Quorum sensing-mediated inter-specific conidial anastomosis tube fusion between Colletotrichum gloeosporioides and Colletotrichum siamense.

doi:10.21203/rs.3.rs-54692/v1

Download PDF

Research

Quorum sensing-mediated inter-specific conidial anastomosis tube fusion between Colletotrichum gloeosporioides and Colletotrichum siamense.

https://doi.org/10.21203/rs.3.rs-54692/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Apr, 2021

Read the published version in IMA Fungus →

You are reading this latest preprint version

Many plant pathogenic filamentous fungi undergo fusion of conidia through conidial anastomosis tubes (CATs), which is believed to facilitate horizontal gene transfer between species. We discovered a remarkable inter-specific conidial anastomosis tube (CAT) fusion between two important plant fungal pathogens Colletotrichum gloeosporioides and Colletotrichum siamense. In an In vitro assay, under no selection pressure, the inter-specific CAT fusion was preferred with higher frequency (25%) than intra-specific CAT fusion (11%). Different stages of CAT fusion viz. CAT induction, homing, and fusion were observed during this inter-specific CAT fusion. The CAT fusion was found to be higher in absence of nutrients and in the presence of physiological stresses. This CAT fusion involved a quorum sensing phenomenon, wherein the CAT induction was dependent on conidial density and the secreted putative quorum sensing molecules were found to be lipid based in nature. Movement of nuclei, mitochondria, lysosomes and lipid droplets were observed during the CAT fusion. Post CAT fusion, the resulting conidia gave rise to putative recombinants with variable colony characteristics as compared to their parental strains. Few recombinants showed variable AFLP banding pattern compared to their parental strains, thereby suggesting a possible genetic exchange between the two species through CAT fusion. The recombinants exhibited variable fitness under different stress conditions. Our study signifies possible role of inter-specific CAT fusion in generation of genetic and phenotypic diversity in these fungal pathogens.

Plant Molecular Biology and Genetics

Conidial anastomosis tube

Horizontal gene transfer

Quorum sensing

Genetic diversity

Hybrid vigour

Colletotrichum

The Colletotrichum is a widespread genus voted as the eighth most important group of plant pathogenic fungi in the world (Dean et al., 2012). Among different species, C. gloeosporioides and C. siamense cause anthracnose in a wide range of host plants such as fruit, vegetable and ornamental plants (Cai et al., 2009; Freeman et al., 1996; Hyde et al., 2009; Jayawardena, 2018; Sharma et al., 2013). We have shown that there is a high level of genetic diversity in C. gloeosporioides isolates in India (Mehta et al., 2017). Our observation also corroborates with a series of studies published on genetic and pathogenic diversity of C. gloeosporioides (Denoyes-Rothan et al., 2003; Nova et al., 2011; Weeds et al., 2003). The possible mechanism of generation of such high genetic diversity may lie in meiotic recombination during sexual reproduction, however, it has been suggested that the sexual reproduction in C. gloeosporioides in nature would be very rare, if not absent (Weir et al., 2012). Similarly, no sexual stage for C. siamense has been demonstrated till date (Prihastuti et al., 2009).

Horizontal gene transfer (HGT) or horizontal chromosome transfer (HCT) may contribute to the high level of genetic variation found in fungi that lack sexual reproduction (Ishikawa et al., 2012; Mehrabi et al., 2011). The HCT and HGT have been considered to play an important role in fungal plant pathogens evolution (Rosewich and Kistler 2000; Walton 2000; Oliver and Solomon 2008; Rep and Kistler 2010; Mehrabi et al. 2011). The horizontal chromosome transfer (HCT) has been demonstrated in C. gloeosporioides, Alternaria alternata and Fusarium oxysporum (Akagi et al., 2009; He et al., 1998; Ma et al., 2010). Horizontal chromosome transfer (HCT) has also been demonstrated between two vegetatively incompatible biotypes of C. gloeosporioides co-cultured under laboratory conditions and this is also thought to occur in nature (He et al., 1998; Manners and He, 2011); however, it is not very clear how exactly the HGT/HCT occurs in C. gloeosporioides and C. siamense. Typically, a conidium germinates to form a germ tube that extends and successively branches to establish the fungal colony. However, in certain conditions, the conidia and conidial germlings in close vicinity to each other may form a specialized hypha, called conidial anastomosis tubes (CATs) that connect conidia, resulting in an interconnected germling network (Read et al., 2010; Roca et al., 2005a, 2005b, 2003). Such network can act as a coordinated individual regulating its overall homeostasis by sharing nutrients, water, signal molecules and organelles, while allowing genetic exchange among conidia (Read et al., 2009). Since CAT fusion involves transfer of genetic material, it is thought that CAT fusion may account for HGT and/or HCT between otherwise incompatible strains (Ma et al., 2010; Mehrabi et al., 2011).

The CAT fusion has been demonstrated in many species of fungi (Roca et al. 2005b). However, the CAT fusion has been extensively studied in C. lindemuthianum, C. gossypii, C. fructicola, C. nymphaeae, F. oxysporum, N. crassa and Venturia inaequalis and for many of these fungi; in-vitro methods have been developed to study the biology of CAT fusion (Gonçalves et al., 2016; Kurian et al., 2018; Leu L.S., 1967; Roca et al., 2005a, 2003; Shahi et al., 2016; Wu et al., 2014). The CAT fusion has never been reported in C. siamense. Similarly, formation of multiple appressoria and CATs in C. gloeosporioides was reported on apple leaves (Araujo and Stadnik, 2013), however, there were no efforts undertaken to study the CAT fusion dynamics in-vitro and to understand the physiological requirements for CAT fusion in C. gloeosporioides and C. siamense. It is also not known, whether CAT fusion may contribute to generation of phenotypic and genetic diversity in these fungal pathogens.

The CAT fusion seems to involve a quorum sensing, wherein, the individual conidia senses their density by detecting the extracellular quorum sensing molecules secreted by their conidial population. There are indirect evidences that a diffusible chemo attractant is released during the CAT induction, which probably prime the conidia for CAT fusion (Roca et al., 2005a). The CAT inducer signal in N. crassa seems to activate a mitogen-activated protein (MAP) kinase, which is shown to be essential for CAT induction (Roca et al., 2005a). However, the chemical nature of quorum sensing molecule/inducer responsible for CAT fusion is not known till date in any fungi. It has been suggested that CAT fusion might play a vital role in life cycle of fungi by improving the chances of colony establishment during nutrient starvation (Roca et al., 2005b); however, there are contrasting reports on the relationship between CAT induction and nutrient availability e.g. CAT fusion in C. lindemuthianum is inhibited by nutrients and only occurs in water (Roca et al., 2003), while in N. crassa and F. oxysporum, CAT induction requires the presence of nutrients to occur (Kurian et al., 2018; Roca et al., 2005a). Moreover, whether any physiological stresses have any role to play in CAT fusion has also not been studied well till date.

Various inter-specific hybrids of filamentous plant pathogens have been described (Depotter et al., 2016) so far and the CAT fusion has been implicated for generation of fungal hybrids. In one such study, an interspecific hybrid of C. lindemuthianum and C. gossypii was reported to occur through CAT and the hybrids exhibited morphological and genetic properties of both the parent species (Roca et al., 2004). Though the existence of hybrids was predicted in C. gloeosporioides species complex (Cisar et al., 1994), however, till date no study has demonstrated any inter-specific hybrids of C. gloeosporioides with any other species. Inter-specific hybridization or gene transfer between closely related species is a fast mean of genome evolution, which allows organisms to acquire novel traits to colonize new niches and/or novel hosts (Man et al. 2007; Bertier et al. 2013). Further, it is speculated that hybrid pathogens might have fitness advantages or disadvantages in a given niche.

In the present work, we aimed to study the physiological requirement and dynamics of CAT fusion between C. gloeosporioides and C. siamense. We also attempted to demonstrate that the CAT fusion is mediated through a quorum sensing like phenomenon in these fungi. Further we generated preliminary experimental proofs to support the role of CAT fusion in generating phenotypic and genotypic diversity in these fungi. The hybrid vigour of putative recombinants of C. gloeosporioides under stress conditions was also assessed.

