CD9 Defines Acute Myeloid Leukemia Stem Cells and is Regulated by Alpha-2-Macroglobulin

doi:10.21203/rs.3.rs-55355/v1

Download PDF

Research

CD9 Defines Acute Myeloid Leukemia Stem Cells and is Regulated by Alpha-2-Macroglobulin

https://doi.org/10.21203/rs.3.rs-55355/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 25 Jan, 2021

Read the published version in Stem Cell Research & Therapy →

You are reading this older preprint version

Read the latest preprint version →

Background: Leukemia stem cells (LSCs) are responsible for the initiation, progress and relapse of acute myeloid leukemia (AML). Therefore, the therapy strategy of targeting LSCs is hopeful to eradicate AML. In this study, we aim to identify LSC-specific surface markers and uncover the underlying mechanism of AML LSCs.

Methods: Microarray gene expression data were used to investigate the candidate AML-LSC specific markers. CD9 expression was evaluated by flow cytometry in AML cell lines, patients with AML and normal donors. The biological characteristics of CD9-positive (CD9⁺) cells were analyzed by in vitro proliferation, chemotherapeutic drug resistance, migration and in vivo xenotransplantation assays. The molecular mechanism involved in CD9⁺ cell function was investigated by gene expression profiling. Effect of alpha-2-macroglobulin (A2M) on CD9⁺ cells was analyzed by proliferation, drug resistance and migration assays.

Results: CD9 as a cell surface protein was specifically expressed on AML LSCs, but almost not expressed on normal hematopoietic stem cells (HSCs). CD9⁺ cells exhibited more resistance to chemotherapy drugs and higher migration potential than CD9-negative (CD9^-) cells. More importantly, CD9⁺ cells possess the ability to reconstitute human AML in immunocompromised mice and promote tumor growth, suggesting CD9⁺ cells define the LSC population. Furthermore, we identified A2M plays a crucial role in CD9⁺ LSCs stemness maintenance. Down-regulation of A2M impairs drug-resistance and migration of CD9⁺ cells.

Conclusion: Our findings suggest that CD9 is a new biomarker of AML LSCs and may serve as a promising therapeutic target.

Stem Cell & Developmental Cell Biology

Acute myeloid leukemia (AML)

Leukemia stem cells (LSCs)

CD9

Alpha-2-macroglobulin (A2M)

Biomarker

Acute myeloid leukemia (AML) is the most common acute leukemia in adults, accounting for approximately 80% of cases in this group that is characterized by infiltration of the bone marrow, blood, and other tissues by proliferative, clonal, abnormally differentiated, and occasionally poorly differentiated cells of the hematopoietic system [1–2]. AML is caused by the disorders of the hematopoietic system and the most common treatments are chemotherapy and hematopoietic stem cell transplantation [3]. However,43% of patients will eventually relapse after complete remission in young adult patients [4]. Residual rare leukemia stem cells (LSCs) are the major cause of recurrence of AML, which possess chemoresistant and the ability to self-renew and differentiate thus reconstitute AML. Therefore, the LSCs concept has inspired the design of innovative treatment strategies for AML aimed at targeting LSCs hidden in cancers.

To identify the potential therapeutic targets, many groups have reported cell surface proteins preferentially expressed on AML LSCs, including CD47 [5], CD44 [6], CD96 [7], CD123 [8–9] CD99 [10] and TIM-3 [11–12]. During the past few years, some strategies for targeting LSCs markers antibody or immune cells have already been tested in patients, but still face the problems of toxicity and LSC resistance. Therefore, more specific LSCs marker still needs to be explored.

Here we identified a potential AML LSCs specific molecule CD9 by analyzing three microarray data of AML LSCs and a minimal residual disease (MRD) expression profiling. As one member of the tetraspanins family, CD9 is the third most abundant protein on the platelet surface and is required for the release of microparticles from coated-platelets [13–14]. Furthermore, it was reported that CD9 plays an important role in cell adhesion, movement, differentiation, proliferation, apoptosis and resistance [15–19]. Although CD9 has been reported to identify cancer stem cells in several types of cancers including pancreatic cancer, glioblastoma and B-acute lymphoblastic leukemia, and is related to the prognosis of AML, biological characteristic and regulatory mechanism of CD9⁺ AML LSCs remain elucidated [15, 20–22].

