lncRNA NEAT1 affects granulosa cell apoptosis and steroid biosynthesis via the miR-204-5p/ESR1 axis in ovarian aging

doi:10.21203/rs.3.rs-5325793/v1

Download PDF

Research Article

lncRNA NEAT1 affects granulosa cell apoptosis and steroid biosynthesis via the miR-204-5p/ESR1 axis in ovarian aging

https://doi.org/10.21203/rs.3.rs-5325793/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Long non-coding RNAs (lncRNAs) play an important role in ovarian aging by affecting the biological functions of granulosa cells (GCs) through multiple mechanisms. The lncRNA NEAT1 is significantly downregulated in aging ovaries; however, the exact regulatory mechanism has not been elucidated. In the current study, we aimed to investigate the effects of the lncRNA NEAT1 in GC functions during ovarian aging and explore its therapeutic potential. We observed that NEAT1 expression is downregulated in GCs of older patients with diminished ovarian reserve (DOR), which is closely associated with ovarian reserve function and assisted reproductive cycle outcomes. Functional assays revealed that NEAT1 promotes KGN cell proliferation by increasing the proportion of S-phase cells and inhibiting apoptosis. Bioinformatics analysis and a dual-luciferase reporter assay confirmed that NEAT1 acts as a miR-204-5p sponge and identified ESR1 as a miR-204-5p target gene, both of which were significantly differentially expressed in the GCs of older patients with DOR. Mechanistic experiments demonstrated that NEAT1 acts as a competitive endogenous RNA and adsorbs miR-204-5p through molecular sponging, which in turn promotes the expression of ESR1 and upregulates the expression of key enzymes (steroidogenic acute regulatory protein and cytochrome P450 family 19 subfamily A member 1) involved in steroid hormone synthesis. This induces estradiol biosynthesis and activates the downstream mitogen-activated protein kinase (MAPK) signaling pathway to promote the phosphorylation of extracellular signaling-related kinase and cyclic adenosine monophosphate response element binding protein, which affects the cell cycle and results in the promotion of proliferation and inhibition of apoptosis of KGN cells. Our results suggest that NEAT1 activates the downstream MAPK pathway through the miR-204-5p/ESR1 axis; regulates GC proliferation, apoptosis, and the cell cycle; and affects steroid biosynthesis. Therefore, NEAT1 represents a potential therapeutic target to delay ovarian aging.

lncRNA NEAT1

miR-204-5p

ESR1

Ovarian aging

Apoptosis

Proliferation

Steroid synthesis

The ovary, a key organ in the female reproductive system that performs both reproductive and endocrine functions, is the first to age. Ovarian aging is a natural physiological process, and a decline in ovarian function occurs at an accelerated rate after age 35 [1]. Poor lifestyle habits and environmental pollution accelerate ovarian aging, and together with the global delay in the age of female fertility [2], lead to reduced fertility, manifesting as an increased risk of infertility and adverse pregnancy outcomes [3]. Although hormone replacement therapy can alleviate the symptoms associated with estrogen deficiency, it fails to restore ovarian function and has little effect on fertility. Therefore, an in-depth study of the molecular mechanisms underlying ovarian aging and the exploration of effective therapeutic strategies are important for the protection of the reproductive health of women.

Granulosa cells (GCs), the key components of follicles, are the primary sites of estrogen synthesis. Communication and interaction between GCs and oocytes play a key role in oocyte development, maturation, and fertilization and are bidirectional [4]. During ovarian aging, GC dysfunction induces follicular atresia, which ultimately leads to a decrease in the number and quality of oocytes as well as in the level of related steroid hormones [5, 6]. Evidence suggests that the apoptotic, proliferative, and steroid hormone-synthesizing capacity of GCs play a central role in ovarian aging [7, 8]. Investigating the mechanisms that regulate the biological functions of GCs is crucial for a deeper understanding of the molecular basis of ovarian aging, and for identifying potential targets for the development of targeted therapeutic approaches.

Competing endogenous RNAs (ceRNAs) constitute a complex regulatory network in which non-coding RNAs such as long non-coding RNAs (lncRNAs) or circular RNAs and mRNAs share the same miRNA response elements, thus forming a competitive relationship to regulate each other's expression levels [9, 10]. Thus, ceRNAs play an important role in the regulation of gene expression. CeRNA-mediated regulation is involved in cell proliferation, differentiation, apoptosis, and other biological processes [11] and plays an important role in developing tumors and female reproductive endocrine diseases [12, 13]. As important transcriptional regulatory molecules in the ceRNA network, lncRNAs such as H19, HOTAIR, and MALAT1 affect biological functions, hormone synthesis, and secretion in GCs by regulating key signaling pathways, such as the PI3K/Akt and TGFβ/SMAD [14, 15] pathways. A previous study [16] showed that lncRNA NEAT1 expression is significantly reduced in GCs of women with diminished ovarian reserve (DOR) and can be used as a biomarker of ovarian aging; however, the specific molecular mechanism has not been fully elucidated.

In the current study, we collected clinical GC samples from older patients with DOR and constructed a ceRNA regulatory axis using bioinformatics to investigate the function and potential molecular mechanism of NEAT1 in ovarian aging. The results showed that NEAT1 acts as a molecular sponge to regulate the mitogen-activated protein kinase (MAPK) signaling pathway by adsorbing miR-204-5p and upregulating estrogen receptor 1 (ESR1), thereby inhibiting apoptosis, promoting cell proliferation, and affecting cell cycle and steroid biosynthetic functions in GCs. This study explored the potential role of ceRNAs in the development of ovarian aging from a novel perspective. The discovery of a therapeutic target may provide a new scientific basis for protecting women's reproductive health, and allow for future clinical applications.

