Sodium arsenite altered the parameters of oxidative stress and induced carcinogenesis and neurotoxicity in Canton-S Drosophila  melanogaster

doi:10.21203/rs.3.rs-5353681/v1

Download PDF

Research Article

Sodium arsenite altered the parameters of oxidative stress and induced carcinogenesis and neurotoxicity in Canton-S Drosophila melanogaster

https://doi.org/10.21203/rs.3.rs-5353681/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Arsenite, an inorganic arsenic compound, is not only acutely toxic but also plays a role in carcinogenicity, neurotoxicity, hepatotoxicity, and inflammation. It can also lead to various skin disorders. Drosophila melanogaster, commonly known as the fruit fly, serves as a cost-effective and efficient model organism for studying chemical-induced toxicity. This study aimed to investigate the toxic effects of sodium arsenite using Drosophila melanogaster as a model. We exposed fruit flies to increasing doses of sodium arsenite (0.03 mM, 0.06 mM, 0.12 mM, and 0.14 mM) and assessed the impacts on survival rates; oxidative stress marker levels; gene expression; and histological changes in the brain, gastrointestinal tract, and fat body over 21 days. Additionally, we examined morphological changes. Our findings indicate that exposure to sodium arsenite significantly reduces survival rates and increases oxidative stress, leading to cellular damage similar to that observed in cancer and certain neurodegenerative diseases. Histological examinations revealed structural changes in the brain, suggesting potential pathways for neurotoxicity and alterations in enterocytes that may be indicative of cancer. Changes in the fat body imply compromised energy metabolism and fat storage. These results highlight Drosophila as a valuable model for studying the carcinogenicity, neurotoxicity, and ovotoxicity induced by sodium arsenite, thus facilitating the development of treatment and prevention strategies.

Cancer

arsenite

Drosophila melanogaster

toxicity

oxidative stress

Arsenic is a toxic metalloid that is widely known for its multiple toxicities. It is a naturally occurring chemical that is found in both organic and inorganic forms. Exposure to arsenic could be oral, via inhalation or direct skin contact, with drinking water being a major source of exposure. This is because As is highly soluble in water, and most plants, such as rice, have the ability to bioaccumulate As in their tissues. When disturbed by natural processes, such as weathering, biological activity, and volcanic eruption, arsenic may be released into the environment. Arsenic can also be released into the environment by anthropogenic operations such as well drilling, mining, smelting ore, and burning fossil fuels, and natural processes such as earthquakes and volcanic eruptions can also occur [1]. Increased exposure to arsenic, especially in less developed and emerging nations, is a global issue because of its negative effects, including genetic damage that can lead to disease (WHO, 2022). Arsenic exposure threatens the health of 230 million people worldwide. These implications include increased risks for cancer, cardiovascular disease, diabetes, skin lesions, neurological disorders, kidney disease, and difficulties related to foetal development and cognition [2].

The toxicity of arsenic is a consequence of its metabolism. When absorbed, As bioaccumulates in the liver, kidneys, heart, and even lungs. The muscles and neural tissues can store lower levels of arsenic. Arsenic accumulation in various tissues has been linked to a variety of diseases, including cancer, diabetes, hepatotoxicity, neurotoxicity, cardiotoxicity [3] and dermatological diseases (Sanyal, Bhattacharjee, Paul & Bhattacharjee, 2020). Arsenic promotes chromosomal instability and clonal variability, which mediate arsenic-induced carcinogenesis, as observed in hsa-miR-186-overexpressing human keratinocytes [4]. Studies have also demonstrated that arsenic exposure leads to metabolic reprogramming, which in turn contributes to carcinogenesis, although the underlying pathways of arsenic carcinogenesis are unknown [5, 6]. The International Agency for Research on Cancer (IARC) classifies arsenic as a Class I human carcinogen [5]. Prolonged arsenic exposure poses considerable risks to human health, and severe cases can lead to breast, meningeal and brain, stomach, liver, and other digestive organ cancers and leukemia [7].

In addition to being a carcinogen, arsenic can induce neurotoxicity. Arsenics deactivate some enzymes involved in the cellular energy system, DNA synthesis, and repair. Most pathways are involved in arsenic-induced neurotoxicity, including oxidative stress, thiamine shortage, and reduced acetylcholinesterase activity [8]. Arsenic neurotoxicity has also been related to alterations in neurotransmitter metabolism, which leads to abnormalities in synaptic transmission [9]. Arsenic readily crosses the blood‒brain barrier and accumulates in the striatum and hippocampus, hence increasing arsenic toxicity and tissue injury [10].

On the basis of the knowledge of arsenic toxicity and how some of the effects are observed in most diseases, such as cancer, the use of a suitable model to express such diseases via the use of arsenic could be explored. The use of mammalian and in vitro models, although offering means of expressing diseases, has limitations [11]. The human and Drosophila genomes are similar not only in terms of genetic material but also in terms of their relationships, with several examples of similar biological systems [12]. Drosophila is a model organism used to investigate a variety of human diseases, including metabolic disorders and neurodegeneration. Flies have a short life cycle, which allows simple survival, neural function, and behavioral studies, making them suitable for modelling diseases.

However, it is necessary to develop a model that would be conducive to studying the effects of long-term exposure to arsenite. Previous studies on arsenic exposure in Drosophila melanogaster [13] did not establish any disease conditions induced by arsenic and focused only on oxidative stress. Using Drosophila melanogaster, long-term effects could be observed and extrapolated to humans since both organisms have conserved pathways. Degenerative diseases can be easily studied with the aim of developing therapeutic interventions. This study was carried out to induce toxicity via the use of arsenic.

Sodium arsenite was acquired from Oxford Lab Fine Chem LLP Vasai East, Palghar-410210, Maharashtra, India.

Experimental Flies

The mixed sex of the Canton-S strain of Drosophila melanogaster, which were no older than 3 days, was used for the study. The flies were bred on a medium comprising cornmeal with 1% w/v brewer's yeast, 1% w/v agar and 0.08% v/w nipagin at constant temperature and humidity (25°C; 60–70% relative humidity) under 12 h dark/light cycle conditions at the Drosophila Laboratory, Department of Biochemistry, College of Medicine, University of Ibadan, Oyo State, Nigeria. The flies were obtained from the Federal University of Santa Maria in Brazil and were originally obtained from the National Stock Centre in Bowling Green, Oklahoma, in the United States of America.