Fungal strains and species confirmation by ApMAT sequencing and phylogeny

Colletotrichum gloeosporioides (CBS 953.97) and Colletotrichum siamense (NFCCI 3061) strains used in the study were obtained from Microbial Type Culture Collection (MTCC), Chandigarh, India and National Fungal Culture Collection of India (NFCCI) (WDCM-932), Agharkar Research Institute, Pune, India respectively. The strains were maintained on PDA plates at 25˚C and preserved in 15% glycerol at -80˚C. The species identities of the isolates were initially confirmed by microscopic morphology and further the molecular identification of the above strains was done by ApMAT gene sequencing. Briefly, the genomic DNA (gDNA) was isolated from fungal colonies grown on Potato Dextrose Agar (Hi-Media Laboratories Pvt. Ltd.) plates for a week, by following a rapid DNA extraction protocol(Aamir et al., 2015) using FastPrep®24 tissue homogenizer (MP Biomedicals GmbH, Germany). The gDNA were subjected to polymerase chain reaction (PCR) amplification of the ApMAT gene using primers AMF - TCATTCTACGTATGTGCCCG and AMR - CCAGAAATACACCGAACTTGC using standard cycling conditions as described previously (Silva et al., 2012). The PCR products were purified using QIAquick PCR Purification Kit (QIAGEN), and sequenced using Big Dye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) as per the manufacturer’s instructions on an ABI 3100 Avant Prism automated DNA sequencer (Applied Biosystems). The sequences generated in this study were deposited in NCBI-GenBank. The ApMAT region sequences of closely related species of C. gloeosporioides and C. siamense were retrieved from NCBI-GenBank and a phylogenetic tree was constructed using these sequences by following neighbor-joining method in MEGA7 to confirm the phylogenetic positions of C. gloeosporioides and C. siamense strains used in the present study.

In-vitro conidial anastomosis tube (CAT) induction and their dynamics

The C. gloeosporioides and C. siamense strains were inoculated on bean pod agar medium (autoclaved French bean pods submerged in 2% water agar) and were incubated in the dark at 25°C to induce sporulation. Post-inoculation the conidia were harvested from these two species individually at different time points viz. 6, 10, 13, 17 and 20 days and suspended in distilled water. In order to induce CAT fusion, 0.2 ml conidial suspension (1×10⁶ per ml) and 0.8ml distilled water were placed in the wells of a 24-well tissue culture plate (Tarsons, India) with the final concentration of conidia being 4×10⁵/ml and incubated for 24 h, 48 h, 72 h and 96 h in the dark at 25°C. The CAT induction was carried out in three different ways; 1) CAT induction in only C. gloeosporioides conidia, 2) CAT induction in only C. siamense conidia, and 3) CAT induction in a co-culture of C. gloeosporioides and C. siamense conidia in equal numbers (Additional file 3: Figure S1). Different stages of CAT like induction, homing and fusion were examined at different time points using an Olympus BX53 DIC microscope equipped with Olympus DP73 camera and CellSens 1.13 imaging software. The CAT fusion was quantified as the percentage of conidia involved in fusion (Roca et al., 2003).

Effects of nutrients, physiological stresses and known CAT inducers on CAT induction

In order to study whether CAT fusion between C. gloeosporioides and C. siamense is dependent on nutrient availability and/or physiological stress conditions, the CAT fusion frequency was determined in the presence of different stresses and nutrients. The CAT fusion in 17 days old conidia of both the strains (co-culture) were induced in water, 100% Potato dextrose broth (PDB), 30mM H₂O₂ (oxidative stress), 1M NaCl and 1M Sorbitol (osmotic stress), at 40˚C (heat stress) and 100µg/ml Copperoxychloride (antifungal stress). Further, the CAT fusion in 17 days old conidia of both the strains (co-culture) were also tested in the presence of various carbon and nitrogen compounds like 2% Glucose, 100mM KNO₃, combination of 2% glucose and 100mM KNO₃(Shahi et al. 2016). The CAT induction was also assessed in the presence of previously known CAT inducers of other fungal systems e.g. 25mM NaNO₃, and 25mM MgCl₂(Kurian et al. 2018). Effect of a known CAT inhibitor tryptophan (50 µM) (Fischer-Harman et al., 2012) on CAT induction in these fungi was also assessed. To study whether the CAT induction in these two species is mediated through MAP kinase kinase (MEK) pathways, the CAT fusion percentage was also determined in the presence of a MEK inhibitor InSolution™ PD98059 (5µM).

Detection of quorum sensing like phenomena during CAT fusion

Different numbers of conidia were tested to find out the threshold of conidial numbers required for inter-specific CAT fusion between C. gloeosporioides and C. siamense. The numbers of conidia tested were 4×10², 4×10³, 4×10⁴, 4×10⁵ and 4×10⁶ per ml of water. The conidial numbers represent sum of equal concentration of C. gloeosporioides and C. siamense conidia.

The basic chemical nature of unknown quorum sensing molecules secreted during CAT fusion was determined. Briefly, post inter-specific CAT fusion (96 hours of incubation) of the 17 days old conidia of both the species, the conidial suspension was collected from the tissue culture plate and conidia were separated from the liquid medium (water) by centrifugation at 10,000 rpm for 10 min at RT. The obtained CAT medium supernatant was filtered through Whatman® Syringe filter (pore size 0.45µm). This CAT medium supernatant (1 ml) was tested for their ability to induce CAT fusion in young (6 days) as well as old conidia (17 days) of C. gloeosporioides and C. siamense in co-culture (4×10⁵ conidial concentration), wherein, the conidial co-culture in water (1 ml) was used as a control. These conidial co-cultures were incubated at 25°C for 72 h in the dark. The CAT induction ability of the CAT medium supernatant was tested even in the presence of nutrients viz. 100% PDB by inoculating 6 and 17 days old conidia of both the strains in (a) 1ml CAT medium supernatant, (b) 1ml 100% PDB individually and (c) combination of equal volume of CAT medium supernatant and 100% PDB (total volume 1ml).

To find out whether the putative quorum sensing molecule is lipid based or proteinaceous in nature, three different sets of experiments were performed viz 1) The CAT medium supernatant (1 ml) was treated with equal volume of chloroform, followed by centrifugation at 12000 rpm for 10 minutes at RT to obtain the aqueous CAT medium supernatant back. 2) The leftover chloroform (1ml) from the first set of experiment was treated with water (1ml) to re-extract the quorum sensing molecules, provided these molecules were lipid based in nature. 3) The CAT medium supernatant (1ml) was also treated with 4µl of proteinase K (10mg/ml) for 3 hours at 55^oC. Such treated CAT medium supernatants were tested for their ability to induce CAT fusion in co-culture of 17 days old conidia of both the species.

Nuclear and organelles transfer during CAT fusion

To visualize the genetic transfer between C. gloeosporioides and C. siamense during CAT fusion, the DAPI staining was performed with some modifications (James et al., 1995; Roca et al., 2003). Briefly, 17 days old conidia of C. gloeosporioides and C. siamense were co-cultured in water for 72 h in 24 well tissue culture plates to induce CAT fusion as described above. To these wells, 20μl of sodium phosphate buffer (50μM), pH 7.0 and 10μl of DAPI solution (500μg/ml) was added. After about half an hour of incubation the DAPI solution was gently removed and the fused conidia were gently removed from the well and placed over the glass slide for fluorescence microscopy (ZIESS AXIO Imager.A2 microscope with AxioCam MRc5 camera). Few additional organelles staining experiments were performed using 100nM MitoRed (Sigma-Aldrich, USA), 100nM LysoTracker™ Red DND-99 (Thermo Fisher Scientific), and 100nM Nile Red (Sigma-Aldrich, USA)(Hickey et al., 2004; Meadows BRA, 2012; Yin et al., 2010) to visualize the transfer of mitochondria, lysosomes and lipid droplets, respectively during the CAT fusion. Confocal microscopy was performed to visualize the migration of above-mentioned organelles using Leica SP8 confocal microscope and images were processed and analyzed by LAS X software. The excitation and emission spectra used for MitoRed, LysoTracker™ Red DND-99 and Nile Red staining were 569/594, 577/590 and 520/620, respectively.