Clinical sample collection

Twelve patients who underwent assisted reproductive technology (ART)-based assisted conception using an antagonist regimen at the Department of Reproduction and Genetics (Affiliated Hospital of Shandong University of Traditional Chinese Medicine) were included in the study. These included six patients with advanced DOR (age ≥ 35 years) and six young women with normal ovarian reserve (NOR). The diagnosis of DOR was based on the fulfillment of at least two of the following criteria [17]: (i) bilateral anterior follicle count (AFC) < 6, (ii) anti-Müllerian hormone (AMH) < 1.10 ng/mL; and (iii) basal follicle-stimulating hormone (FSH) of 10–40 mIU/mL. The NOR group included women with normal ovarian reserve but infertility due to male or tubal factors. Patients with structural malformations of the reproductive organs, endometriosis, other endocrine disorders (such as thyroid dysfunction and hyperprolactinemia), or chromosomal abnormalities were excluded from the study. Follicular fluid discarded after oocyte retrieval was collected, and GCs were extracted, purified via density gradient centrifugation [18], and immediately stored in a -80°C refrigerator. This study was approved by the ethics committee of the Department of Reproductive Medicine at the hospital and was registered in the China Clinical Trial Registry on October 30, 2021 (registration number: ChiCTR2100052522). Informed consent was obtained from all the patients.

Cell culture

The human ovarian GC tumor cell line KGN was purchased from Procell Life Science and Technology Co. (Wuhan, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F-12 medium (BasalMedia, Shanghai, China) supplemented with 10% fetal bovine serum (FBS; BasalMedia) and 1% penicillin-streptomycin solution (Biosharp, Hefei, China) in an incubator at 37°C with 5% CO₂.

Cell transfection

NEAT1 overexpression plasmid (OE-NEAT1), NEAT1 small interfering RNA (siRNA; si-NEAT1), ESR1 siRNA (si-ESR1), miR-204-5p mimics (mimics-miR-204-5p), miR-204-5p inhibitor (inhibitor-miR-204-5p), and the corresponding negative controls were obtained from Tsingke Biotech Co. Ltd. (Beijing, China). The plasmids, siRNA, and miR-204-5p mimics/inhibitors were transfected into KGN cells using Lipofectamine® 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The transfection efficiency was determined using quantitative reverse transcription PCR (RT-qPCR).

Fluorescence in situ hybridization (FISH)

A FISH Kit (RiboBio, Guangzhou, China) was used to analyze the subcellular localization of NEAT1. KGN cells were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100. Then, pre-hybridization buffer was added to the cells and incubated for 30 min, followed by overnight incubation in a hybridization buffer containing a fluorescein isothiocyanate (FITC)-labeled NEAT1 probe (Sangon Biotech, Shanghai, China). The cells were counterstained with DAPI (incubation for 8 min protected from light) and imaged under a laser confocal microscope (Leica, Germany).

Dual-luciferase reporter assay

Bioinformatic analysis predicted the downstream targets and complementary pairing sites of NEAT1 and miR-204-5p. Wild-type (NEAT1-WT or ESR1-WT) and mutant plasmids (NEAT1-MUT or ESR1-MUT) containing miR-204-5p binding sites were constructed and cloned into a pGL4 vector (Promega, Madison, WI, USA). KGN cells were co-transfected with the luciferase reporter plasmids, mimics-miR-204-5p, inhibitor-miR-204-5p, and the corresponding negative controls using Lipofectamine® 3000. After 48 h, the luciferase activity in the cells was measured using a Dual-Luciferase Reporter Gene Assay Kit (Promega, USA).

Cell counting kit-8 (CCK-8) assay

A CCK-8 Kit (Vazyme Biotech Co. Ltd., Nanjing, China) was used to analyze cellular activity. KGN cells were plated in 96-well plates at 4 × 10³ cells/well (100 µL/well). After cell adherence, 10 µL CCK-8 solution was added to each well and incubated at 37°C for 2 h in the incubator. Absorbance was measured at 450 nm using a multifunctional enzyme marker (Bio-Rad, Hercules, CA, USA).

EdU proliferation assay

Cell proliferation was assessed by measuring DNA synthesis using the EdU Cell Proliferation Kit (Beyotime, Shanghai, China). KGN cells were incubated with 500 µL EdU working solution for 2 h. The cells were then fixed with 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton-100 for 10 min, and the nuclei were stained with Hoechst 33342 for 10 min in the dark. Images were captured using a fluorescence microscope (Nikon, Tokyo, Japan).

Flow cytometric assay

Apoptosis was detected using the Annexin V-FITC/propidium iodide (PI) Apoptosis Detection Kit (Vazyme). KGN cells were collected, washed with phosphate-buffered saline (PBS), and resuspended in a binding buffer. Subsequently, the cells were stained with Annexin V-FITC and PI by incubating for 15 min in the dark. The cells were analyzed using a flow cytometer (BD, Franklin Lakes, NJ, USA).

The cell cycle was analyzed using a Cell Cycle and Apoptosis Detection Kit (Beyotime). KGN cells were fixed with pre-cooled PBS and 70% ethanol at 4 ºC overnight. The cells were then resuspended in PI staining solution for 30 min at 37 ºC protected from light and detected using a flow cytometer.

RT-qPCR

Total RNA was extracted from clinical GC samples and KGN cells using the Total RNA Extraction Reagent RNA Isolator (Vazyme). The concentration and purity of the extracted RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was reverse transcribed to cDNA using HiScript II Q RT SuperMix for qPCR (Vazyme). RT-qPCR was performed using a fluorescent quantitative PCR instrument (Bio-Rad) and the ChamQ SYBR® qPCR Master Mix (Vazyme). GAPDH or U6 were used as the reference genes, and the ^2−ΔΔCt method was used to quantify the expression level of RNAs. The specific primers used in this study were obtained from Sangon Biotech, and their sequences are listed in Table 1.

Table 1

Primer sequences for gene expression
Gene	Primer sequence (5'-3')
NEAT1	Forward: AGTGTGAGTCCTAGCATTG
NEAT1	Reverse: GAACTTCCTCCTCCTAAGC
hsa-miR-204-5p	Forward: CGCGTTCCCTTTGTCATCCT
hsa-miR-204-5p	Reverse: AGTGCAGGGTCCGAGGTATT
hsa-miR-125a-5p	Forward: TCGGCAGGTCCCTGAGACCCTT
hsa-miR-125a-5p	Reverse: CTCAACTGGTGTCGTGGA
StAR	Forward: GCCACATTTGCCAGGAAACAATG
StAR	Reverse: CTCCTGGTCACTGTAGAGAGTCT
CYP19A1	Forward: GCAAAGCACCCTAATGTTGAAGA
CYP19A1	Reverse: CGAGTCTGTGCATCCTTCCAATA
ESR1	Forward: CTCTAACCTCGGGCTGTGC
ESR1	Reverse: AGATGCTTTGGTGTGGAGGG
NOTCH2	Forward: ATCCCACAAAGCCTAGCACC
NOTCH2	Reverse: CCTTGTCCCTGAGCAACCAT
IGFBP5	Forward: GAAGCAGATGTGTCTCTGCCC
IGFBP5	Reverse: TTCCCTCTGCTTCCTGGTTC
GAPDH	Forward: TGCACCACCAACTGCTTAGC
GAPDH	Reverse: GGCATGGACTGTGGTCATGAG
U6	Forward: CAGCACATATACTAAAATTGGAACG
U6	Reverse: ACGAATTTGCGTGTCATCC

