2.1. Animals and Treatments
Forty-eight male Sprague Dawley rats (6 weeks old, 190-210g) were provided by the Central Hospital of Harbin Medical University (Harbin, China). Rats were maintained under standard conditions and access to water and standard rodent pellet food ad libitum [24]. All animal procedures in the present study were conducted according to the Animal Ethics Committee of the Northeast Agricultural University (SRM-11, China).
After a week of acclimatization, rats were divided at random into four groups (n = 12): CON, LPS, LPS + DEX and DEX. LPS group was given LPS (Escherichia coli 0111: B4; Sigma-Aldrich, San Francisco, USA) dissolved in 0.9% physiological saline at 10 mg/kg by intraperitoneally (i.p.) injected. LPS + DEX group rats were i.p. with DEX (30 µg/kg, Wuhan Belka Biomedical Co., Ltd, Wuhan, China) 0.5 h before LPS administration. DEX group was treated with DEX (30 µg/kg, i.p.). In the CON group, rats were administered with an equal volume of physiological saline by i.p. injected. The doses of DEX and LPS refer to previous reports [9, 25, 26].
2.2. Sample Collection
Four hours after the final treatment, all rats were anesthetized with isoflurane (Yipin Pharmaceutical Co., Ltd, Hebei, China) and sacrificed. Blood was quickly collected by cardiac puncture, and centrifuged at 3000 rpm for 10 min at 4°C to take the supernatant for inspection of inflammatory indicators. The whole brains of three rats in each group were immediately fixed in 10% formalin solution for histopathological observation and immunohistochemical detection. Three hippocampal tissues per group were used for ultrastructural observation. The remaining four hippocampal tissues in each group were rapidly frozen in liquid nitrogen and then stored at − 80°C for Real-time PCR and Western blot analysis.
2.3. Histopathology and Ultrastructural Observation
Brain tissue samples fixed with 10% formalin for 24 h were dehydrated and then embedded in paraffin. Next, they were cut into 4–5 µm sections and stained with hematoxylin and eosin (H&E, Wuhan Biotechnology Ltd. Co., Wuhan, China). After 5–10 min, all sections were observed and photographed under an optical microscope (TE2000, Nikon, Japan). The number of neurons in hippocampal CA1 and CA3 region was counted by ImageJ software (400x magnification).
After fixation with 3% glutaraldehyde for 48 h, the hippocampus blocks (1 mm3) were exposed to 1% osmium tetroxide for 2 h. Next, the blocks were dehydrated, embedded, sectioned (60 nm), and then stained with lead citrate. All samples were captured by transmission electron microscope (Tecnai-G212, FEI Company, Netherlands). Based on the morphology and integrity of the mitochondrial membrane and cristae, the mitochondria in six discontinuous fields of each sample were scored. The criteria for judging mitochondrial damage are as follows: 0, well-defined and organized membranes and cristae; 1, minor distortions and/or swellings, but general organization retained; 2, major distortions and/or swellings and discontinuous membranes and cristae; 3, membranes and cristae dissociated into particulates to produce diffuse mitochondrial ghosts; 4, only a few mitochondrial remnants in cells.
2.4. Immunohistochemistry Analysis
Immunohistochemical analysis was performed as described previously [27]. Briefly, paraffin-embedded brain tissue slices were dewaxed with xylene, dehydrated with gradient alcohol, incubated with hydrogen peroxide, and sealed with goat serum. After that, they were incubated with primary and secondary antibodies and labeled with horseradish enzyme. DAB was used for color development. Finally, all slices were observed and photographed under a DP73 type microscope (OLYMPUS, Japan).
2.5. Cell Culture and Drug Treatments
PC12 cells were obtained from the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM medium (Gibco, Waltham, MA, USA) containing 10% FBS and 1% penicillin-streptomycin in a humidified incubator (37°C, 95% relative humidity, 5% CO2). The experimental groups were as follows: CON, LPS, LPS + DEX and LPS + SB. CON group: the cells were cultured in untreated medium. LPS group: the cells were cultured in medium supplemented with LPS. LPS + DEX group: the cells were treated with DEX for 30 min and then cultured in medium supplemented with LPS. LPS + SB group: after 30 min of p38 MAPK inhibitor SB203582 (10µM, Selleck.cn, Shanghai, China) administration, the cells were cultured in medium with LPS. The concentration of LPS and DEX was determined by CCK-8 assay.
