Evaluation of sea cucumber protein paste for mice’s skin wound healing and its potential anti-inflammatory mechanism

doi:10.21203/rs.3.rs-5319952/v1

Download PDF

Research Article

Evaluation of sea cucumber protein paste for mice’s skin wound healing and its potential anti-inflammatory mechanism

https://doi.org/10.21203/rs.3.rs-5319952/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Natural substances with anti-inflammatory activity have always been the priority for human injuries. This study aims to investigate the beneficial effects and mechanism of sea cucumber protein (SCP) on wound healing, through a BALB/c mice model and LPS-induced RAW 264.7 cells. To find out how SCP paste works, we identified the mice's serum cytokines and tissue section. The alteration of the NF-κB pathway during the anti-inflammatory effect of SCP was also explored. The results showed that the wound healing rate in the SCP(H) group exceeded 90%, whereas it was 72.91% and 64.10% in the Control and NC groups on day 14. New blood vessels and fibroblasts were generated in the wounds. Collagen expression increased by 13.89% and 15.12% respectively in the SCP(L) and SCP(H) groups compared with the Control group on day 14. Furthermore, SCP decreased the levels of pro-inflammatory factors (TNF-α, IL-1β, IL-6) in mice’s serum while up-regulating the level of anti-inflammatory factor (IL-10) during the healing process. Furthermore, SCP suppressed the NF-κB pathway by decreasing protein levels of phosphorylated p65 and IKKα, and increasing protein levels of IκBα.

Sea cucumber protein

Wound

Mice

Anti-inflammation

NF-κB

The process of healing a wound is intricate and necessitates the coordination of several different events [13]. Four periods can be distinguished amongst these events: bleeding and clotting, inflammation, proliferation, and remodeling [24, 52]. Immediately after an injury occurs, clotting begins first. Platelets clump together and clots appear, which prevents the wound from bleeding. Then comes the inflammatory phase. Derived from neutrophils and monocytes, macrophages quickly travel to wounded skin to eradicate pathogens and microorganisms. This process occurs simultaneously with hemostasis as an early stage of wound healing [7]. By the late stage of the inflammatory response, macrophages switch from M1 to M2-type, which slows down the process and speeds up wound healing [6]. Granulation tissue is induced to form by fibroblasts after the inflammatory response is reduced. Stimulated by multiple cytokines, fibroblasts differentiate into myofibroblasts and promote vascular synthesis [32].

Anti-inflammation thus emerges as the key factor in wound healing. Inflammation is a pervasive, interconnected, and complex process triggered by a variety of infections, toxins, or irritants. However, excessive or prolonged occurrence may result in tissue damage [46]. So it is necessary to suppress the inflammatory period during the wound healing process. Many studies have shown that wound healing can be sped up by inhibiting the inflammatory response. A single-stranded RNA molecule has been found to inhibit the expression of pro-inflammatory factors, which in turn suppresses the inflammatory response and facilitates wound healing [3]. Some compounds taken from Caesalpinia sappan L. help wounds heal faster by stopping the production of NO, PGE2, and TNF-α. The substances stimulate collagen synthesis and proliferation of L929 fibroblast [37]. Resveratrol, a polyphenol compound, has anti-inflammatory, wound-healing, collagen-forming, and scar-preventing properties [48].

Food-borne active factors are always preferred in injury treatments. They are safe without cytotoxicity [2, 17] and do not cause liver damage [39, 45], hereditary damage, biochemical alterations, and histological changes [33]. Those substances generally achieve their anti-inflammatory effects through the NF-κB pathway. Cannabis sativa L. extract and cannabidiol inhibited the release of inflammatory mediators and inflammatory processes. The action of this pathway was found via the nuclear factor-kappa B (NF-κB) pathway [26]. NF-κB, the heterodimeric transcription factor, is a key mediator of the cellular response to injury and stress [10]. Normally, IκB proteins are associated with NF-κB and located in the cytoplasm of unstimulated cells. IκB is phosphorylated by IκB kinase upon stimulation, then ubiquitinated, and eventually destroyed within the proteasome. Subsequently, NF-κB is liberated and relocated to the nucleus, where it can stimulate transcription factors. After that, NEMO, a part of the IKK regulatory complex, connects with ATM (ataxia-telangiectasia mutated kinase). They induce the phosphorylation of NEMO, which results in the translocation of this complex from the nucleus to the cytoplasm. It binds to the cytoplasmic IKK complex, which includes IKKa and IKKb, and activates it. IKK phosphorylates IκB, which causes it to degrade, translocate to the nucleus, and activate NF-κB. [8].

In this study, a single protein was isolated from the body well of sea cucumber and named SCP. The promoting function of SCP in wound healing was investigated through a mouse wound model. Subsequently, several inflammatory factors were measured in RAW264.7 cells to explore the anti-inflammatory efficacy of SCP. Finally, to explore the mechanism of SCP in wound healing, the expression of mRNA of those factors was examined.

Materials

The fresh sea cucumbers (S. japonicus) were purchased from the local (Dalian, China) and then transported to the lab in ice-cold seawater in less than 30 minutes. Beyotime Biotechnology (Shanghai, China) supplied the goat antirabbit IgG-HRP, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) protein loading buffer, and tris-glycine protein electrophoresis buffer. Solarbio Life Science Co., Ltd. (Beijing, China) is the supplier of the BCA protein concentration assay kit. We acquired RAW264.7 cells from Saibekang (Shanghai) Biotechnology Co. Male BALB/c mice (five-week-old, 20 ± 2 g, specific pathogen-free) were purchased from Chang Sheng Biotechnology (Benxi, China). Erythromycin and casein were purchased from Macklin Reagent (Shanghai, China). All chemicals used in this study were of analytical grade or above.