CYP19A1, cytochrome P450 family 19 subfamily A member 1; ESR1, estrogen receptor 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IGFBP5, insulin-like growth factor binding protein 5; NEAT1, nucleo-enriched abundant transcript 1; NOTCH2, recombinant notch homolog 2; StAR, steroidogenic acute regulatory protein; U6, RNU6.

Western blotting

Proteins were extracted from cells using radioimmunoprecipitation assay (RIPA) lysis buffer (Servicebio, Wuhan, China), and the protein concentration was determined using the Bicinconinic acid (BCA) Protein Assay Kit (CWBIO, Taizhou, China). Equal amounts of proteins were separated by electrophoresis on 12% sodium dodecyl sulfate-polyacrylamide gels and subsequently transferred to polyvinylidene difluoride membranes (Bio-Rad). The non-specific sites on the membranes were blocked by incubating with 5% skimmed milk for 2 h at 22°C. The membranes were then incubated with the primary antibody overnight at 4°C. The membranes were washed with TBST buffer and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 2 h at room temperature. After washing with TBST buffer, the protein bands on the membrane were visualized using an enhanced chemiluminescence Detection Kit (Vazyme) and scanned using a gel imaging system. GAPDH was used as an internal reference. All the antibodies used in the western blotting, including ESR1 (20698-1-AP), phospho-ERK1/2 (80031-1-RR), ERK1/2 (11257-1-AP), phospho-CREB1 (28792-1-AP), CREB1 (12208-1-AP), StAR (12225-1-AP), CYP19A1 (16554-1-AP), and GAPDH (10494-1-AP) were purchased from Proteintech Group Inc. (Wuhan, China).

Enzyme-linked immunosorbent assay (ELISA)

KGN cells were collected, and androstenedione (10 µg/mL) was added to the culture medium. The cells were then cultured for 24 h. The estradiol level in the supernatant was measured using the Human Estrogen, E ELISA Kit (Cusabio, Wuhan, China) according to the manufacturer’s instructions.

Statistical analysis

The experimental data were analyzed using SPSS software (version 23.0; IBM, Armonk, NY, USA). All results are expressed as mean ± standard deviation (SD). The normality of data distribution was assessed using the Shapiro–Wilk test. Student's t-test or Wilcoxon test was used to assess the significance of the difference between the two groups of data. Pearson's correlation test was used for the correlation analysis between variables. The graphs were generated using GraphPad Prism (version 8.0; San Diego, CA, USA) software. Statistical significance was set at p < 0.05.

Baseline characteristics

The baseline characteristics of the patients in the two groups are presented in Table 2. Serum AMH and AFC levels were significantly lower (p < 0.001), and basal FSH levels were significantly higher (p < 0.05) in older patients with DOR compared with that in the NOR group. The baseline profiles, such as infertility duration, body mass index (BMI), basal luteinizing hormone (LH), basal estradiol (E₂), and basal progesterone (P) levels, were not significantly different between the two groups of patients (p > 0.05).

Table 2

Comparison of baseline characteristics between the NOR and DOR groups.
	NOR (n = 6)	DOR (n = 6)	p-value
Patient age (years)	31.33 ± 2.42	38.33 ± 1.37	< 0.001
Infertility duration (years)	2.83 ± 1.83	4.50 ± 2.26	0.191
BMI (kg/m²)	20.73 ± 1.56	21.75 ± 2.05	0.356
AMH (ng/mL)	4.50 ± 1.27	0.58 ± 0.27	< 0.001
Basal FSH (mIU/mL)	7.12 ± 0.62	12.58 ± 4.50	0.031
Basal LH (mIU/mL)	7.16 ± 3.74	3.60 ± 1.66	0.059
Basal E₂ (pg/mL)	32.33 ± 12.55	44.73 ± 13.27	0.127
Basal P (ng/mL)	0.44 ± 0.28	0.39 ± 0.17	0.744
AFC (n)	19.50 ± 2.88	5.33 ± 2.42	< 0.001

Data are shown as mean ± standard deviation.

AMH, anti-Müllerian hormone; AFC, antral follicle count; BMI, body mass index; E₂, estrogen; FSH, follicle-stimulating hormone; LH, luteinizing hormone; P, progesterone.

Downregulation of NEAT1 is associated with DOR occurrence and ART outcomes in older women

First, the expression levels of NEAT1 in GC samples were analyzed using RT-qPCR. The results showed that NEAT1 expression was significantly downregulated in the GCs of older patients with DOR compared to those in the NOR group (*** p < 0.001; Fig. 1a). Pearson correlation analysis showed that NEAT1 expression levels were significantly negatively correlated with patient age, basal FSH, and gonadotropin dosage (Fig. 1b-d); and significantly positively correlated with AMH, AFC, number of oocytes retrieved, number of two-pronuclear zygotes, and the number of embryos available (Fig. 1e-i). In addition, there was no significant correlation between NEAT1 expression level and gonadotropin duration and the number of superior embryos (Fig. 1j, k). These results suggest that the downregulation of NEAT1 in the GCs of older patients with DOR may be associated with ovarian reserve function and ART outcomes.