The experimental flies used for the study were grouped as indicated in Table 1.

Table 1

Treatment Groups
Group	Description
Group 1	Positive Control (Distilled water)
Group 2	Exposed to 0.03 mM of NaASO₂
Group 3	Exposed to 0.06 mM of NaASO₂
Group 4	Exposed to 0.12 mM of NaASO₂
Group 6	Exposed to 0.14 mM of NaASO₂
(n = 5 vials per group; 50 flies/vial).

Preparation of fly samples for biochemical assays

All flies were anaesthetized with carbon dioxide, weighed and homogenized at a ratio of 1:10 – field/volume (µL) in 0.1 M potassium phosphate buffer (pH 7.4), and centrifuged at 4,000 × g for 10 min at 4°C. The resulting supernatants were used to determine the following biochemical parameters: total thiol level, hydrogen peroxide (H₂O₂) level, reduced glutathione (GSH) level, nitric oxide content, lipid peroxidation, protein carbonyl content and gene expression.

Histology and morphology

Histology was carried out via the method described by Drobysheva, et al. [14]. Bouin solution was used to fix the flies for 24 hours. Phosphate-buffered saline was used to rinse the flies after fixation four times for 15 minutes at room temperature. The tissues of the gastrointestinal tract were placed in disposable petri dishes and covered with agarose, and the blocks were chilled at 4°C, followed by sectioning. The images were then viewed and analysed. The morphology of the whole gastrointestinal tract was observed microscopically following dissection of the flies in phosphate buffer solution. Images were viewed and analysed via ImageJ software.

Effect of Sodium Arsenite on the Survival Rate

Flies were subjected to sodium arsenite (NaAsO₂) at different doses (0, 0.03, 0.06, 0.12, and 0.14 mM/g diet) for 21-day survival analysis. The flies were observed for survival via the method described by Farombi, et al. [15]. The daily death rate of the flies was recorded, and the Kaplan‒Meier survival method was used to assess the survival rate of the flies exposed to sodium arsenite in contrast to the positive control group, which had not been exposed to arsenite.

Biochemical analysis of oxidative stress markers

Flies were exposed to 0.03, 0.06, 0.12, and 0.14 mM/g diet concentrations of sodium arsenite (NaAsO₂) for 10 days to carry out biochemical analysis, gene expression studies, and histology and morphological examinations.

Lowry’s method was used to determine the protein concentration. The protein concentrations of the various samples were determined via the modified Lowry method as described by Everette, et al. [16].

The total thiol level was analysed via the method of Ellman [17]. To perform the test, 510 µL of 0.1 M phosphate buffer (pH 7.4) was added to 35 µL of 1 mM DTNB, 35 µL of distilled water, and 20 µL of sample, mixed and allowed to incubate for 30 minutes at room temperature, and the absorbance was read at 412 nm.

Glutathione-S-transferase activity was evaluated via the method described by Habig and Jakoby [18]. Solution A was prepared by mixing 0.25 M potassium phosphate buffer (20 µL), 2.5 mM EDTA, 10.5 µL of distilled water and 0.1 M GSH (500 µL) at pH 7.0 and 25°C. A total of 20 µL of the sample, at a ratio of 1:5 dilution, was added to 270 µL of solution A, followed by the addition of 10 µL of 25 mM CDNB. The absorbance was read at 340 nm for 5 min at intervals of 10 seconds via a spectrophotometer.

The hydrogen peroxide level was measured according to the method described by Wolff (1994). After the sample was incubated in the FOX 1 reagent for 30 minutes at room temperature, the absorbance at 560 nm was measured. Protein concentrations in µmole/mg were converted to H2O2 values derived from a standard curve.

The method described by Beutler, et al. [19] was used to assess the level of reduced glutathione (GSH). Serial dilutions of GSH stock solutions containing 20–200 µg of reduced glutathione were prepared in different test tubes and made up to 100 µl with 0.1 M phosphate buffer, pH 7.4. Approximately 900 µl of Ellman’s reagent was then added to each sample tube. Readings were taken immediately after the addition of Ellman’s reagent, as there could be a loss of 1–2% color 5–10 minutes. The GSH concentration in each test tube was determined, and the absorbance was read at 412 nm.

The nitric oxide concentration was analysed via the Greiss method as described by Johnson, et al. [20]. For 20 min at room temperature, 250 µL of each sample was incubated with 250 µL of Griess reagent. By comparing the absorbance of the sample with that of a standard solution with a known nitrite concentration, the nitrite concentration was determined via spectrophotometric measurement at 550 nm.

The protein carbonyls were evaluated as described previously Wehr and Levine [21]. First, 2.0 g of DNPH (dry weight) was dissolved in 1,000 mL of 2 M HCl and stirred in the dark. Afterwards, it was filtered and concentrated by precipitation in 10% trichloroacetic acid via slow speed centrifugation to form a loose, easily dispersed pellet for 2 min at 2,000 × g. 0.5 mL of the solution was added to the sample and vortexed to suspend the sample. The tubes were allowed to stand for 10 min at room temperature, with occasional vortexing. TCA (10%) was added to precipitate the pellets, which were recovered via slow speed centrifugation. The supernatant was removed, and free DNPH was extracted by rinsing with 1 mL of ethanol-ethyl acetate three times, after which the mixture was centrifuged at 5000 × g for 2 minutes. The supernatant was discarded, and the pellet was dried. The dried pellet was redissolved in 200 µL of 6.0 M guanidine 500 mM KCl (pH 2.5) and centrifuged. The solution was read at 370 nm and 276 nm.

Acetylcholinesterase activity was assayed via the method of Ellman, et al. [22]. The process was started by adding 0.8 mM acetylthiocholine to a mixture of 1 mM DTNB and 0.1 M potassium phosphate buffer (pH 7.4). For two minutes, the absorbance was measured at 412 nm every thirty seconds. The AChE activity was measured in µmol of hydrolysed acetylthiocholine per minute per milligram of protein, which was expressed in mmol of hydrolysed acetylthiocholine per minute per milligram of protein.

