This study was carried out in the department of Gastroenterology and Endocrinology PGIMER, Chandigarh. It was conducted after receiving approval from the Institute ethics Committee, PGIME&R, Chandigarh, India. Detailed study design has been described in our previous studies [14-16] . In brief, 300 T2DM patients were recruited from Diabetes Clinic at PGIMER following American Diabetes Association 2013 criteria. Patients who developed diarrhoea following Metformin intake were not been included in this study. Moreover, patients with history of peptic ulcer and taking prokinetic therapies, broad spectrum antibiotics and proton pump inhibitors were excluded from this study. Age and sex matched 200 healthy subjects without diabetes and any gastrointestinal disorders were also included in this study as controls. After enrolment, detailed clinical history including altered bowel habit such as constipation and/or diarrhoea , history of dietary intake and BMI were recorded.
For studying ADRB 2 and 3 gene polymorphism, DNA was isolated from buffy coat of EDTA blood sample using phenol chloroform method. Then the isolated DNA was subjected to Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) using following primers: Beta 2-AR F: 5’ CTTCTTGCTGGCACGCAAT-3’, Beta- 2 AR R: 5’ CCAGTGAAGTGATGAATAGTTGG 3’ ; Beta 3-AR F 5’ CGCCCAATACCGCCAACAC 3’ Beta -3 AR R 5’-CCACCAGGAGTCCCATCACC- 3’
PCR amplification of both the genes was performed in Eppendorf master cycler using above mentioned specific primers.
PCR conditions for Beta-2 AR were: an initial denaturation step at 94o C for 4 minutes , followed by 30 cycles of denaturation at 94o C for 1 minute , annealing at 58 o C for 1 minute and extension at 72 o C for 1 minute, with a final extension of 10 minutes at 72 o C.
The amplified PCR product of 210 bp for Arg16 Gly was digested with BSeMI restriction enzyme. The fragments were resolved by electrophoresis on 6% acrylamide gels. Bands were visualized by UV trans illumination. 131 bp, 56 bp and 14 bp were observed in the gel for individual homozygote for Arg16Arg. 131 bp, 108 bp and 56 bp were observed in the gel for individual heterozygote for Arg16Gly and 108 bp &56 bp were observed for individual homozygote for Gly16Gly. (Figure 1a)
PCR conditions for Beta-3 AR were: an initial denaturation step at 94o C for 5 minutes, followed by 33 cycles of denaturation at 94o C for 30 seconds , annealing at 61 o C for 30 seconds , and extension at 72 o C for 15 seconds, with a final extension of 7 minutes at 72 o C.
The amplified PCR product of 210 bp was digested with BstNI restriction enzyme. The fragments were resolved on 6% acrylamide gel as before. The amplicon of 99,62,30,12,7 bp were observed in individual with genotype Trp64Trp (wild homozygous) , 161,99,62,30,12,7bp bands were observed in individuals with genotype Trp64Arg (variant homozygous) and 161,30,12,7 bp bands were observed in individuals with heterozygous Arg64Arg genotype . (bands of 14 bp, 12 bp, 7bp were too small to be visualized in the gel) (Figure 1b)
Hypo and hyper gut motility was assessed by measuring orocecal transit time (OCTT) according to the original method proposed by Jorge et al 1994[17] and modified subsequently by Rana et al 2010[18]. In brief, after ingestion of 10 g of lactulose, hydrogen concentration in fasting state and at every 15 minutes interval for 4 hours were measured in the end expiratory samples with the help of breath hydrogen Microlyzer from Quinton, USA.
Statistical analysis: Statistical analysis was carried out by SPSS 16.0 version. Data were presented as Mean± SEM and percentage. Independent T test was used to compare between cases and controls of parameters with continuous numbers. Chi square test was carried out to compare categorical variables. P values less than 0.05 was considered significant.