Animals
The dairy goat is one of the most economically useful animals widely distributed in the Shaanxi Province of China. In the present study, we used dairy goats of different ages to represent three major developmental stages of the testes: 3 months of age (juvenile), 6 months of age (puberty), and 24 months of age (adult). A total of nine dairy goats were used in this experiment. After anaesthetization of the dairy goats by intramuscular administration of pentobarbital sodium, samples of the testes were collected immediately and fixed for further analysis.
Chemical Reagents
The following antibodies and reagents were used: Oil red O solution (Sigma, O0625), rabbit 3β-HSD antibody (ABclonal, A19266), rabbit ATG 7 antibody (ABclonal, A0691), Alexa Fluor 488 conjugated rabbit anti-LC3 antibody (CST, 13082), rabbit anti-LC3A/B (CST, 12741), rabbit anti-SQSTM1/p62 (CST, 5114), rabbit anti-PINK1 antibody (ABclonal, A11435), rabbit anti-Parkin antibody (ABclonal, A0968), rabbit anti-β-actin (Bioworld, AP0060), BODIPY 493/503 (Invitrogen, D3922), Anti-rabbit secondary antibody (Alexa Fluor® 594 Conjugate) and Anti-rabbit secondary antibody (Alexa Fluor® 488 Conjugate) were purchased from Cell Signaling Technology. Goat Testosterone Elisa Kit (Shanghai Enzyme Link Biotechnology Co., Ltd. China). Goat Luteinizing Hormone (LH) Elisa Kit (Shanghai Enzyme Link Biotechnology Co., Ltd. China). DAB kit (Boster Bio-Technology, Wuhan, China).
Light microscopy
The dairy goat testes samples were fixed in 10% neutral buffered formalin (v/v) overnight, and then the samples were embedded in paraffin and sectioned serially (5 µm). The sample sections were stained with hematoxylin and eosin for observation by light microscopy (Olympus DP73, Tokyo, Japan).
Oil red O staining
Tissue sections were collected from frozen samples of the testes of dairy goats. The frozen sections were washed with phosphate-buffered saline (PBS), fixed with 4% formaldehyde for 10 min, and stained with fresh Oil red O solution (Oil O-saturated solution in isopropanol:water, 3:2) for 15 min. Then, the sections were washed with 60% isopropanol (v/v) to remove background staining. Finally, stained frozen sections of the testes were imaged using light microscopy (Olympus DP73, Tokyo, Japan).
Immunohistochemistry (IHC)
The tissue sections of the testes were deparaffinized in xylene and rehydrated in a graded series of alcohol. After washing briefly in PBS solution, the sections were placed in 3% hydrogen peroxide for 10 min to eliminate endogenous peroxidase activity. The sections were then boiled for 15 min in sodium citrate buffer for antigen retrieval. The sections were chilled at room temperature and then blocked with 5% bovine serum albumin. The sections were incubated with primary antibodies (3β-HSD antibody or ATG7 antibody) overnight at 4°C. After washing with PBS three times for 5 min each, the sections were incubated with the secondary antibody diluted at 1:200 for 1 h at room temperature. The sections were washed thrice with PBS, and the positive reaction was visualized using a DAB kit. The sections incubated with PBS alone served as the negative control.
Immunofluorescence staining
Sections of the frozen testes of dairy goats were fixed and then incubated overnight at 4°C with Alexa Fluor 488-conjugated rabbit anti-LC3 antibody. After washing with PBS three times for 5 min each, the testes sections were stained with DAPI to highlight the nuclei. Stained sections were observed using fluorescent microscopy. For the immunofluorescence double-labeling, the frozen testes sections were incubated overnight at 4°C with rabbit anti-LC3A/B antibody. The sections were then incubated with the corresponding fluorescent secondary antibody for 1 h at 37°C. After washing thrice with PBS, the sections were stained with BODIPY 493/503 for 15 min. The stained sections were observed under a confocal microscope.
Transmission electron microscopy (TEM)
The testes tissue samples from dairy goats were fixed in 2.5% (v/v) glutaraldehyde in PBS (4°C, pH 7.4) for 24 h. After rinsing in PBS, the samples were fixed in 1% (w/v) osmium tetroxide for 1 h at 37°C and washed again with PBS. Subsequently, the testes samples were dehydrated in ascending concentrations of alcohol, infiltrated with a propylene oxide-Araldite mixture (50% propylene oxide: Araldite), and then embedded in Araldite. Ultrathin sections (50 nm) were first stained with uranyl acetate, and then stained with lead citrate. The electron micrographs were obtained using a transmission electron microscope (Hitachi H-7650, Japan).
Hormone assay
After the dairy goats were anesthetized, blood was collected via jugular vein puncture. Serum was isolated by centrifugation at 1200 × g for 20 min and stored at -80°C until analysis. The concentrations of testosterone and LH in the serum were determined in duplicate using an enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer’s instructions.
Quantitative polymerase chain reactions analyses (qPCR)
Total RNA was extracted from the testes samples of the dairy goats using the Trizol reagent according to the manufacturer’s instructions. After the RNA concentration was measured, cDNA was synthesized using the Prime Script reverse transcription reagent kit (Takara Bio Inc.). qPCR was performed using a Light Cycler detection system (Roche), and the samples for qPCR were prepared using SYBR green super mix (Bio-Rad Laboratories). All values were normalized to those of β-actin to balance potential irregularities in the RNA concentration. The 2−ΔΔCt method was used to calculate fold changes in gene expression (Table 1).
Table 1
The qPCR primer sequences used in the present study.
Gene Name | Primers |
Forward Reverse |
StAR | GGAAGGGATGCCAGTCACAAGATG | CTGCGAGAGGACCTGATTGATGATG |
CYP11A1 | CAGGCTGAATGTTTGGTTTGGAAGAAG | AGGAGGAGGAGAGGAGGAAGTAGG |
3β-HSD | CTATGTTGGCAATGTGGC | ATCTCGCTGAGCTTTCTTAT |
17β1-HSD | GATCCCTGGGTCAAGTAGGAAATGC | AGGTGCGTATATGTGTGCTCAGTTG |
β-actin | CTGAGCGCAAGTACTCCGTGT | GCATTTGCGGTGGACGAT |
Western blotting
The testes samples were harvested from the goats at different development stages and homogenized in cold RIPA-like buffer (Sigma) and supplemented with a protein inhibitor on ice. The homogenates were centrifuged at 12,000 × g for 15 min, and the protein concentrations were determined using a protein assay from Bio-Rad Laboratories. The lysates containing equal amounts of proteins were separated on a 10% gradient SDS-PAGE gel and transferred onto a PVDF membrane. Nonspecific binding was blocked using 5% nonfat milk in Tris-buffered saline with Tween 20 (TBST) for 1 h at room temperature. Next, the membranes were incubated overnight at 4°C with primary antibodies and β-actin antibody. After washing with TBST three times for 5 min each, the membranes were incubated with peroxidase-linked secondary antibody for 1 h at room temperature. Protein bands were scanned using an ECL detection system (Vazyme Biotech, China) and immunoreactive bands were quantified using Quantity One software (Bio-Rad Laboratories).
Statistical analysis
All data are presented as the means ± SEM. The statistical significance of the difference between the mean values for the different groups was measured by ANOVA with the Multiple Comparison Test using GraphPad Prism 7.0 software. All the quantification data were repeated triply and the data were considered significant when the p-value was less than 0.05 (*) or 0.01 (**).