Preparation of SCP paste

Extraction of protein

The sea cucumbers were rinsed with deionized water and smashed into a slurry, following the removal of their viscera. Subsequently, The homogenate was then treated with 3% (W/V) potassium hydroxide solution to adjust it to pH 10. Once the pH reached 10, the liquid was incubated at 4 ℃ for 12 h. The supernatant was adjusted by HCl to pH 4.8 after centrifuging at 7100 g for 30 min. The supernatant was centrifuged at 7100 g again for 30 min to obtain the residue. The residue was dissolved in 0.5 mL of distilled water by stirring with a magnetic mixer at 4 ℃ for 12 h. Eventually, the above sample was dialyzed in a 3500 Da cutoff dialysis bag for three days. Then the crude sea cucumber protein was prepared.

Purification of the crude sea cucumber protein

A pH 7.4 Tris-HCl solution containing 1.5 mL and 20 mmoL was used to dissolve 100 mg of crude sea cucumber protein. After that, the mixture was refined with a DEAE-52 column (3 × 80 cm). 20 mmoL of Tris-HCl solution was used for the elution process, which was carried out at a rate of 0.2 mL/min and a pH of 7.4. An ultraviolet (UV) spectrophotometer (PerkinElmer, Shanghai, China) was used to separate and identify the products at 280 nm. The tubes with the highest absorbance were gathered together. Subsequently, after dialyzing for three days with a 3500 Da cutoff dialysis bag, the sea cucumber protein (SCP) was collected and freeze-dried.

Infrared and Ultraviolet spectra analysis of SCP

SCP of 1.0 mg was mixed with potassium bromide powder, grounded, and pressed into tablets. The samples were scanned in the infrared using a Perkin-Elmer spectrophotometer (PerkinElmer, Shanghai, China) at the wavelength range of 400–4000 cm-1. Meanwhile, the UV spectrophotometer (PerkinElmer, Shanghai, China) was used to scan a 1.0 mg/mL solution of SCP at the wavelength range of 190–400 nm.

Production of SCP paste

SCP paste was prepared by dissolving 1.0 g SCP into 1.0 g distilled water, then adding 97.0 g petroleum jelly, and 1.0 g sodium dodecyl sulfate (SDS). The SCP paste was obtained after blending under 4 ℃.

Wound healing experiment in vivo

Wound healing model in BALB/c mice

Ninety male BALB/c mice were randomly assigned to five groups (n = 18) and kept in cages with certain conditions for a week (temperature: 22 ± 2°C, humidity: 40–60%, 12-hour light/dark cycle) The animal experiments were conducted following the guidelines of the Animal Ethics Committee of Dalian Polytechnic University (license B2015-046). Firstly, mice were given anesthesia. Then, a hole puncher was used to injure a circular, all-over skin area in the center of the mouse's spine, with a diameter of roughly 0.7 cm. The groups were dubbed the blank group, the erythromycin ointment group also known as a positive control (PC), the casein ointment group (containing 0.5% (w/w) casein) also called the negative control (NC), the 0.5% (w/w) SCP group, and the 1.0% (w/w) SCP group. The treatment agents of 0.5 g were spread on the wound of the corresponding group individuals, including of SCP, PC, and NC groups once a day. The mice were sacrificed respectively on days 3, 7, and 14.

Histological analysis

The impact of SCP on the model mice's ability to repair wounds was examined using the Masson and H&E staining. Skin tissue was removed from mice as soon as possible after they died, and it measured about 3.0 mm thick from the edge of the wound. After that, the samples were preserved for more than 24 hours in 4% paraformaldehyde. All of the samples were cut into 5 mm thick slices and submerged in paraffin wax before being ready for H&E and Masson staining according to Zhao [49].

Enzyme-linked immunosorbent assay (ELISA)

The amounts of IL-Iβ, IL-6, TNF-α, and IL-10 in the mouse serum were measured following the ELISA kit's instructions (Nanjing Jianjian Bioengineering Institute, Nanjing, China). In short, mouse serum was centrifuged at 1000 g for 20 minutes after clotted spontaneously for 15 min at room temperature. The supernatant was then collected. Collected supernatant and 100 uL of enzyme labeling reagent were added to 96-well plates, respectively. It was incubated at 37 ℃ for 60 min before dispensing and washing. The 50 uL of colorant was added to every well sheltered from light at 37 ℃ for 15 min. Finally, a microplate reader (Infinite M200, Tecan Infinite, Switzerland) was used to evaluate the absorbance at 450 nm.

Cellular healing pathways in vitro

MTT assay

Mouse RAW264.7 cells at the logarithmic growth phase were inoculated in a 96-well plate. After that, the cells were placed at a density of 1 × 10⁴ cells per well in 100 µL of DMEM culture solution with 10% fetal bovine serum, and left to incubate for 12 h. The experimental group was then treated with DMEM containing varying concentrations of SCP (25, 50, 100, 125, 150, 175, 200 µg mL^− 1). While the control group was treated with 100 µL of serum-free DMEM. Each treatment group has 6 replicates. Following a 24-hour incubation period at 37°C, 20 µL of 5 mg/mL MTT was added into each well and incubated for an additional 4 hours. Next, 150 µL of dimethyl sulfoxide (DMSO, Solarbio Life Science, Beijing, China) was added to the medium as a replacement. The absorbance was measured at 490 nm using a microplate reader (Infinite M200, Tecan Infinite, Switzerland).