Effect of Sodium Arsenite on Gene Expression

The effect of sodium arsenite on the Ras gene was determined via mRNA expression kits. Extraction of mRNA was carried out via the Quick-RNA™ MiniPrep Plus Kit, and cDNA was synthesized via the ProtoScript II First Strand cDNA Synthesis Kit according to the manufacturer’s protocols. Quantitative real-time PCR was carried out to evaluate the expression of the identified genes in the flies. RNA isolation and extraction were carried out rapidly on ice to prevent degradation by RNase. The primers used are presented in Table 2:

Table 2

Primers
Genes	Sequence
p53	F 5’ ATCCAGCCTACGGAGGCAAC 3’ R 5’ CGACCTCCGTGGAGTCATCC 3’
RAS	F 5’ ACGGCAAATCGAAAACGGAC 3’ R 5’ TCGGCTTGTTCATTTTGCGG 3’
CNC	F 5’ CGCCAACGAGGTGGAAATCG 3’ R 5’ CGCCTCCTGGTCCAAACTGA 3’
SOD1	F 5’ CATCGGGTGCGGCGTTATT 3’ R 5’ AATAACGCCGCACCCGATG 3’

Statistical analysis

The data were statistically analysed via GraphPad Prism software (version 9.5.1) from San Diego, CA, USA. The results are presented as the means plus standard deviations (SDs). To assess significant differences, Tukey's post hoc test was employed. Additionally, the statistical significance of the survival rate was determined via the log-rank (Mantel‒Cox) test.

Effect of Sodium Arsenite on the Survival Rates of Drosophila melanogaster

This chart displays Drosophila melanogaster survival rates after 21 days of exposure to various doses of sodium arsenite. The survival rate in the group exposed to the maximum concentration (0.14 mM/g diet) was significantly lower (p = 0.021), with only a 12% survival rate compared with 48% survival in the control group after 21 days of exposure. These findings suggest that higher concentrations of sodium arsenite are harmful and could reduce longevity.

Histology and morphology

The histology of the digestive tract, fat body, and brain demonstrated that sodium arsenite had a detrimental effect on these tissues. Figure 2 below depicts the histology of the dissected organs, which were stained with haematoxylin and eosin (HE) and viewed via 400x objectives.

Histology of the Intestine of Drosophila melanogaster

Figure 2 shows the impact of sodium arsenite on the intestine. Coagulative necrosis was observed in the intestine of the fly exposed to sodium arsenite (Fig. 2b), and the arrows indicate areas where hyperchromacia and hypertrophy were observed in the enterocytes (HE x400) compared with those in the unexposed Drosophila melanogaster. The hyperchromacia was distinguished by a dense purple colouration compared with the positive control, and hypertrophy was identified by separate and well-defined tissues that appeared fuller than the positive control (Fig. 2b). Compared with the positive control, the enterocytes of the sodium arsenite-exposed flies appeared disrupted, as indicated by the stars.

Fat body of Drosophila melanogaster

The image in Fig. 2 above shows histological images of fat bodies from unexposed and exposed flies. Compared with that of the unexposed group (Fig. 2d), which had no observable lesions, the fat body of the sodium arsenite-exposed group (Fig. 2c) was atrophied. Compared with unexposed flies, exposed flies presented significantly altered tissue structure, demonstrating that sodium arsenite exposure causes negative changes in fat body morphology. These findings suggest that As can affect energy storage and metabolism in flies.

Brains of Drosophila melanogaster

The exposed group (Fig. 2e) exhibited loss of gray matter neurons and white matter, with deformed structures, whereas the unexposed group (Fig. 2f) seemed normal, with no visible abnormalities. This implies that sodium arsenite could be neurotoxic, with the ability to cross the blood–brain barrier, causing damage to brain tissue.

Fly morphological changes

There were no physiological changes observed in the flies, although arsenic toxicity was observed in the movement of the flies. The flies exhibited extreme weakness; therefore, male and female flies were dissected to observe whether there were any change(s) within the internal organs. Compared with the plants in the unexposed group, the plants in the male Drosophila group exhibited more tumor-like growth on the surface (Fig. 3b) (Fig. 3a). This was measured via ImageJ software, and the size of the tumor-like growth was 0.18 mm × 0.28 mm. In the dissected female fly, the ovaries ruptured (Fig. 6c), which suggests that the compound could be ovotoxic.

Biochemical analysis of markers of oxidative stress

The results of the biochemical analysis of the oxidative stress markers are shown in Fig. 4.

Hydrogen Peroxide Levels

The bar chart in Fig. 4 shows the concentrations of hydrogen peroxide in the various treatment groups. Compared with the control group (24.84 ± 0.46 mmol/mL), the group exposed to 0.14 mM/g of sodium arsenite presented a significant increase in hydrogen peroxide levels (35.08 ± 3.14 mmol/mL) (p = 0.0007). These findings indicate that arsenic exposure promotes increased oxidative stress, as demonstrated by increased hydrogen peroxide generation, which may overwhelm cellular antioxidant defenses, leading to the development of degenerative diseases.

Total thiol concentration

The total thiol content was measured because arsenite is known to have high affinity for thiol groups. At relatively low concentrations, the thiol content was not affected, which could imply that the concentration of arsenite was not high enough to cause a decrease in the thiol pool of the system. However, as the concentration increased, the thiol content decreased significantly (p = 0.029) at 0.14 mM/g diet of arsenite. This was an indication of a compromised antioxidant system (Fig. 4).

Reduced Glutathione Concentrations

Reduced glutathione (GSH) is a nonenzyme antioxidant. It is responsible for the detoxification of arsenite. However, owing to the thiol groups present in GSH, arsenite tends to bind to the thiol groups, thereby depleting the concentration of GSH due to the formation of the arsenite-GSH complex. The results in Fig. 4 show that at low concentrations, GSH was not depleted, but there was a significant decline (p = 0.0003) in the GSH level of the group exposed to 0.14 mM/g diet of sodium arsenite.