In this study, we found that CD9 was expressed highly in AML patient LSCs but almost not expressed in normal hematopoietic stem cells (HSCs). CD9⁺ cells exhibited stem cell characteristics, including drug resistance, migration ability and remodel human AML in immunocompromised mice. Mechanically, we identified A2M plays a crucial role in CD9⁺ LSC maintenance by transcription profiling analysis. Down-regulation of A2M impairs drug-resistance and migration ability of CD9⁺ cells. In summary, our data suggest CD9 is a potential new target for AML therapy and A2M controls stemness characteristics of CD9⁺ AML LSCs.

Date source

Three AML LSCs sequencing chips and one AML minimal disease residue (MDR) sequencing chip were sourced from the publicly available database. Microarray 1: (GSE24006) https://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-24006/?query=GSE24006; Microarray2:(GSE24395)https://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-24395/?query=GSE24395; Microarray 3: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3005290/; MRD: A group of Minimal Residual Disease was from https://insight.jci.org/articles/view/98561/sd/3.

Cell lines and leukemic cells from patients

The THP-1 and HL-60 AML cells line were obtained from our lab and cell lines were authenticated by short tandem repeat analysis. THP-1 was cultured in RPMI 1640 (Gibco) supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin. HL-60 was cultured in IMDM (Gibco) supplemented with 20% FBS and penicillin/streptomycin.

Primary AML cells were obtained from bone marrows of patients with AML with informed consent from all patients according to protocols approved by the Institutional Review Board of the Southwest Hospital, Army Medical University. All the patients’ information was in supplement table 1.

The primary AML cells were cultured in RPMI 1640 (Gibco) supplemented with 20% FBS, penicillin/streptomycin, and cytokines including IL-3, Flt-3 ligand, TPO and SCF, all of which were bought from Peprotech. The normal bone marrow samples were obtained from volunteers.

Antibodies, Cell Staining, and Sorting

All the antibodies for flow cytometry were purchased from BioLegend and BD Biosciences. For analyses of CD9 expression in THP-1 and HL-60, cells were stained with PE anti-human CD9 Antibody. For primary AML cells, cells were stained with FITC anti-human CD3/CD19 antibody, PerCP anti-human CD45 antibody, APC/Cyanine7 anti-human CD34 antibody, APC anti-human CD38 antibody and PE anti-human CD9 antibody. Briefly, THP-1 and primary AML cells were harvested and suspended with 50ul staining/washing buffer (PBS including 1% FBS), then stained with antibodies and incubated for 30 minutes at 4℃. Cells were washed with staining/washing buffer and suspended in buffer for flow cytometry or cell sorting.

Migration assay

The migration of THP-1 and primary AML cells was tested by using Falcon® Permeable Support for 24-well Plate with 8.0 µm Transparent PET Membrane (Corning). 2x10⁵ CD9⁺and CD9^- cells were suspended in 200μl RPMI 1640 medium (without FBS) and seeded in the upper chambers, respectively. 900μl medium with 20% FBS was added to bottom chamber of each well. After incubation for 6 hours, migrated cells were calculated [23].

Drug resistance assay

The drug resistances of THP-1 and primary AML cells were assessed using MTS assay. 5x10³ CD9⁺ and CD9^-THP-1 and primary AML cells were sorted and seeded in 96-well microtiter plates (NEST) with different concentrations of cytarabine (10, 100μg/ml) in 100μl medium [24]. After 24 hour incubation, 10μl MTS (Promega) was added to each well. After 2 hours’ incubation, the plate was measured at wavelength of 490nm with microplate reader (Thermo Fisher Scientific).

Cell proliferation assay

Sorted CD9⁺ and CD9^- THP-1 and primary AML cells were seeded in 96 well plates with 5x10³ cells/well. At the indicated time, 10μl MTS (Promega) was added to cells and then detected the absorbance at 490 nm after 2 hours using the microplate reader (Thermo Fisher Scientific). The medium without cells was used as a negative control [25].

Transplantation of AML cells into immunodeficient mice

The animal study was performed in accordance with the protocol approved by the Institutional Animal Care and Use Committee of Southwest Hospital, Third Military Medical University (TMMU). NOG mice at age of 6 to 8 weeks were used for xenogeneic transplantation assays. THP-1 cells were infected with lentivirus expressing luciferase according to the previous method[26]. Sorted CD9⁺ and CD9^- THP-1 cells were transplanted into NOG mice via tail vein injection. Tumor growth was monitored by bioluminescence imaging using In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer, USA) and Living Image Software for IVIS (Perkin Elmer).