NEAT1 inhibits apoptosis and promotes proliferation of KGN cells

To confirm the subcellular localization of NEAT1 in KGN cells, a FISH assay was performed. The assay showed that NEAT1 is mainly localized in the cytoplasm (Fig. 2a), which suggests that NEAT1 acts as a molecular sponge for miRNAs to exert post-transcriptional regulation. To further investigate the biological functions of NEAT1, KGN cells were transfected with plasmids si-NEAT1 or OE-NEAT1. RT-qPCR results revealed significant changes in NEAT1 expression in the cells following transfection (Fig. 2b). The CCK-8 and EdU assays revealed that NEAT1 overexpression significantly increased cell viability and proliferation, whereas NEAT1 knockdown had the opposite effect (Fig. 2c, d). Flow cytometry results showed a significant decrease in apoptosis in the OE-NEAT1 group, whereas a significant increase in apoptosis was observed in the si-NEAT1 group (Fig. 2e). Additionally, cell cycle analysis showed that NEAT1 overexpression led to a significant decrease in the proportion of cells in the G0/G1 phase and a significant increase in the proportion of cells in the S phase, indicative of an increase in cell proliferation. In contrast, NEAT1 knockdown significantly increased the proportion of cells in the G0/G1 phase and decreased the proportion of cells in the S phase, indicating that si-NEAT1 blocked cells in the G1/S phase, thereby inhibiting cell proliferation (Fig. 2f).

miR-204-5p is a target of NEAT1

To predict miRNAs that potentially interact with NEAT1, we used the starBase, miRcode, and LncBase databases (Fig. 3a). We screened miR-125a-5p and miR-204-5p as miRNAs common to the three databases, verified their expression levels in GCs using RT-qPCR, and determined that miR-204-5p was significantly upregulated in the GCs of patients with advanced DOR (Fig. 3b). Figure 3c shows the complementary base sequences of NEAT1 and miR-204-5p. Based on the predicted binding site, dual-luciferase reporter assays were performed, which confirmed that mimics-miR-204-5p significantly reduced the luciferase activity of the NEAT1-WT vector, whereas it did not affect the luciferase activity of the NEAT1-MUT vector. In contrast, the inhibitor-miR-204-5p significantly increased the luciferase activity of the NEAT1-WT vector but not that of NEAT1-MUT (Fig. 3d). In addition, transfection with OE-NEAT1 significantly decreased miR-204-5p expression in KGN cells, whereas transfection with si-NEAT1 significantly increased miR-204-5p expression (Fig. 3e). These data suggest that NEAT1 directly binds to miR-204-5p and inhibits its expression.

NEAT1 overexpression negatively regulates miR-204-5p to inhibit apoptosis and promote proliferation of KGN cells

We transfected mimics-miR-204-5p, inhibitor-miR-204-5p, and the corresponding negative controls into KGN cells to investigate the effects of miR-204-5p on cell proliferation and apoptosis. RT-qPCR was used to confirm the transfection efficiency (Fig. 4a). The CCK-8 and EdU assays revealed that miR-204-5p overexpression significantly inhibited cell viability and proliferation, whereas miR-204-5p inhibition had the opposite effect (Fig. 4b, c). Flow cytometry showed that transfection with mimics-miR-204-5p induced apoptosis in KGN cells, whereas transfection with inhibitor-miR-204-5p significantly inhibited apoptosis (Fig. 4d). In addition, cell cycle analysis revealed that miR-204-5p overexpression inhibited cell proliferation by decreasing the proportion of KGN cells in S phase. In contrast, the downregulation of miR-204-5p significantly increased the proportion of S-phase cells and decreased the proportion of G0/G1-phase cells. Thus, the low expression of miR-204-5p promoted KGN cell proliferation by promoting the G1/S transition of the cells (Fig. 4e).

To further examine the correlation between NEAT1 and miR-204-5p in the regulation of KGN cell functions, we co-transfected KGN cells with OE-NEAT1 and mimics-miR-204-5p. As shown in Figs. 5a and b, NEAT1 overexpression increased KGN cell viability and proliferation, and this effect was reversed by miR-204-5p mimics. In addition, overexpression of miR-204-5p reversed the NEAT1-mediated effects on the apoptotic rate and G1/S transition of KGN cells (Fig. 5c, d). These results suggest that NEAT1 affects the proliferation and apoptosis of KGN cells by targeting miR-204-5p.

ESR1 is a downstream target of miR-204-5p

We used multiple bioinformatics databases (starBase, miRcode, TargetScan, miRDB, and miRWalk) to predict the potential target genes of miR-204-5p (Fig. 6a). Three potential targets were identified at the intersection of the five databases. The expression levels of these potential targets were evaluated in 12 clinical GC samples using RT-qPCR. ESR1 showed the most significant difference in expression between the two patient groups (Fig. 6b). We predicted the potential binding site of miR-204-5p on ESR1 (Fig. 6c). Dual-luciferase reporter assays were performed to verify the targeted regulatory relationship between the two molecules (Fig. 6d). Transfection of KGN cells with miR-204-5p mimics decreased ESR1 mRNA and protein expression levels; conversely, transfection with miR-204-5p inhibitors increased ESR1 mRNA and protein expression (Fig. 6e, f). These data suggest that miR-204-5p negatively regulates ESR1 expression.

Silencing of ESR1 reverses the effects of inhibitor-miR-204-5p on proliferation, apoptosis, and steroid biosynthesis in KGN cells

After transfecting KGN cells with inhibitor-miR-204-5p and si-ESR1, we performed a series of experiments to clarify the effect of ESR1 on miR-204-5p-mediated biological functions. CCK-8 and EdU assays showed that the inhibition of miR-204-5p significantly promoted the viability and proliferative capacity of KGN cells, whereas this effect was effectively reversed by silencing ESR1 (Fig. 7a, b). In addition, flow cytometric analysis showed that the miR-204-5p inhibitor significantly reduced the apoptotic rate, increased the proportion of S-phase cells, and reduced the proportion of G2/M-phase cells. However, si-ESR1 transfection partially restored the apoptotic rate and cell cycle transition (Fig. 7c, d). These results indicate that miR-204-5p targets the negative regulation of ESR1 to regulate proliferation, cell cycle, and apoptosis of KGN cells.

ESR1 encodes estrogen receptor-α, which participates in estrogen synthesis by mediating the estrogen signaling pathway. Moreover, it regulates the MAPK signaling pathway [19] to affect cell proliferation, differentiation, and apoptosis. We further examined the expression levels of key steroidogenic genes, including steroidogenic acute regulatory protein (StAR) and cytochrome P450 family 19 subfamily A member 1 (CYP19A1), and the important proteins in the MAPK signaling pathway. The results showed that transfection of KGN cells with inhibitor-miR-204-5p significantly up-regulated the mRNA and protein expression of ESR1, StAR, and CYP19A1 and promoted E₂ biosynthesis, whereas ESR1 silencing reversed these changes (Fig. 7e-g). In addition, the miR-204-5p inhibitor increased the levels of phosphorylated extracellular signaling-related kinase (ERK) and cyclic adenosine monophosphate response element binding protein (CREB), which were reversed by si-ESR1 (Fig. 7f).

