Microsatellite Markers Establishment for African Elemi (Canarium schweinfurthii Engl., Burseraceae), a Africa Prominent Wild Fruit-Bearing Forest Tree

doi:10.21203/rs.3.rs-5328401/v1

Premise of the study :

Commonly known as Aiélé (in French) or African Elemi (in English), Canarium schweinfurthii (Burseraceae) is an important and remarkable large native food tree of Africa. This species is highly valued by woodworkers for its superior timber quality and by rural communities for its fruits and medicinal properties. Despite its socio-economic and cultural importance, the distribution of its genetic diversity, a key factor for its conservation, has never been studied or documented. The aim of this work is to develop and make available molecular markers for assessing the genetic diversity and population structure of the African Elemi, which are necessary information tools for its conservation and sustainable management.

Methods and results

In this context, 18,079 nuclear microsatellite markers extracted from Next-Generation Sequencing (NGS) of a genomic library were validated and characterized. Thirteen markers were polymorphic and were further tested on 98 individuals from four populations across three African countries (Cameroon, Côte d’Ivoire and Burkina Faso). The number of alleles per locus varied from 6 to 29, with an average of 16.54 ± 7.81. Within populations, the expected mean heterozygosity (H_E) ranged from 0.500 to 0.805 depending on the loci, with an average of 0.705 ± 0.140. Meanwhile, observed mean heterozygosity (H_O) varied from 0.560 to 0.684, averaging 0.643 ± 0.060 across loci. The mean F_IS coefficient per population for each locus ranged from 0.093 to 0.270, with an average of 0.165 ± 0.070.

Conclusions

Given their high polymorphism, the 13 nuclear microsatellite markers developed here can be utilized to study gene flow, the spatial distribution of genetic diversity, and population structure in C. schweinfurthii across Africa, as well as to contribute to its conservation.

African Olive

Fruit tree

Tropical tree

Genetic Diversity

Non Timber Forest Product

Canarium schweinfurthii, a pantropical species of the Burseraceae family, is found from western Senegal to eastern Kenya [1, 2]. This dioecious tree, known as the "bush candle tree”, “African olive tree” or “African elemi” can grow over 50 meters tall, with its canopy reaching the upper layers of humid and riparian forests [2–5]. Its edible fruits are harvested locally for diverse uses, including food, poaching (as bait for large mammals), and traditional medicine with various industrial applications. The wood is highly valued and used in furniture making. Although not often planted, the tree is frequently protected by local communities in agroforests and orchards [2, 3, 6, 7]. Despite its significant over exploitation in some part of its distribution area, C. schweinfurthii is only listed as "Least Concern" on the IUCN Red List [8]. However, we think and believe that its extensive use puts the species under considerable pressure, leading to a potential loss of genetic diversity or extinction, as is the case for some species [9–11]. Given its socio-economic importance, it is necessary to develop sustainable management practices for this species to ensure its contribution to the livelihood of local small-holder farmers. This concerns notably the sustainable management of its genetic resources, which can only be achieved if the spatial distribution of its genetic diversity is well characterized beforehand. To date, no studies have been conducted on its genetic diversity, significantly limiting the development of preservation and sustainable management strategies. No genomic or transcriptomic resources are available for this species. The closest reference genome appears to be Dacryodes edulis, which is relatively distant from a genetic point of view, making an SNP approach difficult to envisage. In this context, the development of SSR markers seems more appropriate, as well as their high level of poymorphism. In this context, 13 nuclear polymorphic microsatellite markers (Simple Sequence Repeats, SSRs) have been developed and characterized to study the genetic diversity and structure of C. schweinfurthii.

