratic Republic of Congo. PLoS ONE. 2017;12:e0179142
Nguetse CN, Adegnika AA, Agbenyega T, Ogutu BR, Krishna S, Kremsner PG, et al. Molecular markers of anti‑malarial drug resistance in Central, West and East African children with severe malaria. Malar J. 2017;16:217
Adamu Auwal, Jada Mahmoud Suleiman, Haruna Hauwa Mohammed Sani, Yakubu Bassa Obed, Ibrahim Mohammed Auwal, Balogun Emmanuel Oluwadare, Sakura Takaya, Inaoka Daniel Ken, Kita Kiyoshi, Hirayama Kenji, Culleton Richard and Shuaibu Mohammed Nasir. 2020. Plasmodium falciparum multidrug resistance gene-1 polymorphisms in Northern Nigeria: implications for the continued use of artemether-lumefantrine in the region. 19:439 https://doi.org/10.1186/s12936-020-03506-z
Dokomajilar C, Nsobya SL, Greenhouse B, Rosenthal PJ, Dorsey G. 2006. Selection of Plasmodium falciparum pfmdr1 alleles following therapy with artemether-lumefantrine in an area of Uganda where malaria is highly endemic. Antimicrob Agents Chemother. 50:1893–5.
WHO. Methods for surveillance of antimalarial drug efficacy. Geneva: World Health Organization; 2009

No competing interests reported.

Molecular Epidemiological Studies of pfmdr-1 Gene in Plasmodium falciparum Among Undergraduates in A Private University in Lagos State

Status:

Version 1

Abstract

Background

Method

Results

Conclusion

Figures

BACKGROUND

METHODS

STUDY SITE

MATERIALS

SAMPLE COLLECTION

SAMPLE SIZE

SELECTION CRITERIA

Inclusion and exclusion criteria

RESULTS

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1