NEAT1 mediates the MAPK signaling pathway through the miR-204-5p/ESR1 axis to affect the biological functions in KGN cells

Next, we sought to investigate whether NEAT1 affects the phenotype of KGN cells by regulating ESR1. KGN cells were transfected with si-NEAT1 or OE-NEAT1, and the mRNA and protein expression levels of ESR1 were analyzed using RT-PCR and western blotting, respectively. The results showed that ESR1 levels decreased significantly following si-NEAT1 transfection, whereas they markedly increased following OE-NEAT1 transfection (Fig. 8a, b). To investigate whether NEAT1 is involved in functional alterations in GCs during ovarian aging by regulating ESR1 expression and downstream signaling pathways through sponging of miR-204-5p, the levels of ESR1, StAR, CYP19A1, and E₂ were analyzed in KGN cells overexpressing NEAT1 in the absence of the presence of mimics-miR-204-5p. The results showed that overexpression of NEAT1 in KGN cells resulted in a significant increase in the mRNA and protein expression of ESR1, StAR, and CYP19A1 and augmentation of E₂ biosynthesis, which was reversed by co-transfection with mimics-miR-204-5p (Fig. 8c-e). In addition, NEAT1 overexpression increased the phosphorylation of ERK and CREB, which was reversed by mimics-miR-204-5p (Fig. 8e). These results suggest that NEAT1 acts as a miR-204-5p sponge to regulate ESR1 expression, which in turn regulates biological functions such as proliferation, apoptosis, and steroid biosynthesis in KGN cells by activating the MAPK signaling pathway.

In women, ovarian aging results in decreased secretion of estrogen and P by the ovaries and a decline in the number and quality of follicles, which affects fertility and quality of life in the long term. Ovarian aging is accompanied by mitochondrial dysfunction in GCs. Oxidative stress and inflammatory responses cause further damage to the GCs. Functional abnormalities of GCs are closely related to the pathogenesis of ovarian aging. Therefore, elucidation of the underlying molecular mechanisms is of great significance for maintaining ovarian function and promoting women's health. LncRNAs are involved in ovarian aging by regulating several biological processes, including oocyte development, maturation, and luteinization [20–22]. In the current study, we observed that the lncRNA NEAT1 upregulates ESR1 through the adsorption of miR-204-5p, which in turn mediates the MAPK signaling pathway, promotes proliferation, inhibits apoptosis, and affects the cell cycle and steroid biosynthesis in KGN cells. Thus, these results revealed a novel regulatory mechanism of GC dysfunction, which can be exploited to improve diagnostic and therapeutic strategies for ovarian senescence.

NEAT1 constitutes the skeletal structure of the subnucleosomal parafollicular patch and regulates gene expression by maintaining mRNA stability in the nucleus [23]. NEAT1 is involved in the cyclic recruitment and differentiation of follicles [24], and is closely associated with corpus luteum formation, pregnancy establishment, and maintenance [25]. NEAT1 is significantly downregulated in the ovarian tissues of patients with premature ovarian failure (POF), and overexpression of NEAT1 inhibits p53 expression by affecting its transcription and stability, which in turn ameliorates POF by inhibiting apoptosis [26]. Several recent studies have demonstrated that NEAT1 acts as a ceRNA to regulate the expression of downstream target genes, which are involved in the development of reproductive endocrine diseases at the post-transcriptional level through the competitive adsorption of miRNAs. For example, NEAT1 overexpression increases the expression of androgen receptors, follistatin, and insulin receptor substrate 2 by sponging miR-30d-5p, which is involved in developing polycystic ovarian syndrome [27]. Additionally, NEAT1 competitively binds to miR-874-3p, thereby regulating the proliferation of mouse GCs and producing E₂ and progesterone [28]. Furthermore, NEAT1 reduces miR-654 expression and regulates the STC2/MAPK pathway to reduce apoptosis and autophagy, rendering it a potential therapeutic target for POF [29]. Similarly, the current study demonstrates that NEAT1 expression levels are downregulated in the GCs of older patients with DOR and correlate with ovarian reserve function and ART outcomes. Using a series of in vitro functional assays, we demonstrated that NEAT1 promotes KGN cell proliferation by regulating the cell cycle and inhibiting apoptosis. This suggests that NEAT1 plays an important role in ovarian aging by affecting multiple biological functions of GCs and may thus serve as a potential target for the diagnosis and treatment of ovarian hypoplasia.

We predicted potential targets of NEAT1 based on data from multiple bioinformatics databases and observed that miR-204-5p was upregulated in GC samples from patients with clinical DOR. In addition, using dual-luciferase reporter assays, we confirmed that miR-204-5p binds to NEAT1. Subsequent functional and salvage assays showed that miR-204-5p affects KGN cell viability, proliferation, apoptosis, and cell cycle and induces DOR, which is contrary to the biological functions of NEAT1. A recent study showing that miR-204-5p functions as an oncogene and plays an important role in various cancers by regulating cell proliferation, apoptosis, autophagy, and the immune microenvironment has received widespread attention [30]. Downregulation of miR-204-5p expression in ovarian cancer inhibits tumor cell proliferation, migration, and invasion by targeting specific genes such as ubiquitin-specific peptidase 47 and thrombospondin-1 [31, 32]. Upregulation of NEAT1 in synovial tissues of patients with rheumatoid arthritis was observed to promote the proliferation and production of inflammatory cytokines in rheumatoid arthritis fibroblast-like synoviocytes and inhibit apoptosis by targeting miR-204-5p to mediate the nuclear factor kappa-B pathway [33]. Chronic exposure to estradiol and leptin alters endometrial homeostasis and promotes endometrial cancer via the NEAT1-miR-204-5p-Igf1 axis in women with obesity [34]. Another study demonstrated that cadmium exerts cytotoxic effects and impairs ovarian function by affecting the miR-204-5p/BCL2 axis and promoting apoptosis in GCs [35]. Similarly, our data demonstrate that low NEAT1 expression in the GCs of patients with DOR attenuates miR-204-5p adsorption, thereby affecting cell proliferation, apoptosis, and viability, accelerating ovarian senescence.