Plant material and DNA extraction

DNA was extracted from dried leaves or cambium of 98 C. schweinfurthii individuals from four populations (localities) across three countries (Cameroon, Burkina Faso and Côte d'Ivoire; see Fig. 1) using an adapted version of the protocol by Mariac et al. [12]. To ensure DNA purity and address the challenges posed by the high levels of phenolic, polysaccharidic, and glyco-lipidic compounds in the extracts that complicate DNA isolation, the homogenate of each sample was pretreated with a sorbitol-based extraction buffer solution (composed of 63.7g of sorbitol, 100mL of 1M Tris-HCl pH 8, 10mL of 0.5M EDTA pH 8, 5g of 0.5% sodium bisulfite added on the same day, and Milli-Q water to a final volume of 1000ml), The whole mixture is centrifuged before applying the extraction protocol [12]. Three washing series, each involving 1.5mL of buffer solution per sample and per wash, were performed.

Microsatellite development

A genomic library was prepared for two out of the 98 individuals (ARM0325 and ARM0326, Data availability and Supplementary Information 1) from Cameroon following the protocol by Mariac et al. [13], and sequenced in paired-end mode using Illumina MiSeq v2 reagents with 2 × 250 bp reads at Novogene (Munich, Germany). We obtained 1,463,279 and 1,458,372 raw reads for individuals ARM325 and ARM326, respectively. Reads were joined using FLASH v1.2.11[14], resulting in 1,035,067 and 1,010,583 joined reads for individuals ARM325 and ARM326, respectively.

The software QDD v3.1.2 [15] was used with default settings to identify microsatellite repeat units (nuclear SSR motifs) and design primers. We identified 8,432 and 9,647 reads with an SSR motifs for ARM325 and ARM326 respectively. These raw sequencing data and reads with SSRs have been deposited in GenBank SRA under accession PRJNA1125310 (available at: https://www.ncbi.nlm.nih.gov/sra/PRJNA1125310). 48 loci per individual were selected based on the following criteria: (1) perfect di- or trinucleotide microsatellite repeat units (i.e., non-composite); (2) motif repetitions with a minimum threshold of 10; (3) primers located at least 20 bp away from the microsatellite region; (4) PCR product size between 90 and 250 bp. For each primer pair, a tail with one of four fluorochromes was added to the 5' end of the Reverse or Forward primer(Q1-6-FAM, Q2-NED, Q3-VIC, Q4-PET [16]; see Table 1).

ThermoFisher Multiple Primer Analyzer web page (https://www.thermofisher.com/fr/fr/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html) was used to check for the presence of self-dimers and cross primer dimers for each of the 48 primer pairs selected for each individual. 52 loci were kept (19 in ARM325 and 33 loci in ARM326) for following analyses (test of amplification and polymorphism). For each of these 48 markers, an amplification test was carried out on 4 individuals in simplex reactions (name of individuals). A second test on 16 individuals was carried out on the xx markers that had amplified in order to assess their polymorphism. Finally, thirteen markers were found to be polymorphic and were selected for multiplex PCR. Primer sequences for these SSRs (see Table 1) were deposited in GenBank.