Nitric oxide (NO) release assay

The concentrations of nitrite in the cell culture supernatant were measured using the NO release assay. RAW264.7 cells were seeded in a 96-well plate (1 × 10⁵ cells/mL) and cultured for 12 h with 100 µL of DMEM solutions containing 10% fetal bovine serum. After that, the medium in each group of wells was replaced. DMEM solution of 100 µL containing 10% fetal bovine serum was added to the control group. DMEM solution of 100 µL containing 10 µg/mL Lipopolysaccharides (LPS) was added to the LPS-induced group. DMEM solution of 100 µL containing 10% fetal bovine serum, SCP with concentrations of 25, 50, 100, 125, 150, 175, and 200 µg/mL was added to the test groups. Every group has 6 replicate wells. After incubating at 37°C for 12 h, the supernatant was collected to determine the absorbance at 540 nm by a microplate reader (Infinite M200, Tecan Infinite, Switzerland).

RT-qPCR

RAW264.7 cells (1 × 10⁶ mL^− 1) were cultured with DMEM medium in a 6-well plate for 24 h. The Trizol Reagent kit (BBI Life Sciences, Shanghai, China) was used to extract total RNA after 24 hours of dSCP treatment following the manufacturer's instructions. The RNA purity was confirmed by measuring the absorbance and obtaining an OD260/280 nm ratio of 1.8–2.2. The reverse transcription of cDNA was synthesized from the total RNA with the PrimeScript RT Reagent Kit (Takara, Shiga, Japan). The primer sequences are shown in Table 1.

Table 1

The primer sequence of the gene
	Forward (5′→3′) sequence	Reverse (5′→3′) sequence
β-actin	CTACCTCATGAAGATCCTGACC	CACAGCTTCTCTTTGATGTCAC
TNF-α	ATGTCTCAGCCTCTTCTCATTC	GCTTGTCACTCGAATTTTGAGA
IL-6	CTCCCAACAGACCTGTCTATAC	CCATTGCACAACTCTTTTCTCA
IL-10	TTCTTTCAAACAAAGGACCAGC	GCAACCCAAGTAACCCTTAAAG
IL-Iβ	CACTACAGGCTCCGAGATGAAC	TCCATCTTCTTCTTTGGGTATTC

[Table 1]

Western blot

DMEM medium was used to seed 1 × 10^{^}6 cells in a 6-well plate for 24 hours. Various concentrations of SCP were substituted for the previous medium, and cultured for another 24 h. Radio-immunoprecipitation assay lysis buffer (RIPA, Beyotime, Shanghai, China) was used to lyse cells on ice. The extraction of total protein was following the instructions of the RIPA kit. The BCA kit (Solarbio Life Science, Beijing, China) was used to evaluate the protein concentration. After that, the protein and SDS-PAGE loading buffer were combined and boiled for 10 min. Following electrophoresis, 10 µL of total proteins were separated using 10% SDS-PAGE and then transferred to PVDF membranes. For an hour, membranes were sealed at room temperature using 5% defatted milk. After that, primary antibodies of NF-κB p65, p-NF-κB p65, IκBα, IKKα, β-actin were added to the milk and left overnight at 4°C (1:1000). β-actin was used as the internal reference when evaluating the protein band intensity using ImageJ software.

Statistical analysis

The experimental data from all studies were presented as mean ± standard deviation (SD). Statistical significance of data was performed by IBM SPSS Statistics 23. P-value < 0.05 was deemed significant. Graphic abstract was conducted by means of the FigDraw platform.

Infrared and ultraviolet spectral analysis

The strong and broad absorption peaks at 3500 − 3150 cm^− 1 in Fig. 1A are the superposition of O-H stretching vibration and N-H stretching vibration. It indicates the presence of intramolecular hydrogen bonding, intermolecular hydrogen bonding, and an amino group [1]. Those can be the characteristic absorption peaks of proteins. The absorption peaks at 2936 cm^− 1, 1646 cm^− 1, 1544 cm^− 1, and 1290 cm^− 1 are the alkyl group, carboxyl groups, CH/C double bond, and stretching vibration of S = O in the sulfate group, respectively [23, 36]. The strong and sharp absorption at 1036 cm^− 1 indicates the presence of a pyran ring [22].

The UV spectral analysis of SCP showed the maximum light absorption at a wavelength of 198 nm (Fig. 1B). It is consistent with the reported absorption characteristics of protein in the UV band [44]. The weak absorption peak absence at 280 nm suggests that SCP contains little phenylalanine and tyrosine. This is consistent with the previous findings [35]. No other absorption peaks were observed in the UV absorption pattern of SCP, which indicates that the SCP was pure.

[Figure 1]

SCP paste improved the wound healing rate in mice

The wound surface and skin endothelium recovered rapidly after treatment with SCP ointment (Fig. 2A). On day 3, the wound healing rate was 27.18% ± 0.33% in the PC group, 30.94% ± 2.51% in the SCP(L) group, and 33.82% ± 1.32% in the SCP(H) group. SCP(H) group was significantly different (P < 0.05) compared with the control group (wound healing rate of 14.32% ± 2.38%) (Fig. 2B). On day 14, the wounds of the SCP(H) group were almost healed, with a healing rate of 90.51% ± 1.99%. The SCP(L) group and the PC group showed a healing rate of 84.08% ± 1.44% and 81.81% ± 1.39%, respectively. However, the healing rate in the Control group (72.91% ± 4.81%) and the NC group (64.10% ± 6.08%) showed tardiness for healing. The application of SCP ointment effectively accelerated the healing speed compared with the control group, with no formation of hyperplastic scar and keloid. Therefore, SCP ointment can promote wound healing.