Nitric oxide concentration

Following exposure to sodium arsenite, nitric oxide levels increased in the groups exposed to lower concentrations. At higher concentrations (0.12 mM/g diet and 0.14 mM/g diet), the concentration of nitric oxide decreased in a dose-dependent manner, with p values of 0.00017 and 0.0088, respectively.

Protein carbonyl concentration

In the presence of oxidative stress, free radicals, which can bind randomly to macromolecules, are produced. Binding of these free radicals to amino acids in the protein components of the cell leads to the production of protein carbonyls via protein oxidation. Amino acids are oxidized by free radicals. The results of the present study (Fig. 4) revealed that, at lower concentrations, the protein carbonyl levels were low. However, there was a corresponding increase in arsenite concentration with increasing protein carbonyl content (p = 0.0009).

Glutathione-S-Transferase Activity

The antioxidant system is composed of enzyme and nonenzyme components. Glutathione-S-transferase (GST) is an antioxidant enzyme involved in the detoxification of arsenic. Owing to the presence of thiol-containing amino acids, arsenic tends to have high affinity for proteins. The results of this study in Fig. 4 show that at low concentrations, arsenite does not affect the activity of the protein, but an increase in the concentration of sodium arsenite leads to decreased enzyme activity (p = 0.013).

Acetylcholinesterase activity

Acetylcholinesterase (AChE) is a hydrolase involved in neurotransmission. It degrades acetylcholine to acetic acid and choline. Inhibition of its activity can lead to the development of neurodegenerative diseases. At a relatively high concentration of sodium arsenite (0.14 mM), the activity of AChE decreased significantly (p = 0.01).

Gene expression of sodium arsenite-exposed Drosophila melanogaster

The effects of sodium arsenite on genes were also observed. The results (Fig. 4) revealed that p53 was downregulated in the exposed group. The Ras oncogene was overexpressed. SOD1 was downregulated, and CNC was also overexpressed.

In this study, multiple toxic effects of sodium arsenite were observed in flies. This provides an avenue for studying different conditions in Drosophila melanogaster, underscoring it as a model that fits into the desired scope in in vivo studies. The outcome of the overall study equates the observed toxicity to the toxic effects of arsenic also observed in humans.

Different studies have shown that arsenic has a negative effect on the lifespan of individuals, reducing their lifespan and reducing their quality of health. In this study, the survival rate of the flies decreased upon exposure to arsenic. In this study, flies exposed to relatively high concentrations of sodium arsenite for 21 days presented a relatively high mortality rate, possibly due to arsenic accumulation. This finding is consistent with a prior study by Rahman, et al. [23], which indicated that arsenic exposure can increase mortality in humans. This may be attributed to arsenic accumulation in flies due to their overwhelmed system, resulting in a shorter survival rate of the flies [24]. Epidemiological studies have also shown that arsenic exposure can have negative health consequences, including mortality, depending on the quantity and duration of exposure [25]. Chronic or acute exposure to high levels of inorganic arsenic over time can result in mortality.

As in humans and other living organisms, arsenic can induce oxidative stress in flies. The results of the markers of oxidative stress revealed that exposure to arsenite triggered oxidative stress in flies similar to that in higher organisms, including humans. Oxidative stress has been proposed as a possible mechanism for arsenite toxicity. Increased oxidative stress owing to an imbalance in the antioxidative system caused by excessive ROS might overwhelm the system, leading to different disease conditions.

This study demonstrated that arsenic-induced toxicity in flies increased hydrogen peroxide production, which could be associated with the activities of NADPH oxidase, a transmembrane protein that metabolizes oxygen and water to form hydrogen peroxide. This enzyme, present in both phagocytic and nonphagocytic cells, is usually overexpressed in response to arsenite [26]. It produces superoxide anion radicals (O₂⁻) by reducing oxygen via NADPH or NADH. Electrons are transferred from NADPH in the cytosol to FAD, the inner and outer heme, and O₂ outside the cell, resulting in reactive and short-lived O₂⁻. These reactive O₂⁻ can dismutate spontaneously into H₂O₂ or via SOD [27]. These findings indicate that arsenic exposure can induce ROS production via NADPH oxidase activity.

In this study, increasing the concentration of sodium arsenite resulted in a decrease in the level of reduced glutathione (GSH), an important antioxidant in cells that decreases arsenic-induced ROS and increases arsenic excretion. GSH is responsible for detoxifying arsenite and converting pentavalent arsenic to trivalent arsenic in cells. However, the propensity of arsenic to complex with thiol-containing compounds contributes to its toxicity since it depletes the antioxidant pool in mitochondria by complexing with reduced glutathione, increasing the vulnerability of the cell to oxidative stress-induced damage and death. When arsenic exposure increases, the activity is overwhelmed, resulting in a decrease in GSH synthesis. In addition, arsenite reduces glutamate levels, which in turn leads to a decrease in GSH synthesis [28].

This study revealed that total thiol levels decreased after exposure to arsenite. The toxicity investigation revealed that total thiol levels decreased as the sodium arsenite concentration increased, which is consistent with earlier research [29, 30]. Inorganic As III binds to thiol-containing compounds and protein-cysteine thiols, which can inhibit enzyme activity. Exporting inorganic arsenic-GSH adducts from the cell is crucial for detoxification because of their ability to bind to protein thiols. Dithiol molecules and proteins with surrounding cysteine molecules have been shown to bind inorganic As III [9].

Protein oxidation perturbs the cellular redox balance, altering the cell cycle and possibly causing neuronal death. Protein carbonylation is a defining feature of oxidative stress and involves the direct oxidation of lysine, arginine, proline, and threonine side chains, resulting in reactive ketones or aldehydes that react with 2,4-dinitrophenylhydrazine to produce hydrazones [31]. In addition to the known oxidation of essential proteins involved in DNA damage repair, oxidatively damaged proteins specifically impair DNA repair processes. Oxidative proteome damage is an independent cause of DNA damage and a separate inducer of DNA damage repair dysfunction. As a result, genetic modifications typically continue longer, increasing the likelihood of generating oncogenic mutations [32]. These oncogenic mutations give rise to carcinogenesis.