PCR conditions and microsatellite amplification tests

The PCR reactions were carried out in a total volume of 10 µL, consisting of: 0.15 µL of each forward primer [10 µM], 0.1 µL of each reverse primer [10 µM], 0.15 µL of each fluorescently labeled primer (Q1 to Q4) [16]) [10 µM], 1 µL of DNA (10 ng/µL), 4 µL of PCR Master Mix (Type-it Microsatellite, Qiagen), and the volume was completed to 10 µL with ultra-pure water (Invitrogen). The 13 selected markers are amplifiable in two multiplex reactions of 5 and 8 SSRs. Each multiplex PCR reaction consisted of: 0.15 µL of each forward primer [10 µM], 0.1 µL of each reverse primer [10 µM], 0.15 µL of each linker (Q1-Q4) [10 µM], 1 µL of DNA (10 ng/µL), 7.5 µL of PCR Master Mix (Type-it Microsatellite, Qiagen), and the volume was completed to 15 µL with ultra-pure water (Invitrogen). The PCRs were performed using a Veriti™ 96-Well Thermocycler (Thermo Fisher Scientific) under the following conditions: initial denaturation at 95°C (3 min), 30 cycles of denaturation at 95°C (30 s), annealing at 57°C (1 min 30 s), extension at 72°C (30 s), followed by 10 additional cycles with the annealing temperature adjusted to 53°C, and a final extension at 60°C (30 min). Using 2 µL of the PCR product, 10 µL of Hi-Di formamide (Applied Biosystems, Thermo Fisher Scientific), and 0.12 µL of GeneScan 500 LIZ Size Standard (Applied Biosystems, Thermo Fisher Scientific), genotyping of all samples was performed using an ABI 3500 XL sequencer (Applied Biosystems, Foster City, California, USA) at the CIRAD genotyping platform in Montpellier. Electropherograms were visualized and scored with Geneious version 7.1.3 [17]. Difficult-to-read loci and monomorphic loci were excluded. In total, 13 primer pairs were retained and combined into two multiplex reactions (the list of loci grouped in each multiplex is provided in Table 1) using Multiplex Manager 1.0 software [18].

Microsatellite diversity analysis

A genetic diversity analysis was conducted on a set of individuals (19 to 31 individuals per population; see Fig. 1 and Table 2) coming from four different populations of C. schweinfurthii from three countries: Cameroon (Meyo-Ville), Cameroon (Koupa-Matapit), Burkina Faso (Orodara), and Côte d'Ivoire (Bouaké). Genotyping was analyzed locus by locus using the automated procedure implemented in Geneious Prime® 2019.2.3 [17] and manually corrected. Genetic diversity was assessed in each population by estimating the number of alleles per locus (A), allelic richness (AR), observed heterozygosity (H_O), expected heterozygosity (H_E), the fixation index or inbreeding coefficient (F_IS), and deviations from Hardy-Weinberg equilibrium (HWE) using the program SPAGeDi 1.5 [19]. Null allele frequencies (r) were calculated with INEST 2.2 [20].