Microarray analysis

Three pairs of sorted CD9⁺ and CD9^- primary AML cells (patient 6, patient 7, and patient 8) were investigated with the BGISEU-500 platform for gene expression. In brief, total RNA was extracted with TRIzol (Invitrogen) according to the manufacturer’s instructions from sorted CD9⁺ and CD9^- primary AML cells, respectively. Then all samples are submitted to the BGISEQ-500 platform.

Real time PCR

Total RNA was extracted from CD9⁺ and CD9^- THP-1 cells using RNAiso Plus (Takara), and then Single-stranded cDNA was synthesized with the PrimeScript RT Reagent Kit (Takara) according to the manufacturer’s instruction. Quantitative-PCR analysis was performed using SYBR premix Ex Taq (Takara). The sequence of the primers and the housekeeping gene GAPDH were all from Primer Bank (https://pga.mgh.harvard.edu/primerbank/).

Western blotting

Cells were washed by ice PBS and lysed with RIPA buffer added with protease and phosphatase inhibitor cocktail (Roche). Primary antibody for GAPDH (2118), A2M (4929), CD9 (9750) were purchased from Abcam and EGR1 (100899-T32) from Sino Biological.

Plasmids, Lentivirus construction, and Cell infection

The interference sequence targeting A2M is CCGGCCTAACATCTATGTACTGGATTAGTACTATCCAGTACATAGATGTTAGGTTTTTT and synthesized by Thermo Fisher Scientific. The annealing step was performed with the Annealing Buffer for DNA Oligos (BiYunTian) according to the manufacturer’s instruction after the primers were dissolved. The annealed A2M interference sequence was cloned into the PLKO.1 interference plasmid and detected by gene sequencing. The lentiviruses construction was completed by Chongqing Precision Biotech Co., Ltd. Cell infection was performed as previously described [26]. 10 MOI of lentiviruses supplemented with polybrene (8 ng/ml) was used to infect target cells.

A2M network with CD9 utilizing the GeneMANIA database

Datasets, including physical interactions, pathway, and genetic interactions, were collected from the public domain GeneMANIA database. The dataset relevant to A2M and CD9 network was produced from the GeneMANIA database (http://www.genemania.org).

Statistical analysis

All experiments were repeated at least in triplicate. Collected data were analyzed using GraphPad Prism 8.0 software (GraphPad Software, Inc., San Diego, CA) and estimated variation was taken into account for each group of data and is indicated as SEM or SD in each figure legend. Comparison between two groups was analyzed with unpaired Student’s t test (two tailed), and differences among more than two groups were determined by a one-way ANOVA followed by Newman-Keuls test. Difference with p < 0.05 was considered statistically significant.

1. CD9 is highly expressed in CD34 ⁺ CD38 ⁻ cell population of AML patients,almost not expressed in normal HSCs

To identify cell surface markers selectively expressed on AML LSCs, we surveyed three sets of AML LSCs sequencing chips data [11, 27–28]. Fifty-five commonly upregulated genes were detected by comparing the three datasets (Fig. 1A). MRD (Minimal Residual Disease) in AML patients refers to residual cancer cells after treatment, and it was reported as a powerful and independent prognostic factor for treatment outcome [29–38]. We asked whether the expression level of the fifty-five LSCs upregulated genes was also upregulated in the MRD microarray. By analysis of the MRD microarray data, we found that among these fifty-five genes, twenty-three genes were significantly upregulated in the MRD microarray, including eight cell surface proteins CD33, CD96, HCK, C3AR1, TYROBP, FCER1G, LPXN and CD9 (Fig. 1A, 1B, supplement table 2). Interestingly, CD96 has already been reported as an LSC-specific marker in human AML implying the reliability of our findings. Among these membrane proteins, CD9 was the most intensively upregulated gene,