miRNAs negatively regulate the expression of target genes by binding to the 3'-UTR of the target gene mRNA, promoting mRNA degradation or inhibiting protein translation [36]. We used bioinformatics to predict the potential targets of miR-204-5p and reported that it negatively regulates ESR1. ESR1 is an estrogen receptor α, which mediates estrogen signaling, affecting follicle development, maturation, and steroid hormone synthesis, and plays a crucial role in maintaining ovarian function [37, 38]. StAR and CYP19A1, key enzymes involved in estrogen biosynthesis [39], regulate steroid biosynthesis by transporting free cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. CYP19A1 encodes cytochrome P450 aromatase, which facilitates the catalytic conversion of androgens to estrogens by GCs and is the rate-limiting enzyme for the final step of estrogen synthesis. In addition, ESR1 has been implicated in per/polyfluoroalkyl substances-induced breast cancer development and progression through activation of the MAPK/Erk signaling pathway [40]. The MAPK signaling pathway regulates the proliferation, apoptosis, cell cycle, and steroidogenesis of GCs. Moreover, it plays an important role in the regulation of female reproduction and can therefore be used as a pharmacological target for ovarian hypoplasia [41, 42]. The most representative member of the ERK pathway in MAPK signaling, ERK, becomes phosphorylated and activated and then translocates from the cytoplasm to the nucleus, and it directly or indirectly regulates the expression of a variety of target genes and affects a variety of cellular processes, such as proliferation, differentiation, and cell death [43]. CREB is a key downstream signaling molecule of ERK. Once activated, ERK phosphorylates the downstream CREB and affects the proliferation, apoptosis, and steroidogenesis of GCs [44, 45]. Our findings showed that ESR1 expression was significantly reduced in GCs of older patients with DOR. Further mechanistic studies demonstrated that silencing ESR1 inhibited the MAPK signaling pathway and effectively counteracted the effects of transfection with the inhibitor-miR-204-5p on proliferation, apoptosis, and steroid biosynthesis in KGN cells.

Finally, we examined the relationship between NEAT1, miR-204-5p, and ESR1. We observed that NEAT1 overexpression promoted ESR1 expression, which in turn activated the ERK and CREB phosphorylation in the MAPK signaling pathway and upregulated the expression of StAR and CYP19A1 to increase estradiol production. However, these effects were eliminated by miR-204-5p. These data suggest that NEAT1 regulates ESR1 expression by sponging miR-204-5p and mediates the MAPK signaling pathway involved in DOR. In future studies, we intend to use a larger clinical sample size and an animal model of ovarian senescence to study the molecular mechanisms that regulate ovarian pathogenesis in greater depth.

Our study revealed that NEAT1 is downregulated in the GCs of older patients with DOR. NEAT1 regulates apoptosis, proliferation, and steroid biosynthesis through the miR-204-5p/ESR1 axis-mediated MAPK signaling pathway and participates in the ovarian aging process. This novel axis of ceRNA regulation is associated with DOR development and ART cycle outcomes and provides a promising therapeutic strategy to delay ovarian aging.

AFC	anterior follicle counts
AMH	anti-Müllerian hormone
ART	Assisted Reproductive Technology
BMI	body mass index
ceRNA	Competing endogenous RNA
CREB	Cyclic adenosine monophosphate response element binding protein
CYP19A1	cytochrome P450 family 19 subfamily A member 1
DOR	diminished ovarian reserve
E₂	estradiol
ERK	extracellular signaling-related kinase
ESR1	estrogen receptor 1
FSH	follicle-stimulating hormone
GCs	Granulosa cells
LH	luteinizing hormone
lncRNA	long non-coding RNA
MAPK	mitogen-activated protein kinase
NOR	normal ovarian reserve
P	progesterone
POF	premature ovarian failure
StAR	Steroidogenic acute regulatory protein
siRNA	small interfering RNA

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Reproductive Medicine of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine and registered with the China Clinical Trial Registry on October 30, 2021 (registration number: ChiCTR2100052522). All patients provided written signed informed consent. All methods were performed in accordance with relevant guidelines and regulations.

Consent for publication

Not applicable.

Availability of data and materials

The data supporting the findings of this study are available from the corresponding authors upon a reasonable request.

Competing interests

The authors declare that they have no commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This study was supported by the National Research and Training Program for Outstanding Clinical Talents of Traditional Chinese Medicine (grant number: National Letter of TCM Practitioners No. 1 [2022]), the Co-construction of Science and Technology Programs by the Science and Technology Department of the State Administration of Traditional Chinese Medicine (SATCM) (grant number: GZY-KJS-SD-2023-070), the Shandong Traditional Chinese Medicine Science and Technology Program (grant number: Z-2023094), and the Jinan Science and Technology Program (grant number: 202328044).

Authors’ contributions

LD was a major contributor in writing the manuscript. HW and DL performed the experiments and analyzed the data. FQ and WC did bioinformatics analysis. YX and ML contributed to manuscript revision. YW and RY was responsible for sample collection. PC conceived and designed this study. All authors read and approved the final submitted version of this manuscript.

Acknowledgments

The authors thank all the collaborators and participants of the study.