Table 1

Characterization of 13 microsatellites loci developed for *Canarium schweinfurthi*
Mix	Microsatellite marker	Primer sequences (5′–3′) ^a	Fluorescent label ^b	Repeat motif ^c	PCR product size	Allele size range (bp)	Genebank accession No
Multiplex 1	CS02	F : TGTAAAACGACGGCCAGTTTCTCATCTCCACAAATTCCACA	Q1-6-FAM	(AT)₁₀	123	130–185	PP933780
	CS02	R : GGCCATCCAAGACCAGAACA	Q1-6-FAM	(AT)₁₀	123	130–185	PP933780
	CS11	F : TAGGAGTGCAGCAAGCATCAGGAGGCCACATCGTCTAT	Q2-NED	(AG)₁₂	140	125–170	PP933781
	CS11	R : ATTTGTCCTGCTCCTGTGCT	Q2-NED	(AG)₁₂	140	125–170	PP933781
	CS36	F : CTAGTTATTGCTCAGCGGTTGCTGGTTACGCAGTTGCTA	Q4-PET	(AG)₁₇	222	220–270	PP933782
	CS36	R : TTCCAGAGGATTTCTTGATGTCT	Q4-PET	(AG)₁₇	222	220–270	PP933782
	CS37	F : CACTGCTTAGAGCGATGCAGAGTTCCTTACATAGTGTCACCA	Q3-VIC	(AT)₁₁	222	220–270	PP933783
	CS37	R : CTGCTCAGCTTACAATGACCA	Q3-VIC	(AT)₁₁	222	220–270	PP933783
	CS50	F : TAACCATCTGCCGGTGTTCC	Q1-6-FAM	(AC)₁₀	231	236–272	PP933784
	CS50	R : TGTAAAACGACGGCCAGTTTCTGGCAAGGCAAGCAGAT	Q1-6-FAM	(AC)₁₀	231	236–272	PP933784
Multiplex 2	CS05	F : TGTAAAACGACGGCCAGTAACCAATACCGTCATCACCC	Q1-6-FAM	(AG)₁₀	129	120–160	PP933785
	CS05	R : CGAGAGGTGGTGTTGACATT	Q1-6-FAM	(AG)₁₀	129	120–160	PP933785
	CS19	F : CTAGTTATTGCTCAGCGGTAGGTCAGCAGTCCTTTGACA	Q4-PET	(AG)₂₃	151	130–185	PP933786
	CS19	R : GGGTGGCATCTGGAACTCAT	Q4-PET	(AG)₂₃	151	130–185	PP933786
	CS20	F : CACTGCTTAGAGCGATGCTGAGAAACTGAGCAGTCGAGA	Q3-VIC	(AG)₁₂	152	155–200	PP933787
	CS20	R : TGGCATTTGAAACAGAAATCCTTCA	Q3-VIC	(AG)₁₂	152	155–200	PP933787
	CS34	F : TAGGAGTGCAGCAAGCATCGTTGACACTCTCACTCGCT	Q2-NED	(AG)₁₂	204	205–240	PP933788
	CS34	R : GCAAGATTTAGCTGACCCAACA	Q2-NED	(AG)₁₂	204	205–240	PP933788
	CS40	F : CTAGTTATTGCTCAGCGGTAGAGTGGCTGATAAAGATCTATGCA	Q4-PET	(AT)₂₁	131	210–295	PP933789
	CS40	R : GGGCTGAATGTTGTCAAGGC	Q4-PET	(AT)₂₁	131	210–295	PP933789
	CS42	F : CACTGCTTAGAGCGATGCAGGGTATTGAAGATAAGTAGATTAGCA	Q3-VIC	(AT)₁₅	240	225–285	PP933790
	CS42	R : TGTTACTAGCATTCTCTTGCAGTG	Q3-VIC	(AT)₁₅	240	225–285	PP933790
	CS49	F : AGAATCCCAGATGTAACACCTGT	Q1-6-FAM	(AG)₁₁	241	245–290	PP933791
	CS49	R : TGTAAAACGACGGCCAGTTGTTAGTCCGTGCGTGTCAC	Q1-6-FAM	(AG)₁₁	241	245–290	PP933791
	CS52	F : CATCCAGACAGTATGAATGGCA	Q2-NED	(AG)₁₇	143	135–187	PP933792
	CS52	R : TAGGAGTGCAGCAAGCATCTGACCTAATTGTTCAAAGCAGCT	Q2-NED	(AG)₁₇	143	135–187	PP933792
^a The universal linkers attached to the forward primers are underlined

^b Q1 = TGTAAAACGACGGCCAGT; Q2 = TAGGAGTGCAGCAAGCAT; Q3 = CACTGCTTAGAGCGATGC; Q4 = CTAGTT ATTGCT CAG CGG T, [16].

^c Number of repeats found in the clone that corresponds to the accession number

^d Optimal annealing temperature was 57° C for all loci

Table 2 Genetic properties of the 13 newly developed polymorphic nuclear microsatellites markers in four populations of Canarium schweinfurthii