We firstly analyzed the CD9 expression level in AML cell lines by flow cytometry. The results showed that CD9⁺ cells account for 63.3% in THP-1 and 9.12% in HL-60, respectively (Fig. 1C). Then, we examined CD9 expression in the bone marrow of AML patients and normal donors. The gating strategy for flow cytometry analysis was performed as described previously, we firstly gated away CD3 and CD19 positive T cells and B cells, then focused on CD45^low population, and analyzed CD34⁺CD38⁻ cells within CD45^low, then further investigated CD9 expression in CD3⁻CD19⁻CD45^lowCD34⁺CD38⁻ [10] (Fig. 1D). Our data revealed that the average percentage of CD9⁺ cells was 12.9%±5.857% in AML blasts. It has been shown that the AML LSCs mainly reside within the CD34⁺CD38⁻ fraction of leukemic cells. CD9⁺ cells account for 62.76%±9.668% in CD34⁺CD38⁻ cells (Fig. 1E), suggesting that CD9⁺ cells were enriched in AML LSCs. To determine whether CD9 expression could distinguish LSCs from normal HSCs, we examined CD9 expression in the bone marrow of normal donors. The results showed that CD9 expression was very low in normal bone marrow cells (1.7%±0.379%) and normal HSCs (0.9%±0.318%) (Fig. 1F). These data together demonstrate that the cell surface protein CD9 could be a promising marker for targeting AML LSCs.

2. CD9⁺ cells exhibited LSC characteristics

To investigate the biological function of CD9⁺ cells, we isolated CD9⁺ cells and CD9^- cells from THP-1 and AML patients by fluorescence-activated cell sorting. Cell proliferative assay showed that there was no significant difference in the proliferative capacity of CD9⁺ cells and CD9^- cells either from THP-1 cells or AML patients (Fig. 2A, 2B, p=0.9669, p=0.9005), which is consistent with previous reports that stem cells do not exhibit superior proliferation capacity in the normal condition [39-41]. To assess the ability of drug resistance, we treated the sorted cells with different doses of Ara-C (10μg/ml and 100μg/ml), which is a commonly used leukemia chemotherapy drug, and checked cell survival rate after 24 hours. The results showed that CD9⁺ cells were more resistant to Ara-C than CD9^- cells (Fig. 2C, 2D). Furthermore, the transwell migration assay showed CD9⁺ cells exhibit higher migration potential than CD9^- cells. Cell invasion assay results showed that CD9⁺ cells had stronger invasion and migration ability than CD9^- cells (Fig. 2E, 2F).

To study the function of CD9⁺ AML cells in vivo, THP-1 cells were stably infected with lentivirus expressing luciferase to facilitate subsequent observation of tumor growth in vivo. 1×10⁶ CD9⁺ cells and CD9^- cells from THP-1 were respectively injected into immunodeficiency mice via tail vein. Due to the severe development of tumors, mice were sacrificed on day 50 and the results showed that CD9⁺ cells exhibit superior proliferation capacity than CD9^- cells in vivo (Fig. 3A, 3B). The proportion of CD9⁺ cells in the bone marrow of mice were tested by flow cytometry，and the results showed that CD9⁺ cells injected mice bone marrow contained a large number of infiltrating CD9⁺ cells (50.9±10.26%). Unexpectedly, CD9^- cells injected mice bone marrow also contain CD9⁺ cells to varying degrees(21.02±5.96%) (Fig. 3C, 3D), which may explain why CD9^- mice can also form tumors. Previous studies have shown that cancer stem cells and tumor cells can be transformed into each other in tumor microenvironment [42-43]. In conclusion, CD9⁺ cells display LSC characteristics, drug resistance, increased capacity of migration and promoting cancer progression.

3. A2M is expressed in CD9⁺ cells at high levels

To investigate the molecular mechanisms involved in CD9⁺ LSC maintenance, we performed global gene expression profiles in CD9⁺ cells and CD9^- cells from three AML patients by cDNA microarray. The Venn diagram was used to analyze the differential genes that were up-regulated in these 3 gene sets, and we found 52 differential genes that were commonly up-regulated in the CD9+ population (Fig. 4A, 4B).

We further performed gene ontology analysis of the 52 genes, the top cluster was genes involved in the extracellular matrix organization, including A2M, SULF2, TGFB1, LRP1, MMP9, SERPINE1 and CRISPLD2 (Fig. 4C). We then confirmed the expression levels of these extracellular matrix-associated genes by real-time PCR in THP-1(Fig. 4D). We focus on A2M not only because it is expressed in CD9⁺ cells at high levels, but also because activation of A2M signals was reported to promote proliferation and survival of cancer cells [44]. We also confirmed the high expression of A2M protein in CD9⁺ cells of THP-1 and HL-60 by Western blotting (Fig. 4E).

