Cell culture
FaDu cell line was purchased from the Shanghai Institute of Biological Sciences and cultured in high glucose Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) and 100 μg/ml penicillin/streptomycin (P/S; Invitrogen). Cells were maintained at 37°C with 5% CO2.
Cell cytotoxicity assay of PDQ
PDQ was obtained from the School of Pharmaceutical Sciences of Jilin University, Changchun, China. Logarithmic growth phase of FaDu cells were seeded in 96-well plates at 5000 cells/well and cultured overnight. Then cells were treated with different concentrations of PDQ (40, 60, 80,100,120, 140,160 and 180 μmol/L) for 24 h, 48 h and 72 h. Cells treated with the same amount of anhydrous ethanol (PDQ=0 μmol/L) were used as control. The final concentration of ethanol was 0.1%. Five parallel samples were set for each concentration. After that, 10 μL of Cell Counting Kit 8 (CCK8; Beyotime) was added to every well and the cells were incubated for 2 h at 37°C with 5% CO2. Finally, the absorbance at 450 nm of every well was read by a Bio-Rad microplate reader (model 630; Hercules, CA, USA).
Safety detection of PDQ in vivo
Ten female BALB/c mice (18–22 g) were purchased from the Animal Center of Norman Bethune Medical College of Jilin University (Changchun, China). All animals were maintained under standardized laboratory conditions (12 h light/dark cycle beginning at 08:00 a.m, temperature 22–25 °C, relative humidity 50–70%), with free access to food and water. The mice were randomly divided into control and PDQ group (5 mice/group). Mice in PDQ group were gavaged (P.O) with 40 mg/kg PDQ (suspended in 0.05% carboxymethylcellulose sodium) for one time,while mice in the control group were treated with equal carboxymethylcellulose sodium. All mice general clinical conditions were daily observed for a 2-week follow-up period. Mice were sacrificed by cervical vertebra dislocation at day 14. The whole blood was collected from the orbit and the serum was separated from the blood by centrifugation (3500 rpm, 15 min, 4 ◦C). The hematopoietic and biochemical analysis were determined by automatic hematology analyser (HC2200, Meiyilinm, China). Heart, lungs, liver, spleens and kidneys were rapidly collected and cut into 4–5 μm-thick sections, embedded in paraffin, stained with Hematoxylin - Eosin and examined with Nikon TE 2000 fluorescence microscope (Nikon, Japan). All animals in this study were handled according to a protocol approved by the Institutional Animal Care and Use Committee of Jilin University (No. 2016135).
Glucose uptake assay
Cells (3 × 105 cells/well) were plated in 6-well plates. After the cells were cultured for 24h with different concentration of PDQ, the supernatant of culture medium was collected to examine the concentration of glucose using the Glucose Assay Kit (BestBio, BB-4731-1). The glucose concentration was quantified by the absorbance at 505nm by a plate reader (BioTek), and normalized by protein concentration of respective samples.
Cell cycle analysis by flow cytometry
To analyze cell cycle, FaDu cells at the logarithmic growth phase were harvested and washed with ice-cold PBS, then fixed with ice-cold 70%-75% ethanol at −4 °C overnight. After that, cells were washed with cold PBS, subsequently incubated with 100 ng/mL RNase A for 30 min at 37 °C, and then filtered by 400-mesh screen. Next, cells were stained with 10 μg/mL PI for 30 min at 4 °C in dark. Finally, samples were tested by flow cytometry with FACS Diva Software (Becton Dickinson) to analyze DNA content and light scattering.
Cell apoptosis analysis by flow cytometry and TUNEL
To analyze cell apoptosis, FaDu cells were plated in 6-well plates and treated with different concentration of PDQ (60, 100 and 140 μmol/L) or with the same amount of anhydrous ethanol. After 24 h, cells were harvested and labeled with Annexin V-FITC-PI Apoptosis Detection Kit (BD Biosciences, Beijing, China) according to the manufacturer’s instruction and analyzed by flow cytometry (Becton Dickinson).
Moreover, immunofluorescence staining of TUNEL was also performed to detect cell apoptosis. Cells were cultured at high confluence of 80%-90% and treated with different concentration of PDQ (0, 60, 100, and 140 μmol/L). After 24 h incubation, cells were fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.5% Triton X-100 for 10 min. Next, cells were incubated with TUNEL (Promega Corp., Madison, WI, USA) at 37 °C for 30 min, followed by incubated with Alexa Fluor 488-conjugated goat anti-mouse IgG (Cell Signaling Technology) for 1 h. Finally, the samples were observed by a Zeiss 510 Meta laser scanning confocal microscope (Zeiss). The exposure time of all pictures was 200 ms.
Molecular docking
The software of Schrödinger Suites (2015) was used to perform the molecular docking between PDQ and protein receptors. The crystal structures of proteins were obtained from the Protein Data Bank. The three-dimensional (3D) structure of PDQ was drawn via ‘Maestro Elements’ in the software, and its bond angle and order was assigned by ‘Ligand Preparation’. Protein receptors and PDQ were docked with ‘Glide Docking’, their docking results were visualized through the PyMOL Molecular Graphics System.