Multiplex	Locus	Cameroon (Meyo-Ville, N=31)						Cameroon (Koupa-Matapit, N=25)						Burkina Faso (Orodara, N=23)
Multiplex	Locus	A	AR	H₀	H_E	F_IS^a	r	A	AR	H₀	H_E	F_IS^a	r	A	AR	H₀	H_E	F_IS^a	r
Multiplex-1	CS02	12	10.18	0.839	0.856	0.020	0±0.00	14	12.74	0.64	0.868	0.266***	0.11±0.05	15	14.16	0.783	0.906	0.139^*	0.06±0.05
	CS11	6	5.45	0.484	0.654	0.264^*	0.09±0.06	5	4.69	0.56	0.612	0.087	0.007±0.03	5	4.80	0.348	0.490	0.295	0.07±0.05
	CS36	9	8.63	0.700	0.834	0.163	0.05±0.06	8	7.37	0.625	0.808	0.230^*	0.12±0.08	7	6.79	0.478	0.634	0.250^*	0.08±0.05
	CS37	14	12.14	0.767	0.859	0.109	0.03±0.05	10	9.27	0.609	0.821	0.263^**	0.13±0.09	8	7.7.62	0.826	0.830	0.004	0±0.00
	CS50	6	5.65	0.742	0.675	-0.100	0.04±0.04	3	2.99	0.28	0.286	0.023	0±0.00	4	4.00	0.565	0.712	0.210	0.07±0.07
Multiplex-2	CS05	5	4.61	0.419	0.698	0.403^**	0.16±0.05	4	4.00	0.28	0.711	0.633^***	0.25±0.06	5	4.85	0.455	0.591	0.235	0.11±0.08
	CS19	13	11.27	0.871	0.865	0.007	0±0.00	12	10.68	0.84	0.806	-0.042	0±0.00	11	10.30	0.818	0.800	-0.023	0±0.00
	CS20	13	11.80	0.548	0.905	0.398^***	0.18±0.05	11	10.26	0.36	0.884	0.598^***	0.27±0.05	8	7.71	0.667	0.803	0.173	0.11±0.06
	CS34	10	7.99	0.645	0.701	0.081	0±0.00	11	9.92	0.68	0.805	0.158	0.05±0.05	7	6.85	0.682	0.787	0.136	0.07±0.02
	CS40	13	10.83	0.633	0.826	0.236^*	0.12±0.07	14	12.16	0.68	0.861	0.214^*	0.09±0.05	9	8.70	0.762	0.757	-0.006	0.05±0.02
	CS42	16	13.07	0.667	0.888	0.252^**	0.13±0.07	17	15.51	0.48	0.934	0.491^***	0.23±0.05	14	13.32	1.000	0.873	-0.149^*	0±0.00
	CS49	22	17.25	0.900	0.923	0.025	0.006±0.02	16	14.04	0.68	0.878	0.229^**	0.08±0.06	10	9.80	0.857	0.884	0.031	0±0.00
	CS52	9	7.67	0.677	0.784	0.138	0.07±0.05	3	3.00	0.56	0.638	0.124	0.04±0.07	6	5.90	0.619	0.681	0.092	0.006±0.04
Multilocus mean		11.38	9.74	0.684	0.805	0.153^***	0.07±0.06	9.85	8.97	0.56	0.763	0.270^***	0.11±0.09	8.38	8.06	0.681	0.500	0.093^***	0.05±0.04

Table 2 cont'd

Multiplex	Locus	Côte d’Ivoire (Bouaké, N=19)
Multiplex	Locus	A	AR	H₀	H_E	F_IS^a	r
Multiplex-1	CS02	15	15	0.842	0.94	0.107	0.05±0.05
	CS11	6	6	0.263	0.376	0.305^*	0.08±0.09
	CS36	7	7	0.579	0.869	0.34^***	0.14±0.07
	CS37	9	9	0.737	0.828	0.113	0.04±0.06
	CS50	3	3	0.526	0.519	-0.014	0±0
Multiplex-2	CS05	4	4	0.632	0.741	0.151	0.06±0.07
	CS19	12	12	0.842	0.91	0.075	0.01±0.03
	CS20	10	10	0.526	0.89	0.415^***	0.18±0.06
	CS34	7	7	0.684	0.673	-0.017	0±0
	CS40	7	7	0.632	0.68	0.073	0.05±0.06
	CS42	12	12	0.789	0.898	0.123	0.05±0.06
	CS49	9	9	0.632	0.838	0.251^*	0.12±0.06
	CS52	9	9	0.737	0.624	-0.186	0±0
Multilocus mean		8.46	8.46	0.648	0.753	0.143^***	0.06±0.06