4. A2M regulates CD9⁺ LSC maintenance

To further investigate the connection between CD9 and A2M, we used the GeneMANIA webserver to predict their interactions in the network using the parameters limited to physical interactions, genetic interactions, and pathways to score nodes and source organism Homo sapiens as additional parameters (Fig. 5A). From the Gene MANIA network, we found that A2M has networked with CD9. To test whether A2M regulates CD9 expression, we knocked down the expression of A2M in CD9⁺ cells from THP-1 by shRNA against A2M. The results showed that A2M knockdown significantly reduced the expression levels of CD9 and EGR1 (Fig. 5B). EGR1, as an important transcription factor, is a node in the network of A2M and CD9 (Fig. 5A). The results revealed that A2M possibly regulates CD9 expression by regulating its downstream protein EGR1. Functionally, even though knockdown of A2M had no effect on the proliferative of CD9⁺ cells (Fig.5C), but significantly increase the sensitivity of CD9⁺ cells to Ara-C treatment and attenuate CD9⁺ cells migration compared with control groups (Fig.5D, 5E). Therefore, we conclude that A2M is an upstream gene that regulates CD9 gene expression through EGR1 and controls AML LSCs characteristics (Fig. 5F).

Cancer stem cells (CSCs) drive tumor initiation, progression and metastasis. AML is a clonal malignant disorder derived from a small number of LSCs. LSCs could be the ultimate cellular target to cure human AML. Scientists are dedicated to searching specific LSCs markers, which could effectively distinguish between LSCs and normal HSC. Many molecules were reported to be differently expressed on AML LSCs, such as CD47, CD44, CD96, TIM3, CD99 and CD123 [5–7, 9–11], however, some of these markers are not specific for AML LSCs. For example, targeting CD123 antibody impairs cytokine signaling and is toxic to common myeloid precursors (CMPs) [9], and targeting CD44 antibody disrupts blast-niche interactions [6].

To find a more specific marker of AML LSCs, we analyzed three RNA-sequencing data of LSCs and an AML MRD microarray data. From which we chose CD9, the most intensively upregulated membrane molecule, as a candidate marker for AML LSCs, which has been reported to be involved in several types of CSCs, including pancreatic cancer stem cells, breast cancer stem cells, ovarian cancer stem cells, glioblastoma stem cells, LSCs in B-acute lymphoblastic leukemia [15, 20, 22, 45–46].

As a member of the tetraspanin superfamily, CD9 was first identified by Kersey et al as the human lymphohematopoietic progenitor cell surface antigen p24 using a monoclonal antibody that bound to acute lymphoblastic leukemia cells [47]. CD9 has been reported to be expressed in 40% of human AML samples and associated with clinical outcomes in AML[21]. In this study, we demonstrate that CD9 is highly expressed in the CD34⁺CD38⁻AML LSCs, and extremely low or no expression in normal HSCs, which could serve as a hopeful therapeutic target in AML. Nevertheless, the evaluation of targeting-CD9 therapy still requires further study.

Understanding the underlying mechanisms of CSCs maintenance also provides potential for patient care and improved prognosis. For example, Hedgehog (Hh), Notch and Wnt signaling exhibit significant crosstalk during embryogenesis. Inhibitors of Hh and Notch pathways have achieved considerable progress in early phase clinical trials [48]. To identify the mechanisms that regulate the characteristics of CD9⁺ LSCs, we performed RNA-sequencing of CD9⁺ and CD9⁻ cells from three AML patients. We verified A2M was involved in regulating stemness characteristics of CD9⁺ cells. Importantly, it has been reported that activated A2M signals promote proliferation and survival of cancer cells predominantly through cell surface GRP78 (CS-GRP78). Therefore, we believe that A2M signal play a crucial role in AML and the treatment of targeting-A2M signaling pathway will bring new hope to AML patients.

We demonstrated that CD9 was highly expressed in AML LSCs, but almost not expressed in normal HSCs, and thus could serve as a potential LSCs marker. CD9-positive cells possess CSCs characteristics, including drug-resistance, migration ability and promoting tumor progression. Importantly, we found that A2M signal play a crucial role in the stemness maintenance of CD9-positive cells in AML. Overall, our results found CD9 a new target for AML therapy.