[Figure 2]

Histological analysis

In Fig. 3A, the infiltration of inflammatory cells (I means inflammatory cells) in the sub-epidermal layer of the wound site decreased throughout the 14-day test. On day 3, the density of inflammatory cells infiltration in the SCP(L) and SCP(H) groups was much less than that of the Control group. On day 7, the SCP-treated groups showed a similar number of inflammatory cells to the PC group. On day 14, the SCP-treated groups decreased faster than the Control group. New blood vessel (V means new blood vessel) growth and fibroblast proliferation (F means fibroblast) matter during the wound healing process. On day 3, only a few new blood vessels and fibroblasts were found in the Control group (Fig. 3A). However, many of them were discovered in the SCP-treated groups. On day 14, many new blood vessels and fibroblasts were found to grow in the SCP-treated groups, with a larger amount and a faster speed than those in the Control group. From day 3 to 14, the epithelial tissue thickness (the triangles) of SCP-treated groups (Fig. 3B) was significantly increased compared with the Control group (P < 0.05). Compared with the NC group, two SCP-treated groups all showed an exclusive capacity to accelerate epithelial cell recovery. The external application of SCP reduces the number of inflammatory cells and stimulates fibroblast proliferation and differentiation accompanied by the growth of new capillaries.

To investigate the conditions of collagen accumulation, Masson staining was done on the wound trauma tissue of mice (Fig. 4A). After Masson staining, collagen fibers showed blue color and myofibers were red. The amount of collagen fibers gradually increased in all groups with the time extension. The quantitative analysis of collagen is shown in Fig. 4B. Collagen expression increased by 15.12% and 13.89% respectively in the SCP(H) and SCP(L) groups compared with the Control group on day 14 (Fig. 4B). On the 14th day after modeling, the collagen content in the SCP(H) group was as high as 45%. It was second only to that of the PC group. In terms of the overall trend from 3 to 14 days, collagen formation in the SCP(H) group was facilitated by 23.22% on the 14th day compared with the third day. The results indicated that SCP accelerated tissue regeneration by promoting collagen deposition during wound healing, allowing collagen fibers to be arranged in an orderly manner. In addition, the results of Masson staining were consistent with those of H&E staining. Those results showed that the SCP(H) group promoted the formation of collagen in the granulation tissue and accelerated wound contraction.

[Figure 3]

[Figure 4]

Effect of SCP on inflammatory factors in mouse serum

To assess the inflammation occurrence during trauma recovery, this study determined the release of inflammatory factors in the mice’s serum. The levels of anti-inflammatory and pro-inflammatory factors in the serum are shown in Fig. 5. The level of the tumor necrosis factor (TNF)-α in serum gradually decreased from day 3 to day 14 (Fig. 5A). This trend was also observed in the expression of IL-6 and interleukin (IL)-1β (Fig. 5B-C). On day 14, the expression levels of TNF-α, IL-1β, and IL-6 in the SCP-treated groups were significantly lower than those in the Control and NC groups (P < 0.05). The expression levels of TNF-α, IL-1β, and IL-6 were 0.41-fold, 0.50-fold, and 0.61-fold in the SCP(H) group compared with the Control group, respectively. On day 14, the levels of IL-1β and IL-6 in the SCP(H) group were similar to the PC group (P > 0.05). In addition, the interleukine-10 (IL-10) expression levels in the SCP-treated groups were significantly higher than in the Control and NC groups (P < 0.05). This result was consistent with that in the PC group. At day 14, the IL-10 expression level of the SCP(H) group increased 1.65-fold compared with the Control group. SCP effectively modulates the immune system to reduce pro-inflammatory factors TNF-α, IL-1β, and IL-6 while increasing the production of anti-inflammatory factor IL-10.

[Figure 5]

Effects of SCP on RAW 264.7 cells viability and the Nitric oxide (NO) production

The cytotoxic effect of SCP on RAW 264.7 cells was measured by MTT assay. SCP was safe for the RAW 264.7 cells within or equal to the concentration of 100 µg/mL (Fig. 6A). However, the cell viability decreased significantly when the SCP concentration was reached and greater than 125 µg/mL. Lipopolysaccharides (LPS, 10 µg/mL) treatment significantly increased NO production to about 11-fold compared with the Control group (Fig. 6B). However, the level of NO was reduced significantly after the addition of SCP. The lowest level of NO (9.60 mM) was observed when the application of SCP was 100 µg/mL. The NO level was reduced by 53.04% compared to the LPS-induced group.

[Figure 6]

Effect of SCP on inflammatory factors’ production in LPS-induced RAW264.7 cells

The SCP effect on the mRNA expression of inflammatory factors was investigated in LPS-induced RAW 264.7 cells (Fig. 7). After the RAW 264.7 cells were induced by 10 µg/mL LPS, the mRNA relative expression of TNF-α, IL-6, and IL-1β increased significantly (P < 0.05). By contrast, the SCP treatment significantly reduced the relative mRNA expression levels of TNF-α, IL-6, and IL-1β in the LPS-induced cells (Fig. 7A-C) (P < 0.05). In addition, the SCP treatment increased IL-10 expression level significantly (Fig. 7D). The relative mRNA expression level of IL-10 was 2.4 folds of the LPS group when the concentration of SCP was 100 µg/mL. The results suggest that SCP alleviated the LPS-induced inflammatory response in the RAW 264.7 cells.

[Figure 7]

Effect of SCP on NF-κB pathway in LPS-induced RAW 264.7 cells

After the inducement of LPS (10 µg/mL), the protein expression level of p-p65/p65 was significantly increased in the cells (P < 0.05), while the SCP treatment decreased it (Fig. 8B). At the SCP concentration of 100 µg/mL, the level of phosphorylated p65 decreased by 41.18% compared with LPS-induced treatment (Fig. 8B). IκBα protein level was significantly increased (P < 0.05) after the LPS (10 µg/mL) inducement. However, it was increased dose-dependently with the SCP application promotion (Fig. 8C). In contrast, the IKKα protein level was significantly reduced after the SCP treatment, and the lowest level was observed at the SCP concentration of 100 µg/mL (Fig. 8D).