Quantitative Real-Time RT-PCR
FaDu cells were cultured in 96-well plates and treated with different concentration of PDQ (60, 100 and 140 μmol/L) or with the same amount of anhydrous ethanol. After incubation for 24 h, total RNA was extracted using TRIzol reagent (Invitrogen, USA). cDNA was synthesized by reverse transcription ReverTra Ace® qPCR RT Master Mix with gDNA Remover (TOYOBO Co., LTD) and subjected to real-time PCR with gene-specific primers in the presence of Cybergreen (Applied Biosystems). Experiments were performed at least three times with duplicate replicates. Relative abundance of mRNA was calculated by normalization to GAPDH. Primer pairs used here were as follows (purchased from Genecopoeia Co., Ltd.): GAPDH: forward 5’- TTCTTTTGCGTCGCCAGCCGAG -3’, reverse 5’- CCAGGCGCCCAATACGACCAAA -3’; GLUT1: forward 5’- CTGGCATCAACGCTGTCTTC -3’, reverse 5’- GCCTATGAGGTGCAGGGTC -3’; HIF-1α: forward 5’- AGACAAAGTTCACCTGAGCC -3’, reverse 5’- GGGAGCTAACATCTCCAAGTCT -3’.
Western blotting
FaDu cells were treated with different concentration of PDQ (60, 100 and 140 μmol/L) or with the same amount of anhydrous ethanol. After incubation for 24 h, cells were harvested and subjected to SDS-PAGE, and processed per antibody manufacture’s instruction (BD Biosciences). The primary antibodies were used as follows: anti-HIF-1α (1:200 dilution, Santa Cruz, sc-13515), anti-GLUT1 (1:200 dilution, Santa Cruz, sc-377228), anti-Bcl-2 (1:1000 dilution; Bioss, bsm-52304R.), anti-Bax (1:1000 dilution; Bioss, bsm-52316R.), anti-Caspase9 (1:800 dilution; Proteintech, 10380-1-AP.), and anti-Caspase3 (1:1000 dilution; Proteintech, 19677-1-AP.), and GAPDH (1:10000 dilution; Abcam,Inc.) Following incubation with the corresponding secondary antibodies, the signals were developed using an Amersham ECL Plus Western Blotting Detection System (GE Healthcare). Data were presented as relative protein levels which were normalized to GAPDH, and the ratio of control samples was taken as 100%.
dSTORM imaging
Cells were passaged on a pre-cleaned standard microscope slide (22 mm × 22 mm, Fisher) in the dish and treated with 100 μM PDQ or left untreated. After 24 h, the solution was removed and cells were rinsed with PBS for three times. Subsequently, cells were fixed with 4% paraformaldehyde for 10 min at room temperature, and blocked with 3% Bovine Serum Albumin for 30 min. Then cells were incubated with anti-human GLUT1 antibodies (2 μg/ml in 3% BSA; Santa Cruz, sc-377228) overnight at 4 °C, and washed with PBS. At last, cells were stained with Alexa Fluor 647 goat anti-mouse IgG antibodies (2 μg/ml in 3% BSA; Invitrogen, A-21235) for 1 h. Before imaging, 50 μl imaging buffer containing Tris (50 mM, pH 8.0), NaCl (10 mM), glucose (10% w/v), glucose oxidase (500 μg /ml; Sigma), catalase (40 μg/ml; Sigma) and β-mercaptoethanol (1% v/v; Sigma) was dropped on a large microscope slide (24 mm × 50 mm, Fisher), and the small slide where cells were seeded was covered on the large one and sealed with nail polish.
dSTORM imaging was performed on a Nikon Ti-E microscope with a 100×1.49 NA TIRF lens (Nikon, Japan). The sample was illuminated in total internal reflection fluorescence (TIRF) mode. The 640 nm laser was used to excite fluorophores of Alexa Fluor 647, and the 405 nm laser was used to increase the number of on-state fluorophores by carefully controlling its irradiation intensity (<0.1 kW/cm2). All images were captured by a cooled EMCCD (Andor Ixon Ultra 888). 5000 images were collected for each cell with an internal time of 25 ms between frames to reconstruct a super-resolution image. TetraSpeck microspheres of 100 nm (Invitrogen,) were embedded in the sample to correct x–y drift, and a focus lock was used to correct z drift.
dSTORM data analysis
Raw dSTORM image sequences were analyzed by ThunderSTORM[20], a free available plug-in in Image J, to obtain a reconstructed dSTORM image. To characterize the spatial distribution of GLUT1 on cell membranes, SR-Tesseler analysis method was used as previously reported[21]. Firstly, a file including the coordinates, intensity and sigma of localizations was loaded in the program. The reconstructed image was shown and an ROI of cell could be selected to analyze (Figure S1a). Secondly, bisectors between two closest localizations were drawn, and the ROI was segmented into many polygons with different number of localizations (Figure S1b). The localization density of a polygon was defined as δi1, and the average localization density of the total ROI was δ0. If δi1 > δ0, localizations in this polygon were picked up to create an ‘object’ (Figure S1c). Similarly, the localization density of an object was set as δi2, and the average of all objects was δ1. Thirdly, objects satisfied the requirement of δi2 > δ1 were extracted as clusters (Figure S1d). Finally, the area, the number of localizations, coordinates and morphological parameters of each cluster were computed and exported.
Statistical Analysis
Data were expressed as mean ± SD (standard deviation). All statistical analysis was performed using SPSS version 22.0 (IBM, Chicago, Illinois, USA). Group means were compared by one-way analysis of variance (ANOVA), and P values <0.05 were considered significant in all cases. In addition, two-tailed unpaired t-test was used for the statistical analysis of dSTORM data, and P values <0.05 were considered significant.