Assessment of colony morphology of progenies generated through intra and inter-specific CAT fusion

The colony morphologies of putative recombinant conidia generated post intra-specific (self-fusion) and inter-specific CAT fusions were studied by harvesting them by following a single spore isolation method (Ho and Ko, 1997). Briefly, intra-specific and inter-specific CAT fusions in and between C. gloeosporioides and C. siamense were carried out as described in above mentioned method. The conidia were harvested from the 24 well tissue culture plate post CAT fusion (after 96 hours of incubation) by centrifugation and the concentration was adjusted to approximately 1 conidia/µl by diluting the conidia with sterile water. About 50 circles (3mm diam.) were drawn on the bottom of water agar plates. A 1µl drop of conidial suspension was placed on the water agar surface above each circle. After incubation at 25°C for 12-24 h, each circle was inspected microscopically at 100X magnification from the bottom of the plate. The circle containing single germinating conidium was marked and conidia in those circles were individually transferred to PDA plates. The resulting pure colonies originating from single spore isolation were termed as putative recombinants. The colony morphologies of these putative recombinants were analyzed. In cases of inter-specific CAT fusion, the genetic backgrounds of the putative recombinants were checked by ApMAT gene sequencing so as to find out whether a given putative recombinant belongs to C. gloeosporioides or C. siamense. The ApMAT gene sequences of the putative recombinants generated in this study were deposited in NCBI-GenBank. In order to rule out the possibility of any other mechanisms (e.g. spontaneous phenotypic heterogeneity or stress induced genomic alterations) for generation of phenotypic diversity, the single conidium of each species were harvested from the 17 days old cultures of these two fungi, grown separately and without subjecting them to CAT fusion. These vegetatively grown conidia were allowed to develop as a colony and their morphological characteristics were recorded.

Amplified fragment length polymorphism (AFLP) analysis of C. gloeosporioides and C. siamense parental strains and their putative recombinants

In order to determine genetic diversity in putative recombinants of C. gloeosporioides and C. siamense, an AFLP assay was performed for both the parental strains [C. gloeosporioides parent (CGP) and C. siamense parent (CSP)] and their 20 recombinants [C. gloeosporioides recombinants (CG1-10) and C. siamense recombinants (CS1-10)] generated post-CAT fusion. Approximately 50ng of genomic DNA of each of the strain was subjected to a combined restriction-ligation procedure with a mixture containing 50 pmol of the HpyCH4IV adapter, 50 pmol of the MseI adapter, 2U of HpyCH4IV (New England Biolabs, Ipswich, MA), 2U of MseI (NEB), and 1U of T4 DNA ligase (NEB) and 0.2µl of 100x Bovine Serum Albumin (BSA) in a total volume of 20 µl of 1X reaction for 2 h at 37°C then 1 h at 16°C in Applied Biosystems ProFlex PCR System. Adapters were made by mixing equimolar amounts of complementary oligonucleotides (5’-CTCGTAGACTGCGTACC-3’ and 5’-CGGGTACGCAGTC-3’ for HpyCH4 IV; 5’-GACGATGAGTCCTGAC-3’ and 5’-TAGTCAGGACTCAT-3’ for MseI) and heating them to 95°C for 2 min, with subsequent slow cooling to ambient temperature in Applied Biosystems ProFlex PCR System. One microliter of the 10 times diluted restriction-ligation mixture was used for pre-selective amplification in a volume of 25 µl under the following conditions: 1µM HpyCH4IV forward primer (5’-GTAGACTGCGTACCCGTA-3’), 1µM MseI reverse prime (5’-GATGAGTCCTGACTAATGAG-3’), 0.2mM each deoxynucleoside triphosphate (dNTP), and 1U of Taq DNA polymerase (Sigma Aldrich, USA) in 10X reaction buffer containing MgCl2. Amplification was performed as follows: an initial denaturation step for 5 min at 94°C, 20 cycles of 30s of denaturation at 94°C and 30s of annealing at 56°C and 2 min of extension at 72°C. These pre selective PCR products (1µl) were used as template for selective amplification in a volume of 25 µl under the following conditions: 1µM HpyCH4IV forward primer, 1µM selective MseI reverse primer with underlined selective base pairs (5’-GATGAGTCCTGACTAATGAG-AC-3’), 0.2mM each deoxynucleoside triphosphate (dNTP), and 1U of Taq DNA polymerase (Sigma Aldrich, USA) in 10X reaction buffer containing MgCl₂. Selective amplification was performed as follows: an initial denaturation step for 5 min at 94°C, 20 cycles of 30s of denaturation at 94°C and 30s of annealing at 66°C and 2 min of extension at 72°C. Cycling was then continued for a further 30 cycles, with an annealing temperature of 56°C and a final extension at 72°C for 10 min and hold at 4°C (Chakrabarti et al., 2010). The selective PCR products were run on native polyacrylamide gel electrophoresis (PAGE) to determine the banding pattern of parents and their recombinants. For PAGE, 100ml (5%) gel solution was prepared by adding 12.5ml of 40% acrylamide and bis-acrylamide solution (19:1), 10ml 10x Tris-Borate EDTA, 50mg Ammonium persulfate (APS) and 40µl Tetramethylethylenediamine (TEMED). Eight µl of selective amplified product and 100bp DNA marker were loaded in the native PAGE gel and it was run on C-DASG-400-50 Dual Adjustable Mega-Gel Electrophoresis System (CBS Scientific) at 200 Volts for 3-4 hours. After the electrophoresis, the gel was stained with Silver Nitrate stain (Elouafi and Nachit, 2004). The stained gel was observed under white light and photographed with Canon EOS 600D.

Assessment of hybrid vigour of putative recombinants under stress conditions

The fitness of parent strains and putative recombinants of C. gloeosporioides was tested under different stresses viz. oxidative stress (H₂O₂), osmotic stresses (NaCl and Sorbitol) by employing surface plate assay (Zafra et al., 2015). Briefly, the C. gloeosporioides putative recombinants and parent strain (1x10⁴ conidia) were individually inoculated on the centre of PDA plates containing 30mM H₂O₂, 1M NaCl and 1M Sorbitol separately. Plates were incubated at 25°C for 7 days and mycelium radial extension rate measurements (cm d^-1) were made every 24 h manually with help of ruler. Fungal growth assays were structured by using an 11x3 factorial design (11 strains and 3 different stress mediums).

Statistical analysis

All data were analyzed by Analysis of Variance (ANOVA) with GraphPad Prism 5 Statistics Software. Differences with a p value< 0.05 were considered statistically significant. All assays were performed in triplicates and with 300 conidial numbers, wherever applicable.

High frequency of inter-specific versus intra-specific CAT fusion in C. gloeosporioides and C. siamense

Colletotrichum gloeosporioides CBS 953.97 could be differentiated from C. siamense NFCCI 3061 by having cylindrical conidia while the later had fusiform shaped conidia (Fig. 2D-E) (Prihastuti et al., 2009). The BLASTn analysis of ApMAT DNA sequence of these fungal strains showed 100% sequence similarity with C. gloeosporioides and C. siamense (Additional file 1: Table S1). Further, the ApMAT based phylogenetic analysis revealed that these two species of Colletotrichum clustered in their respective clades in phylogenetic tree, thereby confirming their identity and phylogenetic positions (Fig. 1).