[Figure ]

In a previous study, the protein (SCP) was extracted from the body wall of the sea cucumber. It showed an ideal capability of wound healing promotion in BALB/c mice after oral administration [35]. However, open wounds need urgent treatment to avoid deep scars in some situations. Therefore, in this study, the external application of SCP on wound healing was tested.

Not all natural proteins come with wound healing properties. Currently, only a few natural proteins can achieve wound healing function. They are collagen and its hydrolysates, elastin and its derivatives, keratin, and Silk fibroin [9, 27, 40, 47]. Nevertheless, whether our protein can play the same role as those and how the protein exerts its function is unknown. In this study, the functional sea cucumber protein (SCP) was tested for the wound healing function by external application treatment. SCP was a homogenous protein and the molecular weight was calculated as 70 kDa [35]. The IR and UV spectral results confirmed the protein composition and the purity characteristic of SCP. BALB/c mice wound model was established and the SCP paste was applied to the wound surface. SCP(H) group showed the highest healing rate, and the wound healing rate was better than the positive control group till day 14. On day 14, the SCP(H) groups showed accelerated healing of 8.7% over the PC group (Fig. 2). For comparison propose, the casein ointment was used as a negative control. Casein is a routine food protein and the test results showed that casein does not affect wound healing. These results demonstrated that not all proteins can accelerate wound healing and the SCP is a functional protein for wound healing.

The skin wound healing process involves the following interpenetrating phases: hemostasis, inflammation, proliferation, re-epithelialization, and remodeling [50]. Initially, neutrophils and monocytes move quickly to the site of the wound, where they undergo differentiation into macrophages in order to eradicate infections and microbes. [11]. The study of serum inflammatory variables in the mice demonstrated that the pro-inflammatory factors, such as TNF-α, IL-1β, and IL-6, decreased as a result of the SCP intervention. However, anti-inflammatory molecules including interleukins (IL)-10 were encouraged (Fig. 5). As an anti-inflammatory agent, IL-10 shields tissues from over-inflammation. [5]. The reaction of immune systemto dangerous stimuli, like infections and damaged cells, is inflammation. But unchecked acute inflammation can develop into a chronic condition and lead to a severe inflammatory illnesses [51]. Hence, the anti-inflammatory function during wound healing becomes essential. The topical medication therapy of SCP resulted in an anti-inflammatory response in the mice’s serum (Fig. 5). So SCP prevents the inflammatory response from getting worse so that benefiting wound healing.

New blood vessels and fibroblasts in the SCP groups were found to grow faster than those in the Control group (Fig. 3). Keratinocytes move to bridge the wound gap, blood vessels regenerate by angiogenesis, and fibroblasts replace the original fibrin clot with granulation tissue, during the proliferative phase [43]. SCP-treated groups accelerated the generation of new blood vessels, granulation tissues, and fibroblasts. That indicated that SCP promoted the proliferative phase during wound repair. The generation of the above substances is the transition from inflammation into proliferation [28]. The increase in epidermal thickness is an important indicator of re-epithelialization [20]. The increase in epidermal thickness in the SCP-treated groups was significantly higher than that in both the Control group and the NC group (Fig. 3B), from day 3 to day 14. Collagen, a component of the connective tissue and the major protein of the extracellular matrix matters in wound healing [29]. About 80% of the collagen in adult skin is type I collagen and only 10% is type III collagen. A fibrin clot initially forms at the start of remodeling, and it concludes several years later with the development of a mature scar rich in type I collagen. [16]. The appearance of large collagen deposits signifies that wound healing has drowned to a close - remodeling [28]. Compared with the PC group, collagen formation in the SCP(H) group was promoted by 106% on day 14 than on day 3 (Fig. 4B). That indicates that SCP accelerated the function of collagen expression. Thus, SCP paste accelerated the transition of mice’s wound healing from the inflammatory to the remodeling.

The macrophages deeply involve the repair of the skin wound. During wound healing, macrophages release pro-inflammatory factors to engulf pathogens [25, 42]. But after that, some macrophage subsets, like profibrotic macrophage, will show up. Then, they impulse collagen deposition and excessive extracellular matrix components, resulting in fibrosis [19, 38]. Macrophages are one of the core participants orchestrating the inflammatory response at the wound site [15, 34]. RAW 264.7 cells are widely adopted as the immune response model and they simulate the injury process as a macrophage model in this study. SCP was safe for the RAW 264.7 cells within or equal to the concentration of 100 µg/mL (Fig. 6A). NO production in the SCP group was significantly reduced by 53.04% compared with that of the LPS-induced group under this concentration (Fig. 6B). One signaling molecule that is essential to the pathophysiology of inflammation is nitric oxide (NO). It is thought to be a pro-inflammatory mediator that causes inflammation through overproduction in aberrant circumstances. [30]. The NO reduction effect by SCP in the cell model indicated that SCP has the capability of anti-inflammatory. Likewise, the main ingredients of ginger were also found to have anti-inflammatory effects by inhibiting the production of nitric oxide (NO) [31]. Reducing NO levels by SCP can benefit wound healing. Similarly, the relative mRNA expression of pro-inflammatory cytokines, including TNF-α, IL-6, and IL-1β, in the LPS-induced cells was significantly reduced after SCP treatment (Fig. 7A-C). While the expression of IL-10 was significantly increased (Fig. 7D). They are all cytokines, including pro- and anti-inflammatory cytokines, and are predominantly released from immune cells, such as macrophages. The aforementioned occurrences all supported the theory that SCP reduces inflammation by encouraging the development of anti-inflammatory factors while suppressing the expression of pro-inflammatory factors, which facilitates the healing of wounds.