Note N individuals number sampled, A number of alleles, AR (K=38 gene copies) allelic richness, H₀ observed heterozygosity, H_E expected heterozygosity, F_IS inbreeding coefficient or fixation index, r frequency of null alleles, ^aSignificance of deviation from Hardy–Weinberg equilibrium (HWE): *P < 0.05, **P < 0.01,***P < 0.001, Total : total observed among all four populations

From 2,045,650 reads produced by NGS sequencing 18,079 reads containing SSR motifs were identified, 52 of which were selected for PCR testing. Loci exhibiting non-specific or no amplification were excluded, as was done in similar studies [16, 21–23]. The 13 retained loci were those that consistently amplified well across all evaluated populations. The level of polymorphism of these markers (number of alleles per locus) evaluated on 98 individuals ranging from 6 to 29, with a mean of 16.54 ± 7.81 per locus (Table 2). Missing data per locus varied from 0 to 3% (3% in CS37, CS40, CS42, and CS49). The majority of low amplification loci contained missing data randomly distributed for a few individuals. The majority of these loci were from multiplex 2. This issue may be attributed to the number of loci (eight loci, see Table 1) included in this multiplex, compared to Multiplex 1 (5 loci, see Table 1), which functioned successfully across all individuals.

The number of alleles per locus ranged from five to 22, with an average of 11.34 ± 4.66 in Meyo-Ville population (Cameroon), from three to 17 with an average of 9.85 ± 4.88 in Koupa-Matapit population (Cameroon), from four to 15 with an average of 8.38 ± 3.38 in Orodara population (Burkina Faso), and from three to 15 with an average of 8.46 ± 3.33 in the Bouaké population (Côte d'Ivoire). The high average number of alleles per locus in Meyo-Ville population may be explained by the indigenous nature of the individuals (sampling from wild, uncultivated). Expected heterozygosity (H_E) varied from 0.500 (Orodara) to 0.805 (Meyo-Ville, Table 2), whereas observed heterozygosity (H₀) ranged from 0.560 (Koupa-Matapit) to 0.684 (Meyo-Ville, Table 2). Significant deviations from Hardy-Weinberg equilibrium (Table 2) were identified in three populations for three loci (CS36, CS20, and CS42), in two populations for five loci (CS02, CS11, CS05, CS40, and CS49), and in one population for a single locus (CS37). This is largely explained by the presence of null alleles. Indeed, the null allele frequency was higher at these loci compared to others within each population (Table 2). The multi-locus fixation index (F_IS) was 0.168 ± 0.034.

For this study, we developed 13 highly polymorphic microsatellite markers for the African olive tree, C. schweinfurthi, a prominent agroforestry fruit tree highly valued in Africa. These markers will facilitate the assessment and interpretation of intraspecific genetic diversity, patterns of gene flow, population structure, and reproductive biology of the species. These results are crucial for genetic improvement, understanding domestication syndrome, and the restoration of natural populations of the species, especially given the significant pressure exerted by rural populations on the natural stands of this species for various uses.

Data availability and Supplementary Information

GenBank SRA accession under to PRJNA1125310 (https://www.ncbi.nlm.nih.gov/sra/PRJNA1125310);
DNA sequences of microsatellites described in this paper were deposited in GenBank (Table 1) ;
The data and related documentations that support the findings of this study are openly available in DataSuds repository (IRD, France) at https://doi.org/10.23708/GWRGBC. Data reuse is granted under CC-BY license.

Acknowledgements

The authors thank Brahima Coulibaly (Head of CNRA's Forest-Environment Programme), Cyrille N'Gouan Kouassi (CNRA Regional Director in Bouaké), the National Centre for Agronomic Research of Côte d'Ivoire (CNRA), Mamadou SANGARE (Managing Director of SODEFOR), the Côte d'Ivoire Forest Development Company (SODEFOR), Barima Yao Sadaiou Sabas, Dolou Tonessia Charlotte and Akaffou Doffou Sélastique for facilitating access to the sample collection sites in Côte d'Ivoire. Additionally, they express their gratitude to the MOPGA (Make Our Planet Great Again) Excellence Grant for supporting Beda Innocent Adji.