The activity of GST decreased significantly with increasing concentrations of sodium arsenite, which could be due to inhibition of the enzyme by arsenite, as observed in other studies [13, 33, 34]. The production of ROS when exposed to arsenic results in the formation of GSH complexes containing trivalent arsenicals. This process promotes arsenite methylation or membrane transfer, which results in the detoxification of arsenite and its metabolites. However, GST activity is usually inhibited in the presence of arsenite, which prevents GST conjugation with GSH. Increased ROS levels deactivate antioxidant enzymes, resulting in lower antioxidant enzyme levels and cell toxicity.

Nitric oxide (NO) is a well-known autocrine and paracrine signalling agent that performs pleiotropic functions, including the modulation of blood flow and circulation, thrombosis, inflammation, immunological control, and brain activity [35]. In this investigation, there was a decrease in the concentration of nitric oxide in the flies, which contradicts the findings of the study conducted by Oyibo, et al. [13]. The effect of arsenite on NO generation varies with cell type, increasing in some and decreasing or even having no effect on others. This could be due to the use of the Canton S strain of D. melanogaster, as opposed to the Harwich strain used in other studies (Oyibo et al., 2021). However, in investigations where NO production is reduced by exposure to arsenite, it was postulated that the decline could be related to lower endothelial NO synthase (eNOS) expression and/or its phosphorylation at serine, which is associated with an increased risk of vascular disorders [36]. Nitric oxide synthase (NOS) is important for the production of NO and L-citrulline from L-arginine, molecular oxygen, and NADPH. It exists in various isoforms, including endothelial NOS (eNOS), neuronal NOS (nNOS), and inducible NOS (iNOS). These isoforms play vital roles in various physiological and pathological processes. Endothelial dysfunction is caused primarily by oxidative stress, which has been linked to endothelial NO synthase dysfunction caused by eNOS uncoupling. This uncoupling occurs when NOS activity releases superoxide or hydrogen peroxide, negatively impacting NO bioavailability and potentially destroying NO generated elsewhere [37]. eNOS uncoupling may occur when NADPH oxidase is activated, which is sustained when exposed to arsenite, thus releasing ROS [38]. When NO activity is disrupted, it leads to disease conditions such as atherosclerosis. Overwhelming ROS production surpasses antioxidant defences, and oxidative stress results, which compromises endothelial function. Atherosclerosis is a result of both vascular oxidative stress and NO, with well-known cardiovascular risk factors such as smoking, diabetes, high blood pressure, and high cholesterol increasing the production of ROS and lowering endothelial NO production. Important molecular pathways in atherogenesis are facilitated by vascular oxidative stress, whereas the same activities are inhibited by NO [39].

Arsenite binds to AChE to inhibit its activity. This has been attributed to its ability to form diester bonds with the tyrosine residue of the protein [40]. Inhibition of protein activity leads to the accumulation of acetylcholine, which can eventually lead to neurodegeneration. Most routinely used compounds can cause neurotoxicity by inhibiting acetylcholinesterase (AChE) activity. Acetylcholine facilitates neurotransmission at neuromuscular junctions and numerous synapses in the central nervous system. Thus, arsenite could be linked to neurotoxicity, as Drosophila melanogaster can be used as a model to study and understand the mechanism of neurotoxicity induced by arsenite. The toxicity of trivalent arsenicals is caused by their interaction with sulfhydryl groups in proteins. This binding can cause changes in the conformation of proteins, their functions, and even interactions with other functional proteins. As a result, research on arsenic binding to proteins is critical for understanding arsenic toxicity and creating arsenic-based therapies [1].

The ovarian toxicity of arsenic has also been confirmed. In the present study, we observed that the ovaries ruptured following exposure to arsenic. A previous study confirmed that exposure to arsenic leads to an overall decline in ovarian functions, such as disruption of steroidogenesis, where the effect of arsenic exposure leads to decreased levels of estradiol (E2) and other steroid hormones [41]. Additionally, the histology of fat bodies revealed arsenic toxicity, which led to atrophy of fat body cells. This finding corroborates the findings of Zhang, et al. [42] that arsenite trioxide induces hepatotoxicity. The fat body in Drosophila melanogaster performs functions similar to those of the human liver, making it a suitable model for studying liver-related conditions. The Drosophila fat body is an organ that resembles liver and adipose tissue, storing fat and acting as a detoxifying and immunological response system [43]. The results of this study suggest that sodium arsenite could be used to induce toxicity in these organs in Drosophila melanogaster for the purpose of developing therapeutic strategies.

One of the hallmarks of cancer is oxidative stress. For example, hydrogen peroxide is diffusible, crosses membranes via aquaporins (AQPs), and initiates cell signalling [44]. It is also known to cause cellular damage at extremely high concentrations. A high quantity of hydrogen peroxide is one of the hallmarks of the tumor microenvironment. Hydrogen peroxide accumulation can increase oxidative stress and reflect the development of numerous diseases, making it a potential cancer diagnostic marker [45]. Low thiol levels are associated with cancer. A study on the native and total thiol levels of lung cancer patients revealed that the progression and risk of lung cancer can be associated with reduced total thiol levels[46], as can prostate [47] and breast [48] cancer. On the other hand, reduced GST activity can result in the accumulation of reactive oxygen species (ROS), which can damage DNA and initiate or promote carcinogenesis. Carcinogens are generally detoxified by GST, but decreasing activity might lead to the accumulation of carcinogens, potentially initiating or promoting cancer. As a result, GST plays an important role in antioxidant activity. Owing to the roles these markers play in carcinogenesis, arsenite-induced carcinogenesis in Drosophila melanogaster could be explored and used for cancer-related studies.

In addition to oxidative stress markers and their possible roles in cancer, Drosophila is a suitable model for studying gastrointestinal-related diseases. The tumor-like growth observed in Drosophila suggests that arsenite can induce gastrointestinal tract cancer. This finding supports the findings of the study carried out by Kasmi, et al. [49]. In this study, we observed tumor-like growth, with distorted enterocytes characterized by hypertrophy and hyperchromacia, alongside the overexpression of Ras, which corroborates the findings of Martorell, et al. [50] that these features of colorectal cancer are expressed in the gastrointestinal tract of Drosophila melanogaster. Ras activation is a cancer-specific characteristic in Drosophila and humans that regulates both growth and cancer. It is associated with Hpo activity in Drosophila epithelial cells, which causes tissues to shift from pro-differentiative to pro-growth processes. Ras also promotes cell proliferation by regulating the transcription of growth factors and their receptors, which influences Drosophila growth and may cause cancer [51].