When different aged conidia of C. gloeosporioides and C. siamense were analyzed individually for CAT fusion, it was observed that the CAT fusion occurred in very low frequency in 6 d old conidia and thereafter percentage of CAT fusion increased with the increasing age of conidia. The CAT fusion frequency reaches to its peak when the conidial age was 17 days, thereafter it starts decreasing (Fig. 2A). It was observed that when different aged conidia were harvested and incubated in distilled water for 24, 48, 72 and 96 h, the maximum CAT fusion frequency was observed at 72 h post-incubation (Fig. 2B). The CAT fusion percentage observed in C. gloeosporioides and C. siamense individually (intra-specific) were 11% and 12%, respectively (Fig. 2C). However, when 17 days old conidia of these two different species were co-cultured in distilled water for CAT induction (for 72 h), interestingly the inter-specific CAT fusion percentage observed was as high as 25%, which was significantly higher than intra-specific CAT fusion percentage (Fig. 2C). The representative microscopic images of intra-specific and inter-specific CAT fusion in/between C. gloeosporioides and C. siamense have been depicted in figure 2 D-F. Since, the highest CAT fusion percentage was observed in co-culture of 17 days old conidia of C. gloeosporioides and C. siamense and 72 h incubation time in water for CAT induction in-vitro, most of the further experiments were conducted using these optimized parameters and co-culture of these two different species.

Different stages of the inter-specific CAT fusion between C. gloeosporioides and C. siamense were studied (Fig. 3). Initially conidia get attracted and come closer to each other due to the effect of extracellular secretary molecules constituting the first stage of CAT fusion known as CAT induction (Fig. 3A). Subsequently, conidia with CATs home towards each other (Fig. 3B) and finally they fused to each other (Fig. 3C). Later on, with increasing incubation time CAT connections expanded and formed CAT pre-network (Fig. 3D) and the final CAT network of inter-connected conidia (Fig. 3E-F) till 72 h of incubation. After 72 h CATs started to detach and by 96 h, conidia connected through CATs completely detached and got separated from each other (Fig. 3G).

CAT fusion is dependent on nutrient availability and osmotic stress

The conidia of C. gloeosporioides and C. siamense failed to undergo CAT fusion in the presence of nutrient rich medium like 100% PDB (Fig. 4). As shown previously, the high percentage of CAT fusion (22.3%) was observed in water only. However, when the conidia were incubated in water with glucose, KNO₃ and combination of glucose and KNO₃, the CAT fusion frequency decreased to 4%, 12% and 2%, respectively (Fig. 4). Among different stress conditions, osmotic (1M NaCl and 1M sorbitol) and oxidative stresses (30mM H₂O₂) could induce the CAT fusion in these fungi (Fig. 4). The maximum CAT fusion (25.7%) was detected under osmotic stress exerted by 1M sorbitol (Fig. 4). The inter-specific CAT fusion was also observed in the presence of other known CAT inducers like 25mM NaNO₃, and 25mM MgCl₂at the tune of 12%, and 12.8% respectively, however, the percentage CAT fusion was lower than water only (Fig. 4). Presence of tryptophan could reduce the CAT fusion to 5.9%. The conidia failed to induce CAT fusion in the presence of InSolution™ PD 98059, an inhibitor of MAP kinase kinase, thereby suggesting the involvement of MAPK pathway in inter-specific CAT fusion between C. gloeosporioides and C. siamense (Fig. 4).

Inter-specific CAT fusion is mediated through quorum sensing like phenomena

A density of 4x10⁴ and 4x10⁵ conidia per milliliter (ml) of water was found to be optimal for inter-specific CAT fusion (Fig. 5A), while the maximum CAT fusion % was seen in 4x10⁵ conidia per ml. When inter-specific CAT fusion in young (6 days) and old (17 days) conidia of both the species were assessed in water, the younger conidia showed low levels of CAT fusion (11%) as compared to the older conidia (23%). While in the presence of 100% PDB, conidia of both the age showed negligible CAT fusion, thereby suggesting that rich nutrients do not support CAT fusion. Interestingly, increase in CAT fusion percentage was seen in the presence of CAT medium supernatant (14% in 6 days and 27% in 17 days old conidia), suggesting that the quorum sensing molecules present in CAT medium supernatant could even induce CAT fusion in younger conidia. Significant increase in percentage CAT fusion was seen in both young (8%) and old conidia (14%) even in 100% PDB, when the CAT medium supernatant was supplemented with it (Fig. 5B). The proteinase-k treated CAT medium supernatant could induce inter-specific CAT fusion (18%), while chloroform treated CAT medium supernatant failed to induce CAT fusion in these fungi, suggesting that the putative quorum sensing molecule or CAT inducer was probably a lipid-based molecule (Fig. 5C). To reconfirm the lipid nature of CAT inducer, the leftover chloroform from chloroform treatment of CAT medium supernatant was re-extracted with water and interestingly such water re-extract could induce significantly high CAT fusion percentage (up to 40%), and thereby suggesting that the CAT inducer might be a lipid-based molecule (Fig. 5C). These results suggest that CAT fusion was dependent on conidial threshold and putative extracellular quorum sensing molecules, which are hallmark of quorum sensing like phenomenon.

Movement of nuclei and other cell organelles during CAT fusion

DAPI staining showed that the conidia of both the species, which are committed for CAT fusion were essentially bi-nucleated, however, the number of nuclei increased up to 3-4 in the beginning of nuclear transfer between the conidia. Out of such 3-4 nuclei, one nucleus/part of nucleus was transferred through CATs between conidia of these two species (Fig. 6). Mito Red staining revealed the movement of mitochondria through fused CATs between conidia of C. gloeosporioides and C. siamense (Fig. 7A-C). Mitochondria’s were abundantly present in both the conidia and CATs suggesting that the CAT fusion is an energy intensive process. The transfer of lysosomes and lipid droplets through CATs was also evident by LysoTracker™ Red DND-99 (Fig. 7D-F) and Nile Red staining (Fig. 7G-I), respectively.

Inter-specific CAT fusion generated phenotypic and genotypic diversity

The putative recombinants generated through inter-specific CAT fusion between C. gloeosporioides and C. siamense showed phenotypic variations in colony characteristics as compared to their parent strains (Fig. 8). We selected 10 such putative recombinants of C. gloeosporioides (CG1 to CG10) and C. siamense (CS1 to CS10) species background (generated through inter-specific CAT fusion) with some phenotypic variations in their colony morphology (Fig. 8). Among both the species background, a greater number of C. gloeosporioides putative recombinants showed significant phenotypic variations as compare to C. siamense putative recombinants (Additional file 2: Table S2). Microscopic analysis of the parent strains and the putative recombinants of C. gloeosporioides and C. siamense revealed that the recombinants were pure culture only. The ApMAT gene sequencing of these putative recombinants accurately identified their background species, ruling out the possibility of mixed conidia of these two species. The ApMAT gene sequences of recombinants generated in this study were deposited in GenBank with accession numbers listed in Additional file 1: Table S1.

Possibility of any other mechanisms for generation of phenotypic diversity e.g. intra-specific CAT fusion (or self-CAT fusion), spontaneous phenotypic heterogeneity or stress induced genomic alterations were ruled out, because progenies generated through intra-specific CAT fusion (or self-CAT fusion) in C. gloeosporioides and C. siamense individually did not show any apparent phenotypic variations in colony morphology (Additional file 4: Fig. S2A). Further, the single conidia (17 days old) of each species when grown vegetatively as colony (without CAT fusion), they did not show any phenotypic variations, thereby suggesting that the phenotypic variations obtained were due to a possible transfer of genetic material through inter-specific CAT fusion only (Additional file 4: Fig. S2B).

The AFLP banding pattern of some recombinants of C. gloeosporioides and C. siamense were different compared to their parent strains. We observed significantly more variations in AFLP banding pattern in C. gloeosporioides recombinants namely CG1, 3, 8 and 9 as compared to C. gloeosporioides parent strain (Fig. 9A). On the other hand, very fewer variations were observed in C. siamense recombinants banding pattern (only in CS1) as compared to C. siamense parent strain (Fig. 9B). The presence of extra band was indicated as an asterisk just beneath them in Figure 9. Interestingly, the extra bands observed in C. gloeosporioides recombinants CG1, 3, 8 and 9 was not present in C. gloeosporioides parent strain but present in C. siamense parent strain (Fig. 9A), which denotes that these extra bands in C. gloeosporioides recombinants might have got transferred from C. siamense through CAT fusion, thereby suggesting an inter-specific genetic transfer.