LSCs: Leukemia stem cells; AML: Acute myelogenous leukemia; A2M: Alpha-2-macroglobulin; HSCs: Hematopoietic stem cells; CD9^-: CD9-negative; CD9+: CD9-positive; Minimal residual disease MRD: Minimal residual disease; CSCs: Cancer stem cells; CMPs: Common myeloid precursors.

Acknowledgements

None.

Authors’ contributions

Yongliang Liu, Guiqin Wang and Juanjuan Shan: Conception and design, collection and assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript;

Jiasi Zhang, Xue Chen, Gang Heng and Guiqin Wang: Acquisition of patient specimens, collection and assembly of data, final approval of manuscript;

Jun Chen and Yongchun Zhao: collection and assembly of data, final approval of manuscript;

Huailong Xu and Yuanli Ni: data analysis and interpretation, final approval of manuscript;

Jiatao Li, Yingzi Zhang and Limei Liu: Data analysis and interpretation, final approval of manuscript;

Cheng Qian: Conception and design, data analysis and interpretation, financial support, final approval of manuscript;

Funding

This work was supported by National Key Research and Development Program (2016YFC1303405), National Science Foundation of Chongqing (cstc2016shms-ztzx10006), National Natural Science Foundation of China (No. 81572464，81602590), Fundamental Research Funds for the Central Universities (No. 1061120206, 2019CDYGZD008, 2019CDYGYB012).

Availability of data and materials

For data requests, please contact the authors.