To reveal the signaling mechanism of SCP on wound healing-promoting, we examined the NF-κB signaling pathway in the cell model. Both infectious and non-infectious agents trigger inflammatory signaling pathways, most commonly the NF-κB pathways [4]. Activation of the classical NF-κB signaling pathway is largely dependent on IKK (IκB kinase) complex-mediated phosphorylation and degradation of IκBα. In the presence of an inflammatory stimulus, IKK is activated to add a phosphate group to the IκBα molecule, thereby contributing to its ubiquitination and degradation. This process releases the catalytic subunit of calmodulin protein kinase (IKK) immobilized on IκBα, which is regulated by inflammatory signals in its enzymatic activity. After the degradation of IκBα, NF-κB can enter the nucleus and transcribe inflammatory gene expression. Then inflammation happens [12, 14]. In this study, we observed that IκBα protein degradation was reduced, NF-κB p65 phosphorylation was intercepted, and the NF-κB signaling pathway was inhibited after SCP treatment (Fig. 8). The canonical nuclear factor κB (NF-κB) signaling drives inflammatory greatly affecting the outcomes of healing tissues [18, 21, 41]. So SCP restrains inflammation by regulating inflammatory factor-related genes to promote wound healing.

SCP extracted from sea cucumber shows a potential to promote wound healing. Research has demonstrated that utilizing an SCP external application can enhance the rate of wound healing in BALB/c mice. This is accomplished through the inhibition of the inflammatory response, a decrease in inflammatory cell infiltration, the facilitation of capillary angiogenesis on the wound surface, an increase in epithelial tissue thickness, and the promotion of collagen synthesis. SCP primarily inhibited the NF-κB signaling pathway, blocked the phosphorylation of NF-κB p65, and downregulated IκBα degradation to achieve its anti-inflammatory effects. SCP can be applied to the paste to accelerate wound healing.

CRediT authorship contribution statement

Xiaoyan Wang: Investigation, Writing - original draft.

Jinghe Sun: Investigation, Formal analysis.

Ke Liu: Supervision, Project administration.

Shuang Li: Methodology, Formal analysis.

Jun Zhao: Methodology, Formal analysis.

Jingfeng Yang: Supervision, Funding acquisition, Writing - review & editing.

Conflict of interest

The authors declare no competing financial interest.

Acknowledgments

This work was supported by the National Natural Science Foundation (32372399).