Putative recombinants showed varied fitness under stress conditions

Out of 10 C. gloeosporioides putative recombinant strains, 7 recombinants showed significant varied growth rate under oxidative stress, out of which three recombinant strains showed higher growth rate as compared to the parent strain. On the contrary, 4 out of 7 recombinant strains showed reduced growth rate under oxidative stress (Fig. 10A). With respect to osmotic stress (1M NaCl), only 1 out of 10 putative recombinant strains showed higher growth rate, and 7 showed reduced growth rate as compared to the parent strain (Fig. 10B). Further under sorbitol mediated osmotic stress, 3 out of 10 putative recombinant strains showed higher growth rate, and 4 showed reduced growth rate as compared to the parent strain (Fig. 10C).

The studied fungal species C. gloeosporioides and C. siamense have previously been shown to be different valid species, however, the ApMAT based phylogenetic analysis has shown that C. gloeosporioides was more closely related to C. siamense then C. asianum and C. fructicola. (Silva et al., 2012; Sharma et al., 2013). Our strains belonging to these two species were also rightly placed in the phylogenetic tree (Fig. 1). We have optimized the in-vitro conditions for CAT induction in C. gloeosporioides and C. siamense. We observed significant CAT induction in 17 days old conidia of both these species individually (Fig. 2A). Among different species of Colletotrichum, it was reported that 16 days old culture of C. lindemuthianum and C. gossypii undergo CAT fusion, while 20 days old culture of C. fructicola and C. nymphaeae formed CATs (Gonçalves et al., 2016; Roca et al., 2004, 2003). If CAT fusion in other fungal genera is considered, the conidial age requirements for Fusarium oxysporum and Neurospora crassa were 7–10 and 4–5 days, respectively (Kurian et al., 2018; Roca et al., 2005a; Shahi et al., 2016). Our result seems to fit with the conidial age requirement (older conidia) of the genus Colletotrichum for CAT induction. The CAT fusion percentage was about 11% for both C. gloeosporioides and C. siamense individually (Fig. 2C). However, the CAT fusion frequency was significantly high (25%) when these two species were subjected to CAT induction in the same well, suggesting that the inter-specific CAT fusion was preferred as compare to intra-specific CAT fusion in these two fungal species (Fig. 2C). Inter-specific CAT fusion has also been demonstrated between C. lindemuthianum (harboring hygromycin resistance) and C. gossypii, however, the frequency of these inter-specific fusions was very low even on strong hygromycin selection (Roca et al., 2004). Interestingly, in our experiments, there was no selection pressure for inter-specific CAT fusion between C. gloeosporioides and C. siamense, still the CAT fusion with the other species was preferred. It is hypothesized that inter-specific CAT fusion provides a unique opportunity to exchange the gene pool between two different species, which would possibly generate more genetic diversity as compared to intra-specific CAT fusion. It has been shown previously that the vegetative incompatibility response is suppressed during colony initiation in C. lindemuthianum during CAT fusion (Ishikawa et al., 2012). Thus, by removing the vegetative incompatibility barrier, CAT fusion may allow asexual fungi to increase their genetic diversity. The CATs have been divided into three phases; CAT induction, CAT homing and CAT fusion (Roca et al., 2005b). These phases were also observed in inter-specific CAT fusion between C. gloeosporioides and C. siamense (Fig. 3).

While studying the effect of availability of nutrients on CAT fusion frequency, we observed that the conidia (6 and 17 days old) of C. gloeosporioides and C. siamense failed to undergo CAT fusion in the presence of nutrient rich medium like 100% PDB (Fig. 4). As shown previously, the high percentage of CAT fusion was observed in water only (Ishikawa et al., 2010). The availability of glucose (carbon source), KNO₃ (nitrogen source), and combination of glucose and KNO₃, further lessen the CAT fusion frequency as compared to water only (Fig. 4). These observations suggest that the CAT fusion in C. gloeosporioides and C. siamense occur only in nutrient limited conditions. Our observation corroborates with the previous findings in several ascomycetes’ fungi, wherein, the CAT fusion was inhibited in the presence nutrients or rich organic growth medium (Roca et al. 2005a; Shahi et al. 2016; Kurian et al. 2018). The known CAT inducers of Fusarium sp. e.g. NaNO₃, and MgCl₂ could induce some level of CAT fusion in C. gloeosporioides and C. siamense, however, the CAT fusion frequency was significantly less as compared to water suggesting that the physiological requirement for CAT induction in different fungi may not be very identical. Tryptophan, a known CAT fusion inhibitor also reduced the inter-specific CAT fusion frequency in these fungi up to some extent (Fig. 4) (Fischer-Harman et al., 2012).

A correlation has been established between some important developmental processes like sporulation and biofilm formation to the environmental stresses in few ascomycetous fungal species (Emri et al., 2015; Jaimes-Arroyo et al., 2015; Linz et al., 2013; Orosz et al., 2018; Reverberi et al., 2010; Zheng et al., 2015). Therefore, we further assessed whether the inter-specific CAT fusion between C. gloeosporioides and C. siamense is also dependent on physiological stresses like oxidative, hyperosmotic, heat and antifungal stresses. We observed that the CAT fusion frequency was much lower under heat and antifungal stresses, however, the CAT fusion was found to be higher in oxidative and osmotic stresses in (Fig. 4). Even the hyperosmotic stress exerted by sorbitol induced much higher CAT fusion percentage as compared to water (Fig. 4). The possible reason for relatively high frequency CAT fusion by hyperosmotic and oxidative stresses may be because these stresses activate the mitogen-activated protein kinase signaling pathway, which was shown to be essential for CAT fusion in N. crassa (Roca et al., 2005a). We have also shown that the inter-specific CAT fusion in C. gloeosporioides and C. siamense gets inhibited by a MAP kinase inhibitor InSolution PD 98059 (Fig. 4), thereby suggesting a possible role of MAP kinase pathway in CAT fusion in these fungi. Therefore, we hypothesize that a potential cross-talking among MAPK cascades during hyperosmotic and oxidative stresses, in turn induce CAT fusion fortuitously, however, further studies are needed in this direction.

In C. lindemuthianum, C. gossypii, C. fructicola, C. nymphaeae, Fusarium oxysporum, Neurospora crassa and Venturia inaequalis, the CAT induction is dependent on conidial density, thereby suggesting the involvement of an extracellular CAT inducer. In all these fungi, the conidial number threshold required for CAT induction is more or less same i.e. 1 × 10⁶ conidia/ml (Gonçalves et al., 2016; Kurian et al., 2018; Leu L.S., 1967; Roca et al., 2005a, 2003; Shahi et al., 2016). The combined conidial number requirement for inter-specific CAT fusion in C. gloeosporioides and C. siamense was found to be 4 × 10⁵conidia/ml (2 × 10⁵conidia/ml for each species). It suggests that for an efficient CAT fusion, a threshold conidial number is required and any concentration lesser then that would not result in efficient CAT fusion (Fig. 5A). The CAT induction was shown to be mediated through release of extracellular quorum sensing molecule/s, however, the chemical identity of such molecule/s is not known till date in any fungi known to undergo CAT fusion (Roca et al., 2005a). We have shown that the young conidia were not optimal for CAT fusion, however, when the young conidia were incubated in filtered CAT medium supernatant of older conidia (17 days), they could also undergo CAT fusion up to some extent, thereby suggesting that some molecule/s are secreted in the medium, which could induce CAT fusion even in the younger conidia (Fig. 5B). We have also demonstrated that availability of nutrients (100% PDB) inhibited CAT fusion in C. gloeosporioides and C. siamense, however, when the conidia of these fungi were incubated in 100% PDB supplemented with CAT medium supernatant, then the conidia of both the age could undergo CAT fusion, thereby, suggesting that though the nutrients (100% PDB) had the potential to inhibit the CAT fusion but the quorum sensing molecules could still induce the CAT fusion in the presence of nutrients (Fig. 5B). It was suggested that the CAT inducer might be of peptide or proteinaceous in nature, which gives species specificity for CAT fusion, thereby preventing non self-fusion between species (Roca et al., 2005a). We have also attempted to determine the basic chemical nature of the quorum sensing molecule/s involved in CAT fusion between C. gloeosporioides and C. siamense, by treating the CAT medium supernatant with chloroform and proteinase K separately. We found that proteinase k treated supernatant could retain the CAT inducing ability, thereby suggesting that the potential quorum sensing molecule was not a peptide or protein. However, the chloroform extraction abolishes the CAT induction ability of the CAT medium supernatant, suggesting that the potential CAT inducer might be a lipid-based molecule (Fig. 5C). Further, we have also shown that when leftover chloroform from chloroform treatment of CAT medium supernatant was re-extracted with water and such re-extract could induce significantly high CAT fusion percentage (up to 40%) in older (17 days) conidia suggesting that the CAT inducer is a lipid-based molecule (Fig. 5C). The high CAT fusion percentage seen in re-extract could be because the quorum sensing molecule got purified from other impurities, thereby increased the CAT fusion percentage. We hypothesize that the QS molecules involved in CAT fusion between C. gloeosporioides and C. siamense is probably a lipid-based molecule and we are currently trying to decipher the chemical structure and identity of this QS molecule.