Isola JVV, Ocañas SR, Hubbart CR, Ko S, Mondal SA, Hense JD, Carter HNC, Schneider A, Kovats S, Alberola-Ila J, et al: A single-cell atlas of the aging mouse ovary. Nat Aging 2024, 4:145-162.
Babayev E, Duncan FE: Age-associated changes in cumulus cells and follicular fluid: the local oocyte microenvironment as a determinant of gamete quality. Biol Reprod 2022, 106:351-365.
Johnson JA, Tough S: No-271-Delayed Child-Bearing. J Obstet Gynaecol Can 2017, 39:e500-e515.
Turathum B, Gao EM, Chian RC: The Function of Cumulus Cells in Oocyte Growth and Maturation and in Subsequent Ovulation and Fertilization. Cells 2021, 10.
Cai H, Chang T, Li Y, Jia Y, Li H, Zhang M, Su P, Zhang L, Xiang W: Circular DDX10 is associated with ovarian function and assisted reproductive technology outcomes through modulating the proliferation and steroidogenesis of granulosa cells. Aging (Albany NY) 2021, 13:9592-9612.
Li S, Fan Y, Shu C, Zhou Y, Shu J: Methyl 3,4-dihydroxybenzoate alleviates oxidative damage in granulosa cells by activating Nrf2 antioxidant pathway. J Ovarian Res 2024, 17:87.
Deng J, Tang Y, Li L, Huang R, Wang Z, Ye T, Xiao Z, Hu M, Wei S, Wang Y, et al: miR-143-3p Promotes Ovarian Granulosa Cell Senescence and Inhibits Estradiol Synthesis by Targeting UBE2E3 and LHCGR. Int J Mol Sci 2023, 24.
Li P, Dou Q, Zhang D, Xiang Y, Tan L: Melatonin regulates autophagy in granulosa cells from patients with premature ovarian insufficiency via activating Foxo3a. Aging (Albany NY) 2024, 16:844-856.
Guan C, Li W, Wang G, Yang R, Zhang J, Zhang J, Wu B, Gao R, Jia C: Transcriptomic analysis of ncRNAs and mRNAs interactions during drought stress in switchgrass. Plant Sci 2024, 339:111930.
Tang Z, Li X, Zheng Y, Liu J, Liu C, Li X: The role of competing endogenous RNA network in the development of hepatocellular carcinoma: potential therapeutic targets. Front Cell Dev Biol 2024, 12:1341999.
Wu W, Cao L, Jia Y, Xiao Y, Zhang X, Gui S: Emerging Roles of miRNA, lncRNA, circRNA, and Their Cross-Talk in Pituitary Adenoma. Cells 2022, 11.
Yang Y, Xiong Y, Pan Z: Role of ceRNAs in non-tumor female reproductive diseases†. Biol Reprod 2023, 108:363-381.
Shen J, Liang C, Su X, Wang Q, Ke Y, Fang J, Zhang D, Duan S: Dysfunction and ceRNA network of the tumor suppressor miR-637 in cancer development and prognosis. Biomark Res 2022, 10:72.
Zhang D, Tang HY, Tan L, Zhao DM: MALAT1 is involved in the pathophysiological process of PCOS by modulating TGFβ signaling in granulosa cells. Mol Cell Endocrinol 2020, 499:110589.
Yao Y, Wang Y, Wang F, Meng C, Niu J, Guo M, Sizhu S, Xu Y: BMP15 Modulates the H19/miR-26b/SMAD1 Axis Influences Yak Granulosa Cell Proliferation, Autophagy, and Apoptosis. Reprod Sci 2023, 30:1266-1280.
Dong L, Xin X, Chang HM, Leung PCK, Yu C, Lian F, Wu H: Expression of long noncoding RNAs in the ovarian granulosa cells of women with diminished ovarian reserve using high-throughput sequencing. J Ovarian Res 2022, 15:119.
Ferraretti AP, La Marca A, Fauser BCJM, Tarlatzis B, Nargund G, Gianaroli L: ESHRE consensus on the definition of 'poor response' to ovarian stimulation for in vitro fertilization: the Bologna criteria. Human Reproduction 2011, 26:1616-1624.
Ju W, Zhao S, Wu H, Yu Y, Li Y, Liu D, Lian F, Xiang S: miR-6881-3p contributes to diminished ovarian reserve by regulating granulosa cell apoptosis by targeting SMAD4. Reprod Biol Endocrinol 2024, 22:17.
Liu A, Zhang D, Yang X, Song Y: Estrogen receptor alpha activates MAPK signaling pathway to promote the development of endometrial cancer. J Cell Biochem 2019, 120:17593-17601.
Yao G, Kong Y, Yang G, Kong D, Xu Y, He J, Xu Z, Bai Y, Fan H, He Q, Sun Y: Lnc-GULP1-2:1 affects granulosa cell proliferation by regulating COL3A1 expression and localization. Journal of ovarian research 2021, 14:16.
Wang F, Chen X, Sun B, Ma Y, Niu W, Zhai J, Sun Y: Hypermethylation-mediated downregulation of lncRNA PVT1 promotes granulosa cell apoptosis in premature ovarian insufficiency via interacting with Foxo3a. J Cell Physiol 2021, 236:5162-5175.
Jia Y, Liu L, Gong S, Li H, Zhang X, Zhang R, Wang A, Jin Y, Lin P: Hand2os1 Regulates the Secretion of Progesterone in Mice Corpus Luteum. Vet Sci 2022, 9.
Wang Y, Chen LL: Organization and function of paraspeckles. Essays Biochem 2020, 64:875-882.
Ernst EH, Nielsen J, Ipsen MB, Villesen P, Lykke-Hartmann K: Transcriptome Analysis of Long Non-coding RNAs and Genes Encoding Paraspeckle Proteins During Human Ovarian Follicle Development. Front Cell Dev Biol 2018, 6:78.
Nakagawa S, Shimada M, Yanaka K, Mito M, Arai T, Takahashi E, Fujita Y, Fujimori T, Standaert L, Marine JC, Hirose T: The lncRNA Neat1 is required for corpus luteum formation and the establishment of pregnancy in a subpopulation of mice. Development 2014, 141:4618-4627.
Li M, Peng J, Zeng Z: Overexpression of long non-coding RNA nuclear enriched abundant transcript 1 inhibits the expression of p53 and improves premature ovarian failure. Exp Ther Med 2020, 20:69.
ElMonier AA, El-Boghdady NA, Fahim SA, Sabry D, Elsetohy KA, Shaheen AA: LncRNA NEAT1 and MALAT1 are involved in polycystic ovary syndrome pathogenesis by functioning as competing endogenous RNAs to control the expression of PCOS-related target genes. Noncoding RNA Res 2023, 8:263-271.
Zhang P, Gao J, Lin S, Lin G, Wang W, Tan C, Liu X, Li X, Zhang L: Long non‑coding RNA NEAT1 promotes mouse granulosa cell proliferation and estradiol synthesis by sponging miR‑874‑3p. Exp Ther Med 2023, 25:32.
Liu YX, Ke Y, Qiu P, Gao J, Deng GP: LncRNA NEAT1 inhibits apoptosis and autophagy of ovarian granulosa cells through miR-654/STC2-mediated MAPK signaling pathway. Exp Cell Res 2023, 424:113473.
Yang F, Bian Z, Xu P, Sun S, Huang Z: MicroRNA-204-5p: A pivotal tumor suppressor. Cancer Med 2023, 12:3185-3200.
Chen X, Mangala LS, Mooberry L, Bayraktar E, Dasari SK, Ma S, Ivan C, Court KA, Rodriguez-Aguayo C, Bayraktar R, et al: Identifying and targeting angiogenesis-related microRNAs in ovarian cancer. Oncogene 2019, 38:6095-6108.
Hu L, Kolibaba H, Zhang S, Cao M, Niu H, Mei H, Hao Y, Xu Y, Yin Q: MicroRNA-204-5p Inhibits Ovarian Cancer Cell Proliferation by Down-Regulating USP47. Cell Transplant 2019, 28:51s-58s.
Xiao J, Wang R, Zhou W, Cai X, Ye Z: LncRNA NEAT1 regulates the proliferation and production of the inflammatory cytokines in rheumatoid arthritis fibroblast-like synoviocytes by targeting miR-204-5p. Hum Cell 2021, 34:372-382.
Shetty A, Suresh PS: A synergy of estradiol with leptin modulates the long non-coding RNA NEAT1/ mmu-miR-204-5p/IGF1 axis in the uterus of high-fat-diet-induced obese ovariectomized mice. J Steroid Biochem Mol Biol 2021, 209:105843.
Zhong P, Liu J, Li H, Lin S, Zeng L, Luo L, Wu M, Zhang W: MicroRNA-204-5p regulates apoptosis by targeting Bcl2 in rat ovarian granulosa cells exposed to cadmium†. Biol Reprod 2020, 103:608-619.
Cai Y, Tian J, Su Y, Shi X: MiR-506 targets polypyrimidine tract-binding protein 1 to inhibit airway inflammatory response and remodeling via mediating Wnt/β-catenin signaling pathway. Allergol Immunopathol (Madr) 2023, 51:15-24.
Lee SY, Kang YJ, Kwon J, Nishi Y, Yanase T, Lee KA, Koong MK: miR-4463 regulates aromatase expression and activity for 17β-estradiol synthesis in response to follicle-stimulating hormone. Clin Exp Reprod Med 2020, 47:194-206.
Sun YT, Cai JH, Bao S: Overexpression of lncRNA HCP5 in human umbilical cord mesenchymal stem cell-derived exosomes promoted the proliferation and inhibited the apoptosis of ovarian granulosa cells via the musashi RNA-binding protein 2/oestrogen receptor alpha 1 axis. Endocr J 2022, 69:1117-1129.
Baddela VS, Michaelis M, Tao X, Koczan D, Vanselow J: ERK1/2-SOX9/FOXL2 axis regulates ovarian steroidogenesis and favors the follicular-luteal transition. Life Sci Alliance 2023, 6.
Liu Q, Liu Y, Li X, Wang D, Zhang A, Pang J, He J, Chen X, Tang NJ: Perfluoroalkyl substances promote breast cancer progression via ERα and GPER mediated PI3K/Akt and MAPK/Erk signaling pathways. Ecotoxicol Environ Saf 2023, 258:114980.
Safdar M, Liang A, Rajput SA, Abbas N, Zubair M, Shaukat A, Rehman AU, Jamil H, Guo Y, Ullah F, Yang L: Orexin-A Regulates Follicular Growth, Proliferation, Cell Cycle and Apoptosis in Mouse Primary Granulosa Cells via the AKT/ERK Signaling Pathway. Molecules 2021, 26.
Huang Z, Tian Z, Zhao Y, Zhu F, Liu W, Wang X: MAPK Signaling Pathway Is Essential for Female Reproductive Regulation in the Cabbage Beetle, Colaphellus bowringi. Cells 2022, 11.
Guo YJ, Pan WW, Liu SB, Shen ZF, Xu Y, Hu LL: ERK/MAPK signalling pathway and tumorigenesis. Exp Ther Med 2020, 19:1997-2007.
Guo J, Yuan Y, Lu D, Du B, Xiong L, Shi J, Yang L, Liu W, Yuan X, Zhang G, Wang F: Two natural products, trans-phytol and (22E)-ergosta-6,9,22-triene-3β,5α,8α-triol, inhibit the biosynthesis of estrogen in human ovarian granulosa cells by aromatase (CYP19). Toxicol Appl Pharmacol 2014, 279:23-32.
Wu H, Sun P, Lv C, Zhao X, Liu M, Zhou Q, Tang J, Yang L, Liang A: Effects of IL-11/IL-11 Receptor Alpha on Proliferation and Steroidogenesis in Ovarian Granulosa Cells of Dairy Cows. Cells 2023, 12.