Author Contributions

All authors contributed to the study. BIA, AFC, GCZ and MLAT collected the field samples. Material preparation and data collection were performed by BIA, MHS and JD. BIA and MHS undertook the experiment. BIA, MHS, MC and JD analyzed the data. The original manuscript draft was written by BIA. MC and JD corrected the manuscript. All authors read and approved the manuscript.

Funding

This work was funded by the “RainForStory” project financed by ANR (ANR-23-CE27-0023). The authors also acknowledge the ISO 9001 certified IRD i-Trop HPC (South Green Platform) at IRD Montpellier for providing HPC resources that have contributed to the research results reported within this paper.

Ethical approval

Permits for Collection and Access :

Permits for fieldwork and the collection of plant samples were authorised by SODEFOR's General Management (Cel: +225 22483000, [email protected]) under reference No. 03484-23 CT06/KA/CAK, Mr Mamadou SANGARE (Managing Director of SODEFOR), Dr Cyrille N'Gouan Kouassi (CNRA Regional Director in Bouaké, [email protected], Cel: +225 05 55 23 77 27) and Dr Brahima Coulibaly (Head of CNRA's Forest-Environment Programme, [email protected], Cel: +225 07 09 13 92 38).
This research complies with local and international guidelines on plant research and biodiversity conservation, ensuring minimal impact on natural habitats.
Applications for access and research permits (ABS Agreement of the Nagoya Protocol) have been submitted by the authors from the various countries to the Nagoya Focal Points of the countries concerned and are currently being processed.

Conflict of interest

The authors declare no conflict of interest.

Resolving with human and animal participants

No Human participants and/or Animals were involved in this study.