Previous studies have indicated that CAT fusion may facilitate horizontal gene/chromosome transferred. Nuclei were shown to move between fused conidia of many fungi viz. C. lindemuthianum, C. gossypii, C. nymphaeae, F. oxysporum, and N. crassa (Gonçalves et al., 2016; Kurian et al., 2018; Roca et al., 2005a, 2003; Shahi et al., 2016). By performing DAPI staining, we also observed the movement of nuclei during CAT fusion between C. gloeosporioides and C. siamense (Fig. 6). This nuclear transfer between the two species signifies that this inter-specific CAT fusion is not accidental; indeed, it does involve exchange of nuclear material. We have also shown movement of other cell organelles e.g. mitochondria, lysosomes and lipid droplets during the CAT fusion, which signifies that there has been an active exchange of cellular content between the two species (Fig. 7). These results are first ever evidence of cell organelles transfer during the CAT fusion in any Colletotrichum species so far. Such organelle transfer during CAT fusion has been reported for F. oxysporum, wherein, the movement of mitochondria, vacuoles and lipid droplets was documented (Kurian et al., 2018; Ruiz-Roldán et al., 2010). Nuclear transfer through CAT fusion could be a form of horizontal gene transfer, which might generate genetic and phenotypic diversity and confer selective advantage to survive under the nutrient limitation and other stress conditions. It has been reported that the inter-specific CAT fusion between C. lindemuthianum and C. gossypii, resulted some hybrid colonies, which exhibited morphological variation with distinct phenotypic sectors of both parental types (Roca et al., 2004). Occurrence of heterokaryotic sectored colonies post CAT fusion has also been demonstrated in C. lindemuthianum (Ishikawa et al., 2012). In order to understand the role of inter-specific CAT fusion in generation of genetic and phenotypic diversity in C. gloeosporioides and C. siamense, we have carried out three experiments: (1) Post-CAT fusion between C. gloeosporioides and C. siamense, the conidia were harvested and grown as a single colony in separate Petri plates, wherein, each colony originated from a single conidium (in which the genetic transfer might have happened). The resulting colonies have shown significant phenotypic variations in colony characteristics (Fig. 8). By observing the colony characteristics, we could not identify that the colony developed originally from which fungal conidia (C. gloeosporioides or C. siamense); moreover, one might argue that whether these phenotypic variations are bona fide variations or it is a result of mixing of conidia of two different species, though we strictly followed single spore isolation protocol. These two species can be differentiated based on their conidial morphologies, wherein, C. gloeosporioides conidia are cylindrical, while C. siamense are fusiform in shape (Prihastuti et al., 2009). Therefore, by doing light microscopic studies on these putative recombinant colonies, we could tentatively establish the species background of these recombinants, however, at times it has been difficult to differentiate the post-CAT fusion generated conidia based on the morphology, therefore, the ApMAT gene sequencing accurately confirmed the species background of these putative recombinants (Additional file 1: Table S1). The ApMAT gene sequencing proved that whatever putative recombinants were observed, they were indeed bona fide recombinants of C. gloeosporioides and C. siamense. Among both the species, a greater number of C. gloeosporioides putative recombinants showed significant phenotypic variations as compare to C. siamense putative recombinants (Additional file 2: Table S2). (2) In order to prove that the phenotypic variations observed in putative recombinants were genuinely generated due to inter-specific CAT fusion between these two species, the results of our control experiment showed that intra-specific CAT fusion (self-fusion) in C. gloeosporioides and C. siamense individually did not generate apparent colony morphology variations in their progenies (Additional file 4: Fig. S2A). (3) There can be another argument saying that CAT fusion might not be a reason for the observed phenotypic variations in the C. gloeosporioides and C. siamense colonies (which developed from single conidium post CAT fusion) and such variation could have generated spontaneously as a result of phenotypic heterogeneity exhibited by many fungi or stress induced genomic alterations. Phenotypic heterogeneity’ refers to a phenomenon whereby individual cells within clonally-derived populations, that have a uniform genetic background, can nevertheless display differences in phenotype (Hewitt et al., 2016). It has also been seen that prolonged starvation/stress could cause genomic rearrangements and transposon movement in fungi, thereby generating phenotypic variations (Coyle and Kroll, 2008; Miousse et al., 2015). To rule out these two possibilities, when C. gloeosporioides and C. siamense were grown for 17 days, it caused nutrient limitation stress and such conidia when developed as colonies did not show any significant phenotypic variation with respect to colony characteristics as compared to their parental strains (Additional file 4: Fig. S2B). Therefore, the above-mentioned 2nd and 3rd experiment further confirms that the phenotypic variation (colony characteristics) generated in putative recombinant was not spontaneous and was due to inter-specific CAT fusion only.

In order to further explore that the CAT fusion between these two species indeed involved genetic exchange and responsible for genetic variations, we performed AFLP of genomic DNA isolated from C. gloeosporioides and C. siamense parents’ strains, and their putative recombinants (Fig. 9). Interestingly, we observed a much variable AFLP banding pattern in C. gloeosporioides putative recombinants as compared to C. gloeosporioides parent strain. Interestingly, we also observed that few C. gloeosporioides recombinants showed presence of some extra bands, which are present in C. siamense and not in C. gloeosporioides parent strains. This suggest that during CAT fusion, some amount of DNA might have got transferred between the two species, which resulted in variable AFLP banding pattern in C. gloeosporioides putative recombinants. These observed genotypic variations in C. gloeosporioides putative recombinants might be responsible for the above-mentioned phenotypic variations in C. gloeosporioides putative recombinants. Further, we do not see a significant variation in AFLP banding pattern in C. siamense putative recombinants, which interestingly corroborates with our phenotypic variation data, wherein, we did not see a significant phenotypic variation in the colonies of C. siamense putative recombinants as well. These variable AFLP patterns were reproducible thereby ruling out the possibility of any artifact or procedural borne variation in AFLP banding pattern. Our results suggest that the inter-specific CAT fusion between C. gloeosporioides and C. siamense, involved some level of genetic exchange, which resulted in phenotypic variations in C. gloeosporioides putative recombinants. However, further experiments are warranted to confirm the same.

We have shown that a greater number of C. gloeosporioides recombinants exhibited phenotypic variations (Fig. 8); therefore, we tested the fitness of these recombinants only. We observed that there were few recombinants (e.g. CG1 and CG4) showed growth advantages under certain stress conditions (oxidative stress) as compared to others and the same recombinants showed reduced growth under a different stress condition (osmotic stress). One putative C. gloeosporioides recombinant CG2 exhibited higher growth rates under oxidative as well as osmotic stress as compared to the parent strain of C. gloeosporioides (Fig. 10). The observed growth advantages might be due to heterosis, wherein, recombinants were more heterozygous than their parents.