In addition to antioxidant systems, the effects of sodium arsenite on genes also underscore the use of Drosophila melanogaster as a model to induce diseases related to these genes via the use of arsenite. The overexpression of Ras has been implicated in a wide range of cancers and is currently explored for targeted therapy in cancer research. In this study, SOD1 was downregulated after exposure to sodium arsenite, which is consistent with the findings of Perker, et al. [52] and Sun, et al. [53], who reported that arsenite exposure causes SOD1 downregulation. SOD1 downregulation has been associated with a range of pathologies, including amyotrophic lateral sclerosis (ALS), cancer, accelerated ageing and age-related diseases [54]. The downregulation of SOD is critical for cancer development because it decreases detoxification, resulting in the accumulation of reactive oxygen species. This oxidative stress affects DNA, proteins, and lipids, resulting in mutations and genome instability. Low SOD levels reduce cell antioxidant defense, increasing the vulnerability of cells to harm. This downregulation can also affect cell signalling pathways, which help cancer cells grow and survive [55]. CNCs provide a practical and accessible model for studying the structure, function, and biology of Nrf2 transcription factors at different levels, utilizing the extensive genetic, genomic, and biochemical processes found in Drosophila [56]. Nrf2 is the human homologue of Drosophila CNC, and the results of this study revealed that Nrf2 was overexpressed. When Nrf2 activity is elevated, cancer cells become more resistant to radiation and chemotherapy. Furthermore, Nrf2 is essential for metabolic reprogramming during the development of cancer stem cells [57].

Neurotoxicity can also be modelled in Drosophila melanogaster via the use of arsenite on the basis of the results of this study. NO, AChE, and SOD1 have direct implications for neurotoxicity, which was demonstrated in this study on the basis of the results. SOD1, for example, is important for cytoprotection, gene transcription, and physiological regulation since it modulates signal transduction pathways in response to neurotoxic stimuli, leading to the release of reactive oxygen species, and can serve as a target for modifying or developing therapies for neurodegenerative disorders [58]. Acetylcholinesterase inhibitors cause acetylcholine to accumulate, leading to overstimulation of parasympathetic nervous system symptoms such as hypermotility, hypersecretion, bradycardia, miosis, diarrhea, and hypotension. Involuntary movements at neuromuscular junctions and muscle fibrillation, fasciculation, and paralysis could be indicators of acetylcholine toxicity [59].

Drosophila melanogaster serves as an effective model for studying diseases. The challenges posed by sophisticated methods and the need for affordable models often hinder research on certain disease conditions. In this study, we examined the toxicity of sodium arsenite in Drosophila melanogaster. Our findings revealed a significant decline in survival rates, impacts on oxidative stress markers, and disruptions in the histological integrity of critical tissues, including the brain, ovaries, and fat bodies. Additionally, we observed alterations in gene expression. These results not only increase our understanding of arsenic toxicity but also suggest that sodium arsenite could be used to induce toxicity, such as carcinogenicity, neurotoxicity, and ovotoxicity, in Drosophila melanogaster.

AChE

Acetylcholinesterase

GST

Glutathione–S–Transferase

GSH

Reduced glutathione

H₂O₂

Hydrogen Peroxide

Sodium arsenite

Credit Authorship Contribution Statement

Conceptualization: Titilayo O. Johnson; Methodology: Titilayo O. Johnson, Jane-Rose I. Oche; Formal analysis and investigation: Jane-Rose I. Oche; Writing - original draft preparation: Jane-Rose I. Oche; Writing - review and editing: Jonathan D. Dabak, Titilayo O. Johnson; Funding acquisition: not applicable; Resources: Jane-Rose I. Oche, Jonathan D. Dabak, Titilayo O. Johnson; Supervision: Titilayo O. Johnson

