2.1. Ethics and general information
Specialists recruited all 198 participants either at the Department of General Surgery and Oncology of the Warmia and Mazury University Hospital in Olsztyn or at the Clinical Department of Trauma-Orthopedic Surgery and Spine Surgery of the Provincial Specialist Hospital in Olsztyn in 2014-2020. All participants were treated according to the Patient Right Protection Act of our institution and international guidelines, and the Local Bioethics Committee approved our study (13/2016; 51/2019).
Peripheral blood samples (5-10 ml) was collected into a tube containing EDTA, were collected from each patient by the medical staff, and all biological material was immediately transported to the laboratory and directly used in analysis or stored at -80°C.
2.2. Controls and AP group characteristic
Our study included 198 individuals (all Caucasian): 107 patients diagnosed with AP (19 females and 88 males; mean age ranging from 28 to 76 years; average 52.4) and 91 healthy people (25 females and 66 males; mean age ranging from 23 to 68 years; average 44.2). This is therefore a cross-sectional study.
Patients were admitted to the hospital 8-36 hours after the onset of AP symptoms (pain, vomiting, emetic reflex). Comorbidity of chronic circulatory system, liver, kidney or lung diseases caused exclusions from the study. Blood samples were collected from the forearm vein for the panel of biochemical tests twice – upon arrival at the hospital and 48 hours after admission. Within 2 days, each patient had computed tomography (CT) with contrast performed to detect fluid collections, the extent of inflammation or necrotic changes. APACHE-II (Acute Physiology And Chronic Health Evaluation II) scores were calculated using data from the first 24 h after admission to assess patients’ condition. Predicting acute pancreatitis severity and potential complications were based on imaging scales performed 3-4 days after the onset of symptoms, then after 10-12 days treatment.
For AP group, primarily patients with alcohol-related acute pancreatitis were selected for the study. 75% of AP cases met the DSM IV criteria for alcohol dependence, and 25% - incidental cause of inflammation. Both groups presented no inflammatory disease or other infection symptoms, no urogenital tract or kidney failure. This was confirmed by laboratory tests, and all required data was collected from their medical records and/or a filled-in questionnaire. The control group included individuals after control visit at hospital, and volunteers. Both groups were matched in age, and gender ratio. Table 1 presents the characteristics of both groups.
2.3. Polymorphism rs211105 in TPH1 gene in healthy and AP patients
DNA was isolated from peripheral blood using GeneJET™ Whole Blood Genomic DNA Purification Mini Kit (Thermo Scientific, Waltham, USA) according to the manufacturer’s instructions. Polymorphism rs211105 was assessed by polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) according to the method described by Shiotani et al. [21] with own modification. Primers for PCR reaction had the following sequence:
TPH1HAF forward primer: caaaagcagaataaagatgcaca and
TPH1HAR reverse primer: acctacagggtgagggaagg.
The program in a thermocycler consisted of and initial denaturation at 94°C for 3 min, a proper denaturation at 94°C for 30 s, attaching the primers at a temperature of 61°C for 30 s, synthesis at 72°C for 30 s, and final synthesis at 72°C for 5 min. The number of cycles was 40, after which cooling was performed at 4°C. There was 25 μl of the mixture of DreamTaq™ Green Master Mix (Thermo Scientific, Waltham, USA), specific primers, the DNA matrix and molecularly pure water (Sigma-Aldrich, Saint Louise, USA). The yield and specificity of PCR products were evaluated after electrophoresis in 1.5% agarose gel (Promega, Madison, USA) and stained with GelGreen (Biotium, Fremont, USA). Next, FastDigest® BsuRI (HaeIII) (Thermo Scientific, Waltham, USA) enzyme was added to the TPH1 rs211105 PCR products and then digested according to manufacturer’s instruction. For genotyping, a 2.5% agarose gel was used (Figure 1). To confirm proper genotyping, 30 randomly chosen samples was genotyped one more time after proper genotyping. PCR-RFLP products were: TT (324 bp), GG (75, 249 bp), and GT (324, 249, 75 bp).
2.4. Tryptophan hydroxylase 1 concentration
TPH1 concentration has been determined in plasma using Human Tryptophan 5-hydroxylase 1 ELISA kit according to the manufacturer’s instruction (Wuhan EIAab Science Co., China). The analysis was performed in duplicate at 37°C with gentle shaking (250 rpm) in a microplate incubator (SkyLine ELMI Shaker DTS-4, Riga, Lithuania).
In brief, TPH1 content was measured in the following order: 100 µL of Samples, Blank, and Standards in range of concentration 0.312 – 20 ng/mL were added into microtiter strips and incubated for 2 hours. After removal of the liquids, 100 µL of Detection reagent A working solution was added. Incubation was carried out for 1 hour, after that the microplate was rinsed three times with Wash Buffer, and 100 µl of the Detection reagent B working solution was added. After a 1-hour incubation, rinsing the microplate with Wash Buff-er was performed as previously, and 100 µL of Substrate Solution was added to each well. After a 15-minute incubation, 50 µL of Stop Solution was pipetted to the microplate. The absorbance was measured at a wavelength of λ= 450 nm using an ELISA reader (BiogenetAsys UVM 340, Cambridge, UK).
2.5. Serotonin concentration
The analysis was performed in duplicate using the Serotonin ELISA kit according to the manufacturer’s instruction (LDN, Labor Diagnostika NORD, Nordhorn, Germany), and described before by Cieślińska et al. [30]. All steps of the ELISA were carried out at RT (room temperature) with gentle shaking (250 rpm) in microplate incubator (SkyLine ELMI Shaker DTS-4, Riga, Lithuania). Samples were acylated before analysis as follows: 25 µL of serum, standards or controls was mixed with 500 µL of acylation buffer and 25 µL of acylation reagent provided with the kit. The mixtures were incubated for 15 minutes at RT. Serotonin content was measured as follows: a standard curve in concentration 10.2 – 2500 ng/mL, controls and serum samples were pipetted into serotonin microtiter strips. Then, 100 µl of the serotonin-specific antiserum preparation was added into all wells and incubation was carried out for 30 minutes. Plate was washed three times with Wash Buffer and 100 µl of the conjugate was added. After 15 minutes of incubation, 100 µL of substrate was pipetted. A 15-minute incubation was repeated and 100 µL of stop solution was added. The absorbance was measured at a wavelength of λ= 450 nm using an ELISA reader (BiogenetAsys UVM 340, Cambridge, UK).
2.6. Statistical analysis
The frequency distribution of common risk factors for AP are presented as the mean. The genotype distribution among subjects was analysed for Hardy-Weinberg equilibrium (HWE) using the chi-square test, and genotype and SNP allele frequencies were compared in AP patients and control groups by Fisher’s test. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using logistic regression analysis and used to compare both allele frequencies in controls and AP patients, and allele frequencies between females and males. The risk of AP development was estimated via wild-type genotype and wild/mutant versus the mutant-type genotypes. Serotonin and tryptophan hydroxylase 1 concentration results were used to determine the distribution of variables, and are presented as a mean ± standard error. The mean values in Control and AP groups were compared using ANOVA and Student’s t-test. One-way analysis of variance was performed for multiple comparisons between groups, and Tukey’s honestly significant difference test was used to conduct post-hoc analysis. Spearman’s rank correlation coefficient analysis was used to estimate the relationship between analysed parameters. Statistical analysis was calculated using Statistica 13.1 (TIBCO Software Inc., Paolo Alto, CA, USA) and GraphPad Prism 6 software (GraphPad Software Inc., San Diego, CA, USA), with ≤ 0.01 P-value considered statistically significant.