This is the first study to determine the optimal conidial density, conidial age, nutritional factors, and other physiological requirements for CAT induction between C. gloeosporioides and C. siamense. We discovered a significantly efficient inter-specific CAT fusion between these two fungi under no selection pressure, which is very intriguing. We have also generated some preliminary experimental proofs to link the role of inter-specific CAT fusion in generation of phenotypic and genotypic diversity in these fungi. Further, the putative recombinants generated post-CAT fusion was also followed up for their fitness in different stress conditions and it was seen that CAT fusion might be responsible for generation of the offspring’s which may have growth advantages in a given niche. Therefore, to summarize, the observed colony phenotypic variations, AFLP band polymorphism and varied fitness of the putative recombinants together suggests a possible genetic rearrangement through inter-specific CAT fusion. The present study will help to understand the genetic exchange/transfer mechanisms and generation of inter-specific hybrids or recombinants in C. gloeosporioides and C. siamense in future.

Additional file 1: Table S1: Fungal cultures, their ApMAT gene-based identification and GenBank accession numbers.

Additional file 2: Table S2: Percentage phenotypic variations of C. gloeosporioides and C. siamense colonies generated post inter-specific CAT fusion.

Additional file 3: Figure S1: A schematic representation of in-vitro CAT induction protocol. Cg: C. gloeosporioides and Cs: C. siamense.

Additional file 4: Figure S2: Colony morphologies of C. siamense and C. gloeosporioides parent strains and their progenies generated post intra-specific CAT fusion and vegetative growth. a Colony morphologies of parent C. siamense and C. gloeosporioides strains and their progenies (CSA-CSJ and CGA-CGJ) derived post intra-specific CAT fusion individually (self-fusion) by single spore isolation. b Colony morphologies of parent C. siamense and C. gloeosporioides strains and their progenies (CSV1-CSV10 and CGV1-CGV10) obtained from vegetatively grown C. gloeosporioides and C. siamense strains (17 days old), individually without CAT fusion. Scale Bar = 20 µm.

Acknowledgement

We are thankful to the Director, MACS’ Agharkar Research Institute for providing the necessary facility to carry out the research work. AB is thankful to SERB-DST for sanctioning the core research grant (CRG/2018/001786). NM acknowledges Council for Scientific and Industrial Research (CSIR) New Delhi for the junior research fellowship. We are grateful to Dr. Ravindra Patil from Agharkar Research Institute, Pune for providing us the native PAGE facility.

Adherence to national and international regulations

Authors’ contributions

NM and AB designed the research, NM performed the experiments, NM and AB analyzed and interpreted the experiments and results. They also wrote the manuscript; all authors read, revised and approved the manuscript.

Funding

This study was funded by Science and Engineering Research Board (SERB) – Department of Science and Technology, New Delhi, India. The project grant number is CRG/2018/001786.

Availability of data and materials

ApMAT DNA Sequences of C. gloeosporioides and C. siamense parent and their recombinant strains were deposited to NCBI and accession numbers listed in Additional file 1: Table S1.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declared that they have no competing interests.

Aamir S, Sutar S, Singh SK, Baghela A (2015) A rapid and efficient method of fungal genomic DNA extraction, suitable for PCR based molecular methods. Plant Pathol Quar 5:74–81

Akagi Y, Akamatsu H, Otani H, Kodama M(2009) Horizontal chromosome transfer, a mechanism for the evolution and differentiation of a plant-pathogenic fungus. Eukaryot Cell 8(11):1732–1738

Araujo L, Stadnik MJ(2013)Multiple pressures and conidial anastomosis tubes in the infectious process of Colletotrichum gloeosporioides in apple trees. Bragantia 72(2):180–183

Bertier L, Leus L, D’hondt L, De Cock AWAM, Höfte M(2013) Host adaptation and speciation through hybridization and polyploidy in phytophthora. PLoS One 8(12):e85385

Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller J, Abang MM et al (2009) A polyphasic approach for studying Colletotrichum. Fungal Divers 39:183–204

Chakrabarti A, Shivaprakash MR, Curfs-Breuker I, Baghela A, Klaassen CH, Meis JF(2010) Apophysomyces elegans: Epidemiology, amplified fragment length polymorphism typing, and in vitro antifungal susceptibility pattern. J Clin Microbiol48(12):4580–4585

Cisar CR, Spiegel FW, TeBeest DO, Trout C(1994) Evidence for mating between islates of Colletotrichum gloeosporioides with different host specificities. Curr Genet 25(4):330–335

Coyle S, Kroll E(2008) Starvation induces genomic rearrangements and starvation-resilient phenotypes in yeast. Mol Biol Evol25(2):310–318

Dean R, Van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD (2012) The Top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 13(4):414–430

Denoyes-Rothan B, Guérin G, Délye C, Smith B, Minz D, Maymon M et al (2003) Genetic diversity and pathogenic variability among isolates of colletotrichum species from strawberry. Phytopathology 93:219–228

Depotter JRL, Seidl MF, Wood TA, Thomma BPHJ(2016) Interspecific hybridization impacts host range and pathogenicity of filamentous microbes. Curr Opin Microbiol 32:7–13

Elouafi I, Nachit MM (2004) A genetic linkage map of the Durum x Triticum dicoccoides backcross population based on SSRs and AFLP markers, and QTL analysis for milling traits. Theor Appl Genet108(3):401–13

Emri T, Szarvas V, Orosz E, Antal K, Park HS, Han KH et al(2015) Core oxidative stress response in Aspergillus nidulans. BMC Genomics 16(1):478

Fischer-Harman V, Jackson KJ, Muñoz A, Shoji JY, Read ND(2012) Evidence for tryptophan being a signal molecule that inhibits conidial anastomosis tube fusion during colony initiation in Neurospora crassa. Fungal Genet Biol 11:896–902

Freeman S, Katan T, Shabi E(1996) Characterization of Colletotrichum gloeosporioides isolates from avocado and almond fruits with molecular and pathogenicity tests. Appl Environ Microbiol 62:1014–1020

Gonçalves AE, Velho AC, Stadnik MJ(2016) Formation of conidial anastomosis tubes and melanization of appressoria are antagonistic processes in Colletotrichum spp. from apple. Eur J Plant Pathol146:497–506

He C, Rusu AG, Poplawski AM, Irwin JAG, Manners JM (1998) Transfer of a supernumerary chromosome between vegetatively incompatible biotypes of the fungus Colletotrichum gloeosporioides. Genetics150(4):1459–1466

Hewitt SK, Foster DS, Dyer PS, Avery SV(2016) Phenotypic heterogeneity in fungi: Importance and methodology. Fungal Biol Rev 30(4):176–184

Hickey PC, Swift SR, Roca MG, Read ND(2004) Live-cell Imaging of Filamentous Fungi Using Vital Fluorescent Dyes and Confocal Microscopy. Methods Microbiol 34:63–87

Ho W, Ko W (1997) A simple method for obtaining single-spore isolates of fungi. Bot Bull Acad Sin 41–44

Hyde K, Cai L, Cannon PF, Crouch JA, Crous PW, Damm U et al (2009) Colletotrichum – names in current use. Fungal Divers online Adv39:147–182

Ishikawa FH, Souza EA, Read ND, Roca MG (2010) Live-cell imaging of conidial fusion in the bean pathogen, Colletotrichum lindemuthianum. Fungal Biol 114:2–9

Ishikawa FH, Souza EA, Shoji JY, Connolly L, Freitag M, Read ND et al (2012) Heterokaryon incompatibility is suppressed following conidial anastomosis tube fusion in a fungal plant pathogen. PLoS One 7(2):e31175