Declaration of competing interests

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

FUNDING

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Shen S, Li XF, Cullen WR, Weinfeld M, Le XC (Oct 9 2013) Arsenic binding to proteins, (in eng). Chem Rev 113(10):7769–7792. 10.1021/cr300015c
Bhat A, Ravi K, Tian F, Singh B (2024) Arsenic Contamination Needs Serious Attention: An Opinion and Global Scenario, Pollutants, vol. 4, no. 2, pp. 196–211, [Online]. Available: https://www.mdpi.com/2673-4672/4/2/13
Singh AP, Goel RK, Kaur T (2011) Mechanisms pertaining to arsenic toxicity, (in eng), Toxicol Int, vol. 18, no. 2, pp. 87–93, Jul 10.4103/0971-6580.84258
Lykoudi A, Cardoso APF, Wise SS, Banerjee M, States JC (2023) Clonal variability in chromosomal instability as a potential driver in the acquisition of tumorigenic phenotype in chronic arsenic-exposed and hsa-miR-186 overexpressing human keratinocytes. Toxicol Appl Pharmcol, p. 116730
Ruan Y et al (2022) Metabolic reprogramming in the arsenic carcinogenesis. Ecotoxicol Environ Saf 229:113098
Cardoso APF, Al-Eryani L, States JC (2018) Arsenic-induced carcinogenesis: the impact of miRNA dysregulation. Toxicol Sci 165(2):284–290
Rahmani A et al (2023) The association of arsenic exposure with mortality due to cancer, diabetes, Alzheimer's and congenital anomalies using Poisson regression. Sci Rep 13(1):15456
Mochizuki H (2019) Arsenic Neurotoxicity in Humans, International Journal of Molecular Sciences, vol. 20, no. 14, p. 3418, [Online]. Available: https://www.mdpi.com/1422-0067/20/14/3418
Garza-Lombó C, Pappa A, Panayiotidis MI, Gonsebatt ME, Franco R (2019) Arsenic-induced neurotoxicity: a mechanistic appraisal. J Biol Inorg Chem 24:1305–1316
Thakur M, Rachamalla M, Niyogi S, Datusalia AK, Flora SJS (2021) Molecular mechanism of arsenic-induced neurotoxicity including neuronal dysfunctions. Int J Mol Sci 22(18):10077
Davis EE, Frangakis S, Katsanis N Interpreting human genetic variation with in vivo zebrafish assays, Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, vol. 1842, no. 10, pp. 1960–1970, 2014/10/01/2014, https://doi.org/10.1016/j.bbadis.2014.05.024
Calap-Quintana P, González-Fernández J, Sebastiá-Ortega N, Llorens JV, Moltó MD (2017) Drosophila melanogaster Models of Metal-Related Human Diseases and Metal Toxicity, International Journal of Molecular Sciences, vol. 18, no. 7, p. 1456, [Online]. Available: https://www.mdpi.com/1422-0067/18/7/1456
Oyibo A, Abolaji AO, Odunola OA (2021) Carcinogen sodium arsenite disrupts antioxidant and redox homeostasis in Drosophila melanogaster. J Basic Clin Physiol Pharmacol no. 0:000010151520200235
Drobysheva D et al (2008) An optimized method for histological detection of dopaminergic neurons in Drosophila melanogaster, (in eng), J Histochemistry Cytochemistry, vol. 56, no. 12, pp. 1049-63, Dec 10.1369/jhc.2008.951137
Farombi EO, Abolaji AO, Farombi TH, Oropo AS, Owoje OA, Awunah MT Garcinia kola seed biflavonoid fraction (Kolaviron), increases longevity and attenuates rotenone-induced toxicity in Drosophila melanogaster. Pestic Biochem Physiol, 145, pp. 39–45, 2018/02/01/2018, doi: https://doi.org/10.1016/j.pestbp.2018.01.002
Everette JD, Bryant QM, Green AM, Abbey YA, Wangila GW, Walker RB (2010) Thorough study of reactivity of various compound classes toward the Folin – Ciocalteu reagent. J Agric Food Chem 58(14):8139–8144
Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem Biophys 82(1):70–77
Habig WH, Jakoby WB (1981) [27] Glutathione S-transferases (rat and human). Methods in Enzymology, vol 77. Academic, pp 218–231
Beutler E, Duron O, Kelly BM (1963) Improved method for determination of blood glutathione
Johnson TO et al Benzo[a]pyrene and Benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide induced locomotor and reproductive senescence and altered biochemical parameters of oxidative damage in Canton-S Drosophila melanogaster. Toxicol Rep, 8, pp. 571–580, 2021/01/01/2021, doi: https://doi.org/10.1016/j.toxrep.2021.03.001
Wehr NB, Levine RL (2013) Quantification of protein carbonylation. Cell Senescence: Methods Protocols, pp. 265–281
Ellman GL, Courtney KD, Andres V Jr, Featherstone RM (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem Pharmacol 7(2):88–95
Rahman M et al (2019) Arsenic exposure and young adult's mortality risk: A 13-year follow-up study in MATLAB. Bangladesh Environ Int 123:358–367
Anushree MZ, Ali AL, Bilgrami, Ahsan J (2023) Acute Exposure to Arsenic Affects Pupal Development and Neurological Functions in Drosophila melanogaster, Toxics, vol. 11, no. 4, p. 327
Garkal A, Sarode L, Bangar P, Mehta T, Singh DP, Rawal R (2023) Understanding arsenic toxicity: Implications for environmental exposure and human health. J Hazard Mater Lett, p. 100090
Zhou X, Speer RM, Volk L, Hudson LG, Liu KJ (2021) Arsenic cocarcinogenesis: Inhibition of DNA repair and interaction with zinc finger proteins. Seminars in cancer biology, vol 76. Elsevier, pp 86–98
Zasu A et al (2022) NADPH-Oxidase Derived Hydrogen Peroxide and Irs2b Facilitate Reoxygenation-Induced Catch-Up Growth in Zebrafish Embryo. Front Endocrinol 13:929668
Ran S, Liu J, Li S (2020) A systematic review of the various effect of arsenic on glutathione synthesis in vitro and in vivo, BioMed Research International, vol. no. 1, p. 9414196, 2020
Ugbaja RN et al Flavonoid-rich fractions from Clerodendrum volubile and Vernonia amygdalina extenuates arsenic-invoked hepato-renal toxicity via augmentation of the antioxidant system in rats. Clin Nutr Open Sci, 35, pp. 12–25, 2021/02/01/2021, doi: https://doi.org/10.1016/j.nutos.2020.12.003
Mahajan L, Verma PK, Raina R, Pankaj NK, Sood S, Singh M (2018) Alteration in thiols homeostasis, protein and lipid peroxidation in renal tissue following subacute oral exposure of imidacloprid and arsenic in Wistar rats. Toxicol Rep 5:1114–1119
Martínez-Orgado J et al (2023) Protein Carbonylation as a Biomarker of Oxidative Stress and a Therapeutic Target in Neonatal Brain Damage, (in eng), Antioxidants (Basel), vol. 12, no. 10, Oct 10., 10.3390/antiox12101839