Alkrad JA, Mrestani Y, Stroehl D, Wartewig S, Neubert R (2003) Characterization of enzymatically digested hyaluronic acid using NMR, Raman, IR, and UV-Vis spectroscopies. J Pharm Biomed Anal 31(3):545–550. https://10.1016/s0731-7085(02)00682-9
Auffan M, Rose J, Orsiere T, De Meo M, Thill A, Zeyons O, Proux O, Masion A, Chaurand P, Spalla O, Botta A, Wiesner MR, Bottero J-Y (2009) CeO2nanoparticles induce DNA damage towards human dermal fibroblastsin vitro. Nanotoxicology 3(2):161–171. https://10.1080/17435390902788086
Ban E, Jeong S, Park M, Kwon H, Park J, Song EJ, Kim A (2020) Accelerated wound healing in diabetic mice by miRNA-497 and its anti-inflammatory activity. Biomed Pharmacother 121109613. https://10.1016/j.biopha.2019.109613
Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L (2018) Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9(6):7204–7218. https://10.18632/oncotarget.23208
Couper KN, Blount DG, Riley EM (2008) IL-10: the master regulator of immunity to infection. J Immunol 180(9):5771–5777. https://10.4049/jimmunol.180.9.5771
Das A, Sinha M, Datta S, Abas M, Chaffee S, Sen CK, Roy S (2015) Monocyte and macrophage plasticity in tissue repair and regeneration. Am J Pathol 185(10):2596–2606. https://10.1016/j.ajpath.2015.06.001
Eming SA, Martin P, Tomic-Canic M (2014) Wound repair and regeneration: mechanisms, signaling, and translation. Sci Transl Med 6(265):265–266. https://10.1126/scitranslmed.3009337
Flores RR, Clauson CL, Cho J, Lee BC, McGowan SJ, Baker DJ, Niedernhofer LJ, Robbins PD (2017) Expansion of myeloid-derived suppressor cells with aging in the bone marrow of mice through a NF-κB-dependent mechanism. Aging Cell 16(3):480–487. https://10.1111/acel.12571
Gaspar-Pintiliescu A, Stanciuc A-M, Craciunescu O (2019) Natural composite dressings based on collagen, gelatin and plant bioactive compounds for wound healing: A review. Int J Biol Macromol 138:854–865. https://10.1016/j.ijbiomac.2019.07.155
Gasparini C, Feldmann M (2012) NF-κB as a target for modulating inflammatory responses. Curr Pharm Design 18(35):5735–5745. https://10.2174/138161212803530763
Gurtner GC, Werner S, Barrandon Y, Longaker MT (2008) Wound repair and regeneration. Nature 453(7193):314–321. https://10.1038/nature07039
Karin M, Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol 18:621–663. https://10.1146/annurev.immunol.18.1.621
Labler L, Mica L, Härter L, Trentz O, Keel M (2006) Influence of V.A.C.-therapy on cytokines and growth factors in traumatic wounds. Zentralbl Chir 131:S62–67. https://10.1055/s-2006-921511
Lawrence T (2009) The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb Perspect Biol 1(6):a001651. https://10.1101/cshperspect.a001651
Leibovich SJ, Ross R (1975) The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum. Am J Pathol 78(1):71–100
Li J, Chen J, Kirsner R (2007) Pathophysiology of acute wound healing. Dermatol Clin 25(1):9–18. https://10.1016/j.clindermatol.2006.09.007
Lin W, Huang YW, Zhou XD, Ma Y (2006) Toxicity of cerium oxide nanoparticles in human lung cancer cells. Int J Toxicol 25(6):451–457. https://10.1080/10915810600959543
Liu T, Zhang L, Joo D, Sun S-C (2017) NF-κB signaling in inflammation. Signal Transduct Target Therapy 12https://10.1038/sigtrans.2017.23
Mamadou G, Charrueau C, Dairou J, Limas Nzouzi N, Eto B, Ponchel G (2017) Increased intestinal permeation and modulation of presystemic metabolism of resveratrol formulated into self-emulsifying drug delivery systems. Int J Pharmacol 521(1–2):150–155. https://10.1016/j.ijpharm.2017.02.036
Nguyen LTH, Ahn S-H, Choi M-J, Yang I-J, Shin H-M (2021) Puerarin Improves Dexamethasone-Impaired Wound Healing In Vitro and In Vivo by Enhancing Keratinocyte Proliferation and Migration. Appl Sci 11(19). https://10.3390/app11199343
Pan HW, Cui YH, Zeng JW (2014) NF-κB mediates the survival of corneal myofibroblast induced by angiotensin II. Investig Ophthalmol Vis Sci 55(7):4220–4228. https://10.1167/iovs.13-13735
Parvez FS, Haris I (1999) FTIR spectroscopic characterization of protein structure in aqueous and non-aqueous media. J Mol Catal B: Enzymatic 7(1–4):207–221. https://10.1016/s1381-1177(99)00030-2
Qi Y, Wang L, You Y, Sun X, Wen C, Fu Y, Song S, Foods (2022) 11 (6) https://10.3390/foods11060822
Reinke JM, Sorg H (2012) Wound repair and regeneration. Eur Surg Res 49(1):35–43. https://10.1159/000339613
Rodrigues M, Kosaric N, Bonham CA, Gurtner GC (2019) Wound Healing: A Cellular Perspective. Physiol Rev 99(1):665–706. https://10.1152/physrev.00067.2017
Sangiovanni E, Fumagalli M, Pacchetti B, Piazza S, Magnavacca A, Khalilpour S, Melzi G, Martinelli G, Dell'Agli M (2019) Cannabis sativa L. extract and cannabidiol inhibit in vitro mediators of skin inflammation and wound injury. Phytother Res 33(8):2083–2093. https://10.1002/ptr.6400
Sarangthem V, Singh TD, Dinda AK (2021) Emerging Role of Elastin-Like Polypeptides in Regenerative Medicine. Adv Wound Care 10(5):257–269. https://10.1089/wound.2019.1085
Savcı Y, Kırbaş OK, Bozkurt BT, Abdik EA, Taşlı PN, Şahin F, Abdik H (2021) Grapefruit-derived extracellular vesicles as a promising cell-free therapeutic tool for wound healing. Food Funct 12(11):5144–5156. https://10.1039/d0fo02953j
Schultz GS, Wysocki A (2009) Interactions between extracellular matrix and growth factors in wound healing. WOUND REPAIR REGENERATION 17(2):153–162. https://10.1111/j.1524-475X.2009.00466.x
Sharma JN, Al-Omran A, Parvathy SS (2007) Role of nitric oxide in inflammatory diseases. Inflammopharmacology 15(6):252–259. https://10.1007/s10787-007-0013-x
Shimoda H, Shan SJ, Tanaka J, Seki A, Seo JW, Kasajima N, Tamura S, Ke Y, Murakami N (2010) Anti-inflammatory properties of red ginger (Zingiber officinale var. Rubra) extract and suppression of nitric oxide production by its constituents. J Med Food 13(1):156–162. https://10.1089/jmf.2009.1084
Silambujanaki P, Bala Tejo Chandra C, Anil Kumar K, Chitra V (2011) Wound healing activity of Glycosmis arborea leaf extract in rats. J Ethnopharmacol 134(1):198–201. https://10.1016/j.jep.2010.11.046
Singh SP, Kumari M, Kumari SI, Rahman MF, Mahboob M, Grover P (2013) Toxicity assessment of manganese oxide micro and nanoparticles in Wistar rats after 28 days of repeated oral exposure. J Appl Toxicol 33(10):1165–1179. https://10.1002/jat.2887
