Mice
Female C57BL/6 mice at 8-week-old were purchased from Experimental Animal Center of Yangzhou University. Mice were housed in a specific pathogen-free animal facility and all the experiments were approved by the Jiangsu University Animal Ethics and Experimentation Committee.
Induction of ESS model
The ESS mouse model was induced as previously described (7). Briefly, bilateral salivary glands were isolated from female C57BL/6 mice for homogenization in PBS to prepare SG proteins. Naïve mice were immunized with SG proteins emulsified in an equal volume of CFA (Sigma-Aldrich) to a concentration of 2 mg/mL (100µl /mouse) s.c. on the neck on days 0 and 7. On day 14, the booster injection was performed with a dose of 1 mg/mL SG proteins emulsified in Freund’s incomplete adjuvant (Sigma-Aldrich).
Detection of saliva flow rate
Saliva flow rates were measured as previously described (7). Briefly, mice were anesthetized and injected intraperitoneally with pilocarpine (Sigma-Aldrich) at a dose of 5 mg/kg body weight. Saliva was then collected using a 20-μl pipet tip from the oral cavity for 15min.
Autoantibody and cytokine detection
Autoantibodies against SG proteins and anti-M3 muscarinic receptor (M3R) antibodies were measured with a sandwich enzyme-linked immunosorbent assay (ELISA) as previously described (7). Mouse serum levels of IL-17 and IFN-γ were measured with ELISA Kits (eBioscience) following the manufacturer’s protocol.
Isolation and Culture of BM-MSCs
For the culture of BM-MSCs, bone marrow (BM) cells were cultured in the medium (DMEM supplemented with 15% fetal calf serum) (Gibco) for 3 days. Non-adherent cells were then removed and when the remaining cells reached 80% confluence in the dish, the adherent cells were expanded for three passages and used for the subsequent experiments.
MDSC isolation
CD11b+Gr-1+ MDSCs were isolated from the spleens of ESS mice using a FACSAria II SORP (Becton Dickinson) cell sorter (Miltenyi Biotec). M-MDSCs and G-MDSCs were isolated using a mouse MDSC isolation kit (Miltenyi Biotec) following the manufacturer’s protocol.
Flow cytometric analysis
For surface markers, single-cell suspensions were stained with relevant fluorochrome-conjugated monoclonal antibodies(mAbs): anti-mouse CD40, CD80, CD86 and MHCII from eBioscience, anti-mouse CD11b, Gr-1, Ly6G and Ly6C from Biolegend, For intracellular staining, cells were stimulated with PMA (Sigma-Aldrich, 50 ng/mL), ionomycin (Enzo, 1 µg/mL), monensin (Enzo, 2 µg/mL). After 5 h, cells were stained with antibodies against surface markers, fixed, permeabilized, and stained with anti-IFN-γ mAb (eBioscience), anti- IL-17 mAb (eBioscience) or anti-TGF-β mAb (eBioscience) according to the Intracellular Staining Kit (Invitrogen) instructions. Flow cytometry was performed using the BD FACSCanto II (Becton Dickinson) and data were analyzed using FlowJo software (Becton Dickinson).
Quantitative real-time PCR (qRT-PCR)
The quantitative real-time PCR were performed as previously described. The sequences for the primers used are: TGF-β, Forward -5’- AACCGGCCCTTCCTGCTCCTCAT -3’, Reverse-5’- CGCCCGGGTTGTGTTGGTTGTAGA -3’. β-actin, Forward -5’-TGGAATCCTGTGGCATCCATGAAAC-3’, Reverse-5’-TAAAACGCAGCTCAGTAACAGTCCG-3’. β-actin was used as an internal control.
T cell suppression assay
Mouse CD4+ T cells were sorted from wild-type mice using CD4+T cell microbeads (Miltenyi Biotec). CD4+ T cells were labeled with carboxyfluorescein succinimidyl ester (CFSE, 5 mM; Invitrogen), and then co-cultured with MDSCs at a ratio of 1:1 in 96-well plates (Costar) in the presence of anti-CD3 and anti-CD28 mAbs (eBioscience) for 3 days. CFSE fluorescence intensity was analyzed to determine the proliferation of CD4+ T cells by flow cytometry.
Western blot
Proteins extracted from cells were prepared as previously described. Equal amounts of proteins were separated by 12% SDS-PAGE, then transferred onto Immobilon polyvinylidene difluoride membranes (Bio-Rad). Antibodies against Smad2/3 and p-Smad2/3 were purchased from Cell Signaling Technology.
Histologic analysis
After mice were euthanatized, submandibular glands were collected and immediately fixed in 4% paraformaldehyde. Paraformaldehyde-fixed tissues were embedded in paraffin. Serial 4-μm sections were cut and stained with hematoxylin and eosin (H&E) for morphologic examination.
Detection of arginase activity and NO production
The activity of arginase and NO concentration were measured as previously described (24).
Transfection
TGF-β siRNA and the negative control were synthesized by RiboBio. Oligonucleotide transfection was performed with Entranster-R (Engreen Biosystem) according to the manufacturer’s instructions.
Statistical analysis
The statistical significance was determined by the Student's t test or one-way ANOVA. All analyses were performed using SPSS 16.0 software. p Values less than 0.05 were considered statistically significant.