Jaimes-Arroyo R, Lara-Rojas F, Bayram Ö, Valerius O, Braus GH, Aguirre J (2015) The SrkA kinase is part of the SakA Mitogen-activated protein kinase interactome and regulates stress responses and development in Aspergillus nidulans. Eukaryot Cell 14:495–510

James SW, Mirabito PM, Scacheri PC, Morris NR(1995) The Aspergillus-Nidulans Bime (Blocked-in-Mitosis) Gene Encodes Multiple Cell-Cycle Functions Involved in Mitotic Checkpoint Control and Mitosis. J Cell Sci 108:3485–3499

Jayawardena R(2018) Mycosphere Essay 6: Why is it important to correctly name Colletotrichum species? Mycosphere 7(8):1076–1092

Kurian SM, Pietro AD, Read ND (2018) Live-cell imaging of conidial anastomosis tube fusion during colony initiation in fusarium oxysporum. PLoS One 13(5):e0195634

Leu LS(1967) Anastomosis in Venturia inaequalis. University of Wisconsin, Wisconsin

Linz JE, Hong SY, Roze LV(2013) Oxidative stress-related transcription factors in the regulation of secondary metabolism. Toxins (Basel) 5(4):683–702

Ma LJ, Van Der Does HC, Borkovich KA, Coleman JJ, Daboussi MJ, Di Pietro Aet al (2010) Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464(7287):367–373

Man In ’T Veld WA, De Cock AWAM, Summerbell RC(2007) Natural hybrids of resident and introduced Phytophthora species proliferating on multiple new hosts. Eur J Plant Pathol 117:25–33

Manners JM, He C(2011) Slow-growing heterokaryons as potential intermediates in supernumerary chromosome transfer between biotypes of Colletotrichum gloeosporioides. Mycol Prog 10:383–388

Meadows BRA (2012) Live cell imaging of lipid droplet distribution and motility in the filamentous fungus Ustilago maydis. The University of Exeter

Mehrabi R, Bahkali AH, Abd-Elsalam KA, Moslem M, Ben M’Barek S, Gohari AM et al(2011) Horizontal gene and chromosome transfer in plant pathogenic fungi affecting host range. FEMS Microbiol Rev35(3):542–554

Mehta N, Hagen F, Aamir S, Singh SK, Baghela A(2017) Development of a high-resolution multi-locus microsatellite typing method for colletotrichum gloeosporioides. Mycobiology 45(4):401–408

Miousse IR, Chalbot MCG, Lumen A, Ferguson A, Kavouras IG, Koturbash I(2015) Response of transposable elements to environmental stressors. Mutat Res - Rev Mutat Res 765:19–39

Nova MXV, Borges LR, de Sousa AC, Brasileiro BT, Lima EA, da Costaet al(2011) Pathogenicity for onion and genetic diversity of isolates of the pathogenic fungus Colletotrichum gloeosporioides (Phyllachoraceae) from the State of Pernambuco, Brazil Genet Mol Res 10(1):311–20

Oliver RP, Solomon PS (2008) Recent fungal diseases of crop plants: Is lateral gene transfer a common theme? Mol Plant-Microbe Interact 21(3):287–93

Orosz E, Van De Wiele N, Emri T, Zhou M, Robert V, De Vries RP et al (2018) Fungal Stress Database (FSD) - A repository of fungal stress physiological data. Database. 2018, bay009

Prihastuti H, Cai L, Chen H, Mckenzie EHC, Hyde KD(2009) Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers 39:89–109

Read ND, Fleißner A, Roca MG, Glass NL(2010) Hyphal fusion. Cell Mol Biol filamentous fungi 260–273

Read ND, Lichius A, Shoji JY, Goryachev AB(2009) Self-signalling and self-fusion in filamentous fungi. Curr Opin Microbiol 12(6):608–15

Rep M, Kistler HC(2010) The genomic organization of plant pathogenicity in Fusarium species. Curr Opin Plant Biol 13(4):420–426

Reverberi M, Ricelli A, Zjalic S, Fabbri AA, Fanelli C (2010) Natural functions of mycotoxins and control of their biosynthesis in fungi. Appl Microbiol Biotechnol 87(3):899–911

Roca MG, Arlt J, Jeffree CE, Read ND(2005a) Cell biology of conidial anastomosis tubes in Neurospora crassa. Eukaryot Cell 4:911–919

Roca MG, Davide LC, Davide LMC, Mendes-Costa MC, Schwan RF, Wheals AE(2004) Conidial anastomosis fusion between Colletotrichum species. Mycol Res 108:1320–1326

Roca MG, Davide LC, Mendes-Costa MC, Wheals A (2003) Conidial anastomosis tubes in Colletotrichum. Fungal Genet Biol 249(2):191–8

Roca MG, Read ND, Wheals AE(2005b) Conidial anastomosis tubes in filamentous fungi. FEMS Microbiol Lett 249(2):191–8

Rosewich U, Kistler H(2000) Role of horizontal gene transfer in the evolution of fungi. Annu Rev Phytopathol 38:325–363

Ruiz-Roldán MC, Köhli M, Roncero MIG, Philippsen P, Di Pietro A, Espeso EA (2010) Nuclear dynamics during germination, conidiation, and hyphal fusion of Fusarium oxysporum. Eukaryot Cell 9(8):1216–1224

Shahi S, Beerens B, Bosch M, Linmans J, Rep M(2016) Nuclear dynamics and genetic rearrangement in heterokaryotic colonies of Fusarium oxysporum. Fungal Genet Biol 91:20–31

Sharma G, Kumar N, Weir BS, Hyde KD, Shenoy BD (2013) The ApMat marker can resolve Colletotrichum species: A case study with Mangifera indica. Fungal Divers 61:117–138

Silva DN, Talhinhas P, Várzea V, Cai L, Paulo OS, Batista D(2012) Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee ( Coffea spp.) hosts . Mycologia 104(2):396–409

Walton JD (2000) Horizontal gene transfer and the evolution of secondary metabolite gene clusters in fungi: An hypothesis. Fungal Genet Biol 30(3):167–171

Weeds PL, Chakraborty S, Fernandes CD, d’A Charchar MJ, Ramesh, CR, Kexian Y et al (2003) Genetic Diversity in Colletotrichum gloeosporioides from Stylosanthes spp. at Centers of Origin and Utilization. Phytopathology 93:176–185

Weir BS, Johnston PR, Damm U(2012) The Colletotrichum gloeosporioides species complex. Stud Mycol 73(1):115–80

Wu Y, Zhou HJ, Che J, Li WG, Bian FN, Yu SB et al(2014) Multilocus microsatellite markers for molecular typing of Candida tropicalis isolates. BMC Microbiol 14:245

Yin J, Ye AJJ, Tan KSW (2010) Autophagy is involved in starvation response and cell death in Blastocystis. Microbiology 156(3):665–677

Zafra G, Absalón AE, Cortés-Espinosa DV(2015) Morphological changes and growth of filamentous fungi in the presence of high concentrations of PAHs. Brazilian J Microbiol 46(3):937–941

Zheng H, Kim J, Liew M, Yan JK, Herrera O, Bok JW et al (2015) Redox metabolites signal polymicrobial biofilm development via the napa oxidative stress cascade in aspergillus. Curr Biol 25(1):29–37

Download PDF

Journal Publication

published 01 Apr, 2021

Read the published version in IMA Fungus →

Editorial decision: Major revision
08 Oct, 2020
Review #1 received at journal
01 Sep, 2020
Reviewer #2 agreed at journal
25 Aug, 2020
Reviewers invited by journal
24 Aug, 2020
Reviewer #1 agreed at journal
24 Aug, 2020
First submitted to journal
05 Aug, 2020
Editor assigned by journal
05 Aug, 2020
Submission checks completed at journal
04 Aug, 2020
Editor invited by journal
04 Aug, 2020

You are reading this latest preprint version

Quorum sensing-mediated inter-specific conidial anastomosis tube fusion between Colletotrichum gloeosporioides and Colletotrichum siamense.

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Description of Supplementary Material

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1