Ethics approval and consent to participate

This study was approved by the Ethical/Scientific Committee of Southwest Hospital.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Yamamoto JF, Goodman MT. Patterns of leukemia incidence in the United States by subtype and demographic characteristics, 1997-2002. Cancer causes & control : CCC. 2008;19:379-390.
Döhner H, Weisdorf DJ, Bloomfield CD. Acute Myeloid Leukemia. The New England journal of medicine. 2015;373:1136-1152.
Ding Y, Gao H, Zhang Q. The biomarkers of leukemia stem cells in acute myeloid leukemia. Stem cell investigation. 2017;4:19.
Mardiros A, Forman SJ, Budde LE. T cells expressing CD123 chimeric antigen receptors for treatment of acute myeloid leukemia. Current opinion in hematology. 2015;22:484-488.
Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD, Jr., et al. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell. 2009;138:286-299.
Jin L, Hope KJ, Zhai Q, Smadja-Joffe F, Dick JE. Targeting of CD44 eradicates human acute myeloid leukemic stem cells. Nature medicine. 2006;12:1167-1174.
Hosen N, Park CY, Tatsumi N, Oji Y, Sugiyama H, Gramatzki M, et al. CD96 is a leukemic stem cell-specific marker in human acute myeloid leukemia. Proceedings of the National Academy of Sciences of the United States of America. 2007;104:11008-11013.
Mardiros A, Dos Santos C, McDonald T, Brown CE, Wang X, Budde LE, et al. T cells expressing CD123-specific chimeric antigen receptors exhibit specific cytolytic effector functions and antitumor effects against human acute myeloid leukemia. Blood. 2013;122:3138-3148.
Jin L, Lee EM, Ramshaw HS, Busfield SJ, Peoppl AG, Wilkinson L, et al. Monoclonal antibody-mediated targeting of CD123, IL-3 receptor alpha chain, eliminates human acute myeloid leukemic stem cells. Cell stem cell. 2009;5:31-42.
Chung SS, Eng WS, Hu W, Khalaj M, Garrett-Bakelman FE, Tavakkoli M, et al. CD99 is a therapeutic target on disease stem cells in myeloid malignancies. Science translational medicine. 2017;9.
Kikushige Y, Shima T, Takayanagi S, Urata S, Miyamoto T, Iwasaki H, et al. TIM-3 is a promising target to selectively kill acute myeloid leukemia stem cells. Cell stem cell. 2010;7:708-717.
Li C, Chen X, Yu X, Zhu Y, Ma C, Xia R, et al. Tim-3 is highly expressed in T cells in acute myeloid leukemia and associated with clinicopathological prognostic stratification. International journal of clinical and experimental pathology. 2014;7:6880-6888.
Herr MJ, Longhurst CM, Baker B, Homayouni R, Speich HE, Kotha J, et al. Tetraspanin CD9 modulates human lymphoma cellular proliferation via histone deacetylase activity. Biochemical and biophysical research communications. 2014;447:616-620.
Reyes R, Cardeñes B, Machado-Pineda Y, Cabañas C. Tetraspanin CD9: A Key Regulator of Cell Adhesion in the Immune System. Frontiers in immunology. 2018;9:863.
Podergajs N, Motaln H, Rajčević U, Verbovšek U, Koršič M, Obad N, et al. Transmembrane protein CD9 is glioblastoma biomarker, relevant for maintenance of glioblastoma stem cells. Oncotarget. 2016;7:593-609.
Levy S, Shoham T. The tetraspanin web modulates immune-signalling complexes. Nature reviews. Immunology. 2005;5:136-148.
Leung KT, Chan KY, Ng PC, Lau TK, Chiu WM, Tsang KS, et al. The tetraspanin CD9 regulates migration, adhesion, and homing of human cord blood CD34+ hematopoietic stem and progenitor cells. Blood. 2011;117:1840-1850.
Hemler ME. Specific tetraspanin functions. The Journal of cell biology. 2001;155:1103-1107.
Hemler ME. Tetraspanin proteins promote multiple cancer stages. Nature reviews. Cancer. 2014;14:49-60.
Wang VM, Ferreira RMM, Almagro J. CD9 identifies pancreatic cancer stem cells and modulates glutamine metabolism to fuel tumour growth. 2019;21:1425-1435.
Touzet L, Dumezy F, Roumier C, Berthon C, Bories C, Quesnel B, et al. CD9 in acute myeloid leukemia: Prognostic role and usefulness to target leukemic stem cells. 2019;8:1279-1288.
Nishida H, Yamazaki H, Yamada T, Iwata S, Dang NH, Inukai T, et al. CD9 correlates with cancer stem cell potentials in human B-acute lymphoblastic leukemia cells. Biochemical and biophysical research communications. 2009;382:57-62.
Li H, Guo L, Jie S, Liu W, Zhu J, Du W, et al. Berberine inhibits SDF-1-induced AML cells and leukemic stem cells migration via regulation of SDF-1 level in bone marrow stromal cells. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie. 2008;62:573-578.
Harrison JS, Wang X, Studzinski GP. The role of VDR and BIM in potentiation of cytarabine-induced cell death in human AML blasts. Oncotarget. 2016;7:36447-36460.
Wobus M, Bornhäuser M, Jacobi A, Kräter M, Otto O, Ortlepp C, et al. Association of the EGF-TM7 receptor CD97 expression with FLT3-ITD in acute myeloid leukemia. Oncotarget. 2015;6:38804-38815.
Shan J, Shen J, Wu M, Zhou H, Feng J, Yao C, et al. Tcf7l1 Acts as a Suppressor for the Self-Renewal of Liver Cancer Stem Cells and Is Regulated by IGF/MEK/ERK Signaling Independent of β-Catenin. 2019;37:1389-1400.
Gentles AJ, Plevritis SK, Majeti R, Alizadeh AA. Association of a leukemic stem cell gene expression signature with clinical outcomes in acute myeloid leukemia. Jama. 2010;304:2706-2715.