Kuete V (2017) Chapter 16 - Canarium schweinfurthii. In: Kuete V (ed) Medicinal Spices and Vegetables from Africa. Academic Press, pp 379–384
Mapongmetsem PM (2002) The colonizing flora of Canarium schweinfurthii in the grassfields of Cameroon. Phytoparasitica 30:119–127. https://doi.org/10.1007/BF02979694
Anozie EL, Oboho EG (2019) The Effect of Seed Source and Pre-sowing Treatment on Germination of Canarium schweinfurthii [Engl] Seeds. Asian J Res Agric For 1–11. https://doi.org/10.9734/ajraf/2019/v4i430068
Gabriel K, S. Raïssa A, Gaston R. TN (2022) Propagation of agroforestry tree species by airlayering: a case study of Canarium schweinfurthii Engl. in the Western Highlands of Cameroon. J Appl Biosci 174:18103–18112. https://doi.org/10.35759/JABs.174.6
Njoukam R, Peltier R (2002) L’aiélé (Canarium Schweinfurthii Engl.) : premier essai de plantation dansl’ouest du Cameroun. Fruits 57:239–248. https://doi.org/10.1051/fruits:2002021
Tsewoue MR, Avana Tientcheu ML, Boyah JK (2021) Structure and carbon stock of Canarium schweinfurthii (engl) (burseraceae) in coffee-based agroforestry systems of the bamboutos, west cameroon. Int J Res -GRANTHAALAYAH 9:173–186. https://doi.org/10.29121/granthaalayah.v9.i10.2021.4306
Gabriel K, S. Raïssa A, Gaston R. TN (2022) Propagation of agroforestry tree species by airlayering: a case study of Canarium schweinfurthii Engl. in the Western Highlands of Cameroon. J Appl Biosci 174:18103–18112. https://doi.org/10.35759/JABs.174.6
Botanic Gardens Conservation International (BGCI) (Botanic Gardens Conservation International (BGCI) DH, [email protected] (2018) IUCN Red List of Threatened Species: Canarium schweinfurthii. IUCN Red List Threat Species
Mboujda FMM, Rimlinger A, Tientcheu M-LA, et al (2024) Diversity of Uses and Local Knowledge Associated with Wild African Plum Trees, Dacryodes edulis, Among Different Ethnic Groups in the Congo Basin. Econ Bot 78:308–329. https://doi.org/10.1007/s12231-024-09612-2
Dumenu WK (2019) Assessing the impact of felling/export ban and CITES designation on exploitation of African rosewood (Pterocarpus erinaceus). Biol Conserv 236:124–133. https://doi.org/10.1016/j.biocon.2019.05.044
Adji BI, Akaffou DS, De Reffye P, Sabatier S (2022) Maternal environment and seed size are important for successful germination and seedling establishment of Pterocarpus erinaceus (Fabaceae). J For Res 33:977–990. https://doi.org/10.1007/s11676-021-01412-x
Mariac C, Luong V, Kapran I, et al (2006) Diversity of wild and cultivated pearl millet accessions (Pennisetum glaucum [L.] R. Br.) in Niger assessed by microsatellite markers. Theor Appl Genet 114:49–58. https://doi.org/10.1007/s00122-006-0409-9
Mariac C, Scarcelli N, Pouzadou J, et al (2014) Cost‐effective enrichment hybridization capture of chloroplast genomes at deep multiplexing levels for population genetics and phylogeography studies. Mol Ecol Resour 14:1103–1113. https://doi.org/10.1111/1755-0998.12258
Magoč T, Salzberg SL (2011) FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27:2957–2963. https://doi.org/10.1093/bioinformatics/btr507
Meglécz E, Costedoat C, Dubut V, et al (2010) QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics 26:403–404. https://doi.org/10.1093/bioinformatics/btp670
Culley TM, Weller SG, Sakai AK, Putnam KA (2008) Characterization of microsatellite loci in the Hawaiian endemic shrub Schiedea adamantis (Caryophyllaceae) and amplification in related species and genera. Mol Ecol Resour 8:1081–1084. https://doi.org/10.1111/j.1755-0998.2008.02161.x
Kearse M, Moir R, Wilson A, et al (2012) Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. https://doi.org/10.1093/bioinformatics/bts199
Holleley CE, Geerts PG (2009) Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR. BioTechniques
Hardy OJ, Vekemans X (2002) spag e d i: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol Ecol Notes 2:618–620. https://doi.org/10.1046/j.1471-8286.2002.00305.x
Chybicki IJ, Burczyk J (2009) Simultaneous Estimation of Null Alleles and Inbreeding Coefficients. J Hered 100:106–113. https://doi.org/10.1093/jhered/esn088
Kamdem NG, Sergeant S, Vercruysse C, et al (2024) Development and characterization of nuclear microsatellite markers for the African walnut Coula edulis Baill (Coulaceae). Mol Biol Rep 51:438. https://doi.org/10.1007/s11033-024-09373-0
Kusuma J, Scarcelli N, Couderc M, et al (2020) Microsatellite markers development for Indonesian nutmeg (Myristica fragrans Houtt.) and transferability to other Myristicaceae spp. Mol Biol Rep 47:4835–4840. https://doi.org/10.1007/s11033-020-05535-y
Rimlinger A, Marie L, Avana M-L, et al (2020) New microsatellite markers for Dacryodes edulis (Burseraceae), an indigenous fruit tree species from Central Africa. Mol Biol Rep 47:2391–2396. https://doi.org/10.1007/s11033-020-05270-4

No competing interests reported.

Appendix.docx

Microsatellite Markers Establishment for African Elemi (Canarium schweinfurthii Engl., Burseraceae), a Africa Prominent Wild Fruit-Bearing Forest Tree

Status:

Version 1

Abstract

Figures

Introduction

Methods

Plant material and DNA extraction

Microsatellite development

PCR conditions and microsatellite amplification tests

Microsatellite diversity analysis

Results and discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1