2.6. Cell Viability Assay and Observation of Cell Morphology
Cells were seeded into 96-well plates (4 × 103 cells per well) for 12 h, and then treated with/without DEX in the presence/absence of LPS. After 24 h, the cell viability was determined with the CCK-8 kit (Beyotime Institute of Biotechnology, Suzhou, China) according to the manufacturer's instructions. The absorbance was read at 450 nm by a Bio-Tek Epoch microplate reader (Bio-Tek, Winooski, VT, USA). Cell morphology of each group was observed and captured by inverted microscope (Leica, Germany).
2.7. LDH and ATP Release Assay
Released LDH, ATP content and total ATPase activity were determined by LDH assay kit, ATP content assay kit and ultra-micro total ATPase kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), respectively.
2.8. Dual Immunofluorescence and Annexin V-FITC/PI Staining Assay
Cells in each group were fixed with 4% paraformaldehyde for 30 min and then permeated with 0.3% Triton X-100 for 10 min. Next, they were incubated overnight with Bax (Wanlei, Shenyang, China) at 4°C. The cells slides were incubated with CY3-labelled anti-rabbit IgG (Goodbio Technology, Wuhan, China) in the dark for 1.5 h at 37°C, followed by washing 3 times with PBS. Afterwards, the cells were incubated overnight with Tom20 (ABclonal, Wuhan, China) at 4°C. Finally, they were incubated with 488-anti-rabbit IgG (Goodbio Technology, Wuhan, China) in the dark for 1.5 h at 37°C. Images were captured using a fluorescent inverted microscope (Nikon, Japan).
The resuspended cells were incubated with 5 µL Annexin V-FITC and 10 µL propidium iodide (Bioss, Beijing, China) for 15 min. Then, cell apoptosis was detected by the Attune NxT flow cytometer (Thermo Fisher Scientific).
2.9. Real-time PCR analysis
Total RNA was isolated from hippocampus tissue and PC12 cells by using Total RNA Extraction Kit (Promega Biotech Co, Ltd, Beijing, China). According to the corresponding procedures, superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) was used for reverse transcription to obtain cDNA. Primer sequences of c-Myc, CLIC4 and GAPDH are shown in Table 1. RT-PCR analysis was performed using LightCycler480 (Roche, Basel, Switzerland). The relative quantification of the target gene expression was calculated according to 2−ΔΔCt method.
Table 1
Primer sequence for real-time PCR detection.
Gene | Accession number | Primer sequence (5’-3’) |
GAPDH | XM_216453 | Forward: AGTGCCAGCCTCGTCTCATA |
Reverse: GATGGTGATGGGTTTCCCGT |
c-Myc | NM_012603 | Forward: GGAGAAACGAGCTGAAGCGTAG |
Reverse: CAGCCAAGGTTGTGAGGTTAGG |
CLIC4 | NM_031818 | Forward: GTCACCACCGTTGACCTGAA |
Reverse: TTGGGTGGGCACAAGACTTC |
2.10. Western blot analysis
Hippocampal tissue and PC12 cells were lysed in RIPA buffer with PMSF and phosphatase inhibitor (Beyotime Biotechnology, Shanghai, China). After the protein concentration was determined using the BCA assay kit, the equivalent amount of protein samples was separated by SDS-PAGE gel electrophoresis, and transferred to the PVDF membrane. Then, membranes were blocked in 5% skim milk for 2 h at room temperature. Subsequently, membranes were incubated with primary antibodies adding Primary Antibody Dilution Buffer (Leagene Biotechnology, Beijing, China) overnight at 4℃. The primary antibodies include Bax, cleaved caspase-3, cleaved caspase-9 (1:1000, Cell Signaling Technology, USA); Bcl-2, cytochrome C, P-JNK, JNK, P-ERK, ERK, P-p38, p38 (1:750, Wanlei, Shenyang, China); c-Myc, CLIC4 (1:1000, Santa Cruz Biotechnology Inc, USA). Next, they were incubated with appropriate combination of secondary antibody for 2 h at 37°C. The immunoreactive protein bands were visualized using the enhanced chemiluminescence kit (Beyotime Biotechnology, Shanghai, China), and were captured by Amersham Imager 600 software (GE, USA). Finally, all protein bands were quantified with ImageJ software.
2.11. Statistical analysis
All data were represented as mean ± SD and analyzed using IBM SPASS Statistics 23 software (SPASS, IL, USA). Statistical analysis was conducted via one-way ANOVA, followed by Tukey’s post hoc test. Values with P < 0.05 was considered statistically significant, P < 0.01 were considered extremely significant.