Saito Y, Kitamura H, Hijikata A, Tomizawa-Murasawa M, Tanaka S, Takagi S, et al. Identification of therapeutic targets for quiescent, chemotherapy-resistant human leukemia stem cells. Science translational medicine. 2010;2:17ra19.
Ivey A, Hills RK, Simpson MA, Jovanovic JV, Gilkes A, Grech A, et al. Assessment of Minimal Residual Disease in Standard-Risk AML. The New England journal of medicine. 2016;374:422-433.
Krönke J, Schlenk RF, Jensen KO, Tschürtz F, Corbacioglu A, Gaidzik VI, et al. Monitoring of minimal residual disease in NPM1-mutated acute myeloid leukemia: a study from the German-Austrian acute myeloid leukemia study group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011;29:2709-2716.
Inaba H, Coustan-Smith E, Cao X, Pounds SB, Shurtleff SA, Wang KY, et al. Comparative analysis of different approaches to measure treatment response in acute myeloid leukemia. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012;30:3625-3632.
Buccisano F, Maurillo L, Del Principe MI, Del Poeta G, Sconocchia G, Lo-Coco F, et al. Prognostic and therapeutic implications of minimal residual disease detection in acute myeloid leukemia. Blood. 2012;119:332-341.
Terwijn M, van Putten WL, Kelder A, van der Velden VH, Brooimans RA, Pabst T, et al. High prognostic impact of flow cytometric minimal residual disease detection in acute myeloid leukemia: data from the HOVON/SAKK AML 42A study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2013;31:3889-3897.
Walter RB, Buckley SA, Pagel JM, Wood BL, Storer BE, Sandmaier BM, et al. Significance of minimal residual disease before myeloablative allogeneic hematopoietic cell transplantation for AML in first and second complete remission. Blood. 2013;122:1813-1821.
Othus M, Estey E, Gale RP. Assessment of Minimal Residual Disease in Standard-Risk AML. The New England journal of medicine. 2016;375:e9.
Taub JW, Berman JN, Hitzler JK, Sorrell AD, Lacayo NJ, Mast K, et al. Improved outcomes for myeloid leukemia of Down syndrome: a report from the Children's Oncology Group AAML0431 trial. Blood. 2017;129:3304-3313.
Hourigan CS, Gale RP, Gormley NJ, Ossenkoppele GJ, Walter RB. Measurable residual disease testing in acute myeloid leukaemia. Leukemia. 2017;31:1482-1490.
Buldini B, Rizzati F, Masetti R, Fagioli F, Menna G, Micalizzi C, et al. Prognostic significance of flow-cytometry evaluation of minimal residual disease in children with acute myeloid leukaemia treated according to the AIEOP-AML 2002/01 study protocol. British journal of haematology. 2017;177:116-126.
Fuchs E, Horsley V. Ferreting out stem cells from their niches. Nature cell biology. 2011;13:513-518.
Medema JP, Vermeulen L. Microenvironmental regulation of stem cells in intestinal homeostasis and cancer. Nature. 2011;474:318-326.
Simons BD, Clevers H. Strategies for homeostatic stem cell self-renewal in adult tissues. Cell. 2011;145:851-862.
Cabrera MC, Hollingsworth RE, Hurt EM. Cancer stem cell plasticity and tumor hierarchy. World journal of stem cells. 2015;7:27-36.
Gupta PB, Pastushenko I, Skibinski A, Blanpain C, Kuperwasser C. Phenotypic Plasticity: Driver of Cancer Initiation, Progression, and Therapy Resistance. Cell stem cell. 2019;24:65-78.
Gopal U, Gonzalez-Gronow M, Pizzo SV. Activated α2-Macroglobulin Regulates Transcriptional Activation of c-MYC Target Genes through Cell Surface GRP78 Protein. The Journal of biological chemistry. 2016;291:10904-10915.
Nagare RP, Sneha S, Krishnapriya S, Ramachandran B, Murhekar K, Vasudevan S, et al. ALDH1A1+ ovarian cancer stem cells co-expressing surface markers CD24, EPHA1 and CD9 form tumours in vivo. Experimental cell research. 2020;392:112009.
Ullah M, Akbar A, Thakor AS. An emerging role of CD9 in stemness and chemoresistance. Oncotarget. 2019;10:4000-4001.
Kersey JH, LeBien TW, Abramson CS, Newman R, Sutherland R, Greaves M. P-24: a human leukemia-associated and lymphohemopoietic progenitor cell surface structure identified with monoclonal antibody. The Journal of experimental medicine. 1981;153:726-731.
Saygin C, Matei D, Majeti R, Reizes O, Lathia JD. Targeting Cancer Stemness in the Clinic: From Hype to Hope. Cell stem cell. 2019;24:25-40.

SupplementaryMaterial.xlsx

Download PDF

Journal Publication

published 25 Jan, 2021

Read the published version in Stem Cell Research & Therapy →

Review #2 received at journal
23 Aug, 2020
Editorial decision: Major Revision
23 Aug, 2020
Reviewer #3 agreed at journal
18 Aug, 2020
Review #1 received at journal
16 Aug, 2020
Reviewer #1 agreed at journal
14 Aug, 2020
Reviewer #2 agreed at journal
14 Aug, 2020
Reviewers invited by journal
11 Aug, 2020
Submission checks completed at journal
10 Aug, 2020
Editor assigned by journal
10 Aug, 2020
Editor invited by journal
09 Aug, 2020
First submitted to journal
07 Aug, 2020

You are reading this older preprint version

Read the latest preprint version →

CD9 Defines Acute Myeloid Leukemia Stem Cells and is Regulated by Alpha-2-Macroglobulin

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1