Stefater JA, Rao S, Bezold K, Aplin AC, Nicosia RF, Pollard JW, Ferrara N, Lang RA (2013) Macrophage Wnt-Calcineurin-Flt1 signaling regulates mouse wound angiogenesis and repair. Blood 121(13):2574–2578. https://10.1182/blood-2012-06-434621
Sun JH, Song S, Yang JF (2022) Oral administration of sea cucumber (Stichopus japonicus) protein exerts wound healing effects via the PI3K/AKT/mTOR signaling pathway. Food Funct 13(19):9796–9809. https://10.1039/d2fo01372j
Sun Y, Gong G, Guo Y, Wang Z, Song S, Zhu B, Zhao L, Jiang J (2018) Purification, structural features and immunostimulatory activity of novel polysaccharides from Caulerpa lentillifera. Int J Biol Macromol 108:314–323. https://10.1016/j.ijbiomac.2017.12.016
Tewtrakul S, Tungcharoen P, Sudsai T, Karalai C, Ponglimanont C, Yodsaoue O (2015) Antiinflammatory and Wound Healing Effects of Caesalpinia sappan L. Phytother Res 29(6):850–856. https://10.1002/ptr.5321
Tosato MG, Maya Girón JV, Martin AA, Krishna Tippavajhala V, M. Fernández Lorenzo de Mele and, Dicelio L (2018) Comparative study of transdermal drug delivery systems of resveratrol: High efficiency of deformable liposomes. Materials Science & Engineering C-Materials for Biological Applications, 90 356–364. https://10.1016/j.msec.2018.04.073
Tseng MT, Lu X, Duan X, Hardas SS, Sultana R, Wu P, Unrine JM, Graham U, Butterfield DA, Grulke EA, Yokel RA (2012) Alteration of hepatic structure and oxidative stress induced by intravenous nanoceria. Toxicol Appl Pharmacol 260(2):173–182. https://10.1016/j.taap.2012.02.008
Wan X, Liu S, Xin X, Li P, Dou J, Han X, Kang I-K, Yuan J, Chi B, Shen J (2020) S-nitrosated keratin composite mats with NO release capacity for wound healing. Chem Eng J 400. https://10.1016/j.cej.2020.125964
Watson MR, Wallace K, Gieling RG, Manas DM, Jaffray E, Hay RT, Mann DA, Oakley F (2008) NF-kappaB is a critical regulator of the survival of rodent and human hepatic myofibroblasts. J Hepatol 48(4):589–597. https://10.1016/j.jhep.2007.12.019
Weiskirchen R, Weiskirchen S, Tacke F (2019) Organ and tissue fibrosis: Molecular signals, cellular mechanisms and translational implications. Mol Aspects Med 65:2–15. https://10.1016/j.mam.2018.06.003
Wilkinson HN, Hardman MJ (2020) Wound healing: cellular mechanisms and pathological outcomes. Open Biology 10(9):200223. https://10.1098/rsob.200223
Yang H, Yang S, Kong J, Dong A, Yu S (2015) Obtaining information about protein secondary structures in aqueous solution using Fourier transform IR spectroscopy. Nat Protoc 10(3):382–396. https://10.1038/nprot.2015.024
Yokel RA, Au TC, MacPhail R, Hardas SS, Butterfield DA, Sultana R, Goodman M, Tseng MT, Dan M, Haghnazar H, Unrine JM, Graham UM, Wu P, Grulke EA (2012) Distribution, elimination, and biopersistence to 90 days of a systemically introduced 30 nm ceria-engineered nanomaterial in rats. Toxicol Sci 127(1):256–268. https://10.1093/toxsci/kfs067
Zanoli L, Briet M, Empana JP, Cunha PG, Mäki-Petäjä KM, Protogerou AD, Tedgui A, Touyz RM, Schiffrin EL, Spronck B, Bouchard P, Vlachopoulos C, Bruno RM, Boutouyrie P (2020) Vascular consequences of inflammation: a position statement from the ESH Working Group on Vascular Structure and Function and the ARTERY Society. J Hypertens 38(9):1682–1698. https://10.1097/hjh.0000000000002508
Zhang Y, Sheng R, Chen J, Wang H, Zhu Y, Cao Z, Zhao X, Wang Z, Liu C, Chen Z, Zhang P, Kuang B, Zheng H, Shen C, Yao Q, Zhang W (2023) Silk Fibroin and Sericin Differentially Potentiate the Paracrine and Regenerative Functions of Stem Cells Through Multiomics Analysis. Adv Mater 35(20). https://10.1002/adma.202210517
Zhao CC, Zhu L, Wu Z, Yang R, Xu N, Liang L (2020) Resveratrol-loaded peptide-hydrogels inhibit scar formation in wound healing through suppressing inflammation. Regen Biomater 7(1):99–107. https://10.1093/rb/rbz041
Zhao L, Wang K, Li W, Soteyome T, Xiao H, Hu Z (2019) Protective effects of polyphenolic extracts from longan seeds promote healing of deep second-degree burn in mice. Food Funct 10(3):1433–1443. https://10.1039/c8fo02330a
Zhao X, Liang Y, Huang Y, He J, Han Y, Guo B (2020) Physical Double-Network Hydrogel Adhesives with Rapid Shape Adaptability, Fast Self‐Healing, Antioxidant and NIR/pH Stimulus‐Responsiveness for Multidrug‐Resistant Bacterial Infection and Removable Wound Dressing. Adv Funct Mater 30(17). https://10.1002/adfm.201910748
Zhou Y, Hong Y, Huang H (2016) Triptolide Attenuates Inflammatory Response in Membranous Glomerulo-Nephritis Rat via Downregulation of NF-κB Signaling Pathway, vol 41. KIDNEY & BLOOD PRESSURE RESEARCH, pp 901–910. 6https://10.1159/000452591
Zohdi RM, Zakaria ZA, Yusof N, Mustapha NM, Abdullah MN, MATERIALS RESEARCH PART B-APPLIED BIOMATERIALS (2011) Sea cucumber (Stichopus hermanii) based hydrogel to treat burn wounds in rats, vol 98. JOURNAL OF BIOMEDICAL, pp 30–37. 1https://10.1002/jbm.b.31828

No competing interests reported.

GA.png
Graphic abstract

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluation of sea cucumber protein paste for mice’s skin wound healing and its potential anti-inflammatory mechanism

Status:

Version 1

Abstract

Figures

Introductin

Materials and methods

Materials

Preparation of SCP paste

Extraction of protein

Purification of the crude sea cucumber protein

Infrared and Ultraviolet spectra analysis of SCP

Production of SCP paste

Wound healing experiment in vivo

Wound healing model in BALB/c mice

Histological analysis

Enzyme-linked immunosorbent assay (ELISA)

Cellular healing pathways in vitro

MTT assay

Nitric oxide (NO) release assay

RT-qPCR

[Table 1]

Western blot

Statistical analysis

Results

Infrared and ultraviolet spectral analysis

[Figure 1]

SCP paste improved the wound healing rate in mice

[Figure 2]

Histological analysis

[Figure 3]

[Figure 4]

[Figure 5]

Effects of SCP on RAW 264.7 cells viability and the Nitric oxide (NO) production

[Figure 6]

Effect of SCP on inflammatory factors’ production in LPS-induced RAW264.7 cells

[Figure 7]

[Figure ]

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1