Tramutola A et al (2020) Protein Oxidative Damage in UV-Related Skin Cancer and Dysplastic Lesions Contributes to Neoplastic Promotion and Progression, Cancers, vol. 12, no. 1, p. 110, [Online]. Available: https://www.mdpi.com/2072-6694/12/1/110
Wang C et al (2019) The variable regulatory effect of arsenic on Nrf2 signalling pathway in mouse: a systematic review and meta-analysis. Biol Trace Elem Res 190:362–383
Ojo OO, Fatokun DI, Ejidike IP, Awolope RU, Sanni SO (2022) Quercetin Zinc and Iron Metal Complexes Protect against Sodium Arsenite Intoxication in the Hepato-Renal System of Wistar Rats via the Oxidative Stress Pathway, Journal of Toxicology, vol. 2022
Tran N, Garcia T, Aniqa M, Ali S, Ally A, Nauli SM (2022) Endothelial nitric oxide synthase (eNOS) and the cardiovascular system: In physiology and in disease states. Am J biomedical Sci Res 15(2):153
Seo J et al (2014) Arsenite acutely decreases nitric oxide production via the ROS—protein phosphatase 1—endothelial nitric oxide synthase-thr497 signalling cascade. Biomolecules Ther 22(6):510
Lundberg JO, Weitzberg E (2022) Nitric oxide signalling in health and disease, Cell, vol. 185, no. 16, pp. 2853–2878
Zhang Y, Murugesan P, Huang K, Cai H (Mar 2020) NADPH oxidases and oxidase crosstalk in cardiovascular diseases: novel therapeutic targets, (in eng). Nat reviews Cardiol 17(3):170–194. 10.1038/s41569-019-0260-8
Förstermann U, Xia N, Li H (2017) Roles of vascular oxidative stress and nitric oxide in the pathogenesis of atherosclerosis. Circul Res 120(4):713–735
Page JD, Wilson IB (1985) Acetylcholinesterase: inhibition by tetranitromethane and arsenite. Binding of arsenite by tyrosine residues. J Biol Chem 260(3):1475–1478
Chen Y et al (2022) Arsenic exposure diminishes ovarian follicular reserve and induces abnormal steroidogenesis by DNA methylation. Ecotoxicol Environ Saf 241:113816
Zhang Z et al Clinical Indicators of Hepatotoxicity in Newly Diagnosed Acute Promyelocytic Leukemia Patients Undergoing Arsenic Trioxide Treatment. Biol Trace Elem Res, 202, 1, pp. 122–132, 2024/01/01 2024, 10.1007/s12011-023-03676-2
Musselman LP et al Role of Fat Body Lipogenesis in Protection against the Effects of Caloric Overload in Drosophila*. J Biol Chem, 288, 12, pp. 8028–8042, 2013/03/22/2013, doi: https://doi.org/10.1074/jbc.M112.371047
Vilchis-Landeros MM, Matuz-Mares D, Vázquez-Meza H (2020) Regulation of metabolic processes by hydrogen peroxide generated by NADPH oxidases, Processes, vol. 8, no. 11, p. 1424
Yang N, Xiao W, Song X, Wang W, Dong X (2020) Recent advances in tumor microenvironment hydrogen peroxide-responsive materials for cancer photodynamic therapy. Nano-Micro Lett 12:1–27
Şener MU et al (2020) Evaluation of thiol/disulfide homeostasis in lung cancer. Turkish Thorac J 21(4):255
Solakhan M, Çiçek H, Orhan N, Yildirim M (2019) Role of native Thiol, total Thiol and dynamic Disulfide in diagnosis of patient with prostate cancer and prostatitis. Int braz j urol 45(3):495–502
Gào X et al (2020) Serum total thiol levels and the risk of lung, colorectal, breast and prostate cancer: A prospective case–cohort study. Int J Cancer 146(5):1261–1267
Kasmi S, Moser L, Gonvers S, Dormond O, Demartines N, Labgaa I Carcinogenic effect of arsenic in digestive cancers: a systematic review, Environmental Health, vol. 22, no. 1, p. 36, 2023/04/17 2023, 10.1186/s12940-023-00988-7
Ò, Martorell et al (2014) Conserved mechanisms of tumorigenesis in the Drosophila adult midgut. PLoS ONE 9(2):e88413
Mirzoyan Z, Sollazzo M, Allocca M, Valenza AM, Grifoni D, Bellosta P (2019) Drosophila melanogaster: A Model Organism to Study Cancer, (in eng). Front Genet 10:51. 10.3389/fgene.2019.00051
Perker MC, Orta Yilmaz B, Yildizbayrak N, Aydin Y, Erkan M (2019) Protective effects of curcumin on biochemical and molecular changes in sodium arsenite-induced oxidative damage in embryonic fibroblasts. J Biochem Mol Toxicol 33(7):e22320
Sun H-J, Ding S, Guan D-X, Ma LQ Nrf2/Keap1 pathway in countering arsenic-induced oxidative stress in mice after chronic exposure at environmentally relevant concentrations, Chemosphere, vol. 303, p. 135256, 2022/09/01/2022, https://doi.org/10.1016/j.chemosphere.2022.135256
Xu J, Su X, Burley SK, Zheng XS (2022) Nuclear SOD1 in growth control, oxidative stress response, amyotrophic lateral sclerosis, and cancer, Antioxidants, vol. 11, no. 2, p. 427
Skrzycki M (2021) Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers. Open Life Sci 16(1):1225–1239
Pitoniak A, Bohmann D (2015) Mechanisms and functions of Nrf2 signalling in Drosophila. Free Radic Biol Med 88:302–313
Bi Z et al Cooperation between NRF2-mediated transcription and MDIG-dependent epigenetic modifications in arsenic-induced carcinogenesis and cancer stem cells. Sem Cancer Biol, 76, pp. 310–318, 2021/11/01/2021, doi: https://doi.org/10.1016/j.semcancer.2021.03.030
Trist BG, Hilton JB, Hare DJ, Crouch PJ, Double KL (2021) Superoxide dismutase 1 in health and disease: how a frontline antioxidant becomes neurotoxic. Angew Chem Int Ed 60(17):9215–9246
Singh R, Sadiq NM (2019) Cholinesterase inhibitors

The authors declare no competing interests.

Download PDF

Version 1

posted

You are reading this latest preprint version

Sodium arsenite altered the parameters of oxidative stress and induced carcinogenesis and neurotoxicity in Canton-S Drosophila melanogaster

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Experimental Flies

Preparation of fly samples for biochemical assays

Histology and morphology

Effect of Sodium Arsenite on the Survival Rate

Biochemical analysis of oxidative stress markers

Effect of Sodium Arsenite on Gene Expression

Statistical analysis

RESULTS

Histology and morphology

Fly morphological changes

Biochemical analysis of markers of oxidative stress

Hydrogen Peroxide Levels

Total thiol concentration

Reduced Glutathione Concentrations

Nitric oxide concentration

Protein carbonyl concentration

Glutathione-S-Transferase Activity

Acetylcholinesterase activity

DISCUSSION

CONCLUSION

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1