No competing interests reported.

Originalimagesforgelsandblots.pdf

Download PDF

Reviewers agreed at journal
05 Nov, 2024
Reviewers agreed at journal
05 Nov, 2024
Reviewers agreed at journal
05 Nov, 2024
Reviewers agreed at journal
05 Nov, 2024
Reviewers invited by journal
05 Nov, 2024
Editor assigned by journal
28 Oct, 2024
Submission checks completed at journal
28 Oct, 2024
First submitted to journal
24 Oct, 2024

You are reading this latest preprint version

lncRNA NEAT1 affects granulosa cell apoptosis and steroid biosynthesis via the miR-204-5p/ESR1 axis in ovarian aging

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Clinical sample collection

Cell culture

Cell transfection

Fluorescence in situ hybridization (FISH)

Dual-luciferase reporter assay

Cell counting kit-8 (CCK-8) assay

EdU proliferation assay

Flow cytometric assay

RT-qPCR

Western blotting

Enzyme-linked immunosorbent assay (ELISA)

Statistical analysis

Results

Baseline characteristics

Downregulation of NEAT1 is associated with DOR occurrence and ART outcomes in older women

NEAT1 inhibits apoptosis and promotes proliferation of KGN cells

miR-204-5p is a target of NEAT1

NEAT1 overexpression negatively regulates miR-204-5p to inhibit apoptosis and promote proliferation of KGN cells

ESR1 is a downstream target of miR-204-5p

Discussion

Conclusion

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and materials

Competing interests

Funding

Authors’ contributions

Acknowledgments

References

Additional Declarations

Supplementary Files

Status:

Version 1