All methods performed in this manuscript were in accordance with all policies of the University of Minnesota Institute of Animal Care Use Committee (IACUC), which approved the use and housing of these animals according to accepted principles of laboratory animal care (National Research Council 2003).
Mice
The Neurog1tm1And/J mouse strain was used (26, 27) (Jackson Laboratory, Stock No. 017306) in which the coding exon for Neurog1 was replaced with a green fluorescent protein (GFP) cassette fused to a PGK-neo cassette successfully abolishing gene function in Neurog1-/- null mice (26-28). Expression of the GFP mRNA was reported to mirror Neurog1 endogenous gene function which confirmed the specificity of the transgene knock in. However, GFP protein expression was undetectable indicating that the GFP transcript generated in these mice results in a nonfunctional GFP protein (26). Mice were housed in a specific pathogen free (SPF), Research Animal Resource (RAR) and American Association for Accreditation of Laboratory Animal Care, (AAALAC) approved facility, and plastic cages that were steam cleaned and autoclaved 3 times per week. The mouse colony was maintained by crossing Neurog1+/+ wildtype mice with Neurog1+/- heterozygous mice. Experimental mice were generated through heterozygous matings (Neurog1+/- X Neurog1+/-), which produced the following combinations of genotype: Neurog1+/+ wild-type, Neurog1+/- heterozygous, Neurog1-/- null mice. Neurog1-/- null mice die 24 hours after birth due to their inability to suckle, and were only generated for blastocyst complementation or embryonic harvest. Toe clips were collected at one week of age, which were subsequently hydrolyzed for genotyping analysis. Genotyping was performed by Polymerase Chain Reaction (PCR) using the Jackson Laboratory’s validated genotyping protocol: https://www.jax.org/Protocol?stockNumber=017306&protocolID=23926
Genotyping was performed with the following primers: WT Forward (ACCACTAGGCCTTTGTAAGG), Mutant Forward (ATAGACCGAGGGCAGCTTCA), and a Common Reverse primer (CGCTTCCTCGTGCTTTACGGTAT). Genotyping was run in two separate reactions: (1) WT Forward, a sequence which detects endogenous Neurog1 protein, and the Common primer and (2) the Mutant Forward, which is a sequence in the neomycin cassette, and the Common primer. This reaction yields a 198-bp wild type band and a 500-bp mutant band. Wild type animals will have only one wild type band, heterozygotes will have both wild type and mutant bands, and homozygous nulls will only have a mutant band (Supplemental Fig. 1).
Blastocyst Complementation
Mouse x mouse blastocyst complementation was performed by injecting membrane bound GFP-labeled mouse iPSCs into Neurog1-deficient blastocysts. The derivation of the 3F10 iPSC line used was previously described in detail by Greder and colleagues (29). Briefly, the iPSCs were derived from Oct4-MerCreMer mTmG mice. These mice are from a cross between Oct4-MerCreMer mice carrying a tamoxifen-inducible Cre knock-in transgene upstream of the 3’ UTR of Oct4 (Jackson Laboratory, Stock No: 016829) and a homozygous tdTomato/EGFP reporter mouse strain (mTmG) (Jackson Laboratory, Stock No. 007576). iPSCs were generated according to previous reprogramming protocols (30, 31) and resulting pluripotent iPSCs were cultured with tamoxifen diluted in miPSC growth medium to 100 nM. This strategy results in all donor iPSCs being irreversibly labeled with membrane bound EGFP (Supplemental Fig. 2). Injected blastocysts were transferred to pseudopregnant female surrogates, where they were allowed to develop until the time of natural birth. To produce mutant blastocysts an in vitro approach was used. To do this, the egg donors (Neurog1+/- heterozygous female mice) were superovulated (32) at 3-4 weeks of age, by giving CARD HyperOva® (Cosmo Bio, Cat. No. KYD-010-EX-X5) 0.1 ml/mouse, intraperitoneally (i.p.), at 17:30 pm (mouse room light:dark cycle: 6:00 – 20:00), followed by Human Chorionic Gonadotropin (HCG) (Sigma-Aldrich Cat. No. C 1063), 5 insulin units (IU)/mouse 47 - 48 hours later. Fresh sperm from a Neurog1 heterozygous (+/-) male was used for IVF. Fertilized eggs were cultured in home-made modified Human Tubal Fluid (mHTF, a.k.a. high calcium HTF) medium until the blastocysts were formed in ~ 72 hours after IVF and ready for microinjection of iPSCs. Each blastocyst was injected with 10 - 15 iPSCs. After blastocyst injection, mouse blastocysts were transferred into the uteri of pseudopregnant surrogate mice. This entire process was performed on three separate occasions. Variability is expected with embryological development and some of the surrogate dams resorbed all the developing embryos. However, we obtained two viable litters and 13 P0 pups were obtained: 2 Neurog1+/+ wild type animals, 9 Neurog1+/- heterozygote animals, and 2 Neurog1-/- homozygote null animals. Of these, one of the wild type samples was highly chimeric, three of the heterozygotes were complemented (30%), and none of the homozygotes exhibited any stem cell derived chimerism.
Inner ear harvesting from the embryo, cyrosectioning, and immunohistochemistry
For tissue harvesting, P1 mice were euthanized using C02, according to RAR guidelines, followed by decapitation. Heads were bisected with the intention of using one inner ear for cryosectioning and immunohistochemistry (IHC) and the other processed for imaging using scanning Thin Sheet Laser Image Microscope (sTSLIM). Bisected heads were fixed overnight in 4% paraformaldehyde (PFA) in phosphate buffered saline (PBS), and were rinsed with PBS twice for fifteen minutes each before undergoing decalcification in 10% ethylenediaminetetraacetic acid (EDTA) for three days. Inner ears to be analyzed by cryosectioning and IHC were cryoprotected through overnight incubations in ascending concentrations of sucrose up to 30%, and embedded in tissue freezing medium (TFM) (General Data, Cat#: TFM-5) and snap frozen on dry ice. Bisected heads containing the P0 inner ears were sectioned on a cryostat at a thickness of 16mm and directly mounted to slides. The entire ear was collected, starting with sections from the cochlea, through the macular organs, and through the cristae and semicircular canals. Slides were allowed to dry on the slide warmer for a minimum of one hour prior to beginning staining or storing at -20°C. Sectioned tissue was always stained within three days of sectioning. If previously frozen, tissue was rewarmed to room temp by placing on the slide warmer for a minimum of a half hour. Prior to performing immunohistochemistry, epitopes were exposed by performing antigen retrieval. Briefly, slides were placed in Coplin jars filled with boiling sodium citrate buffer with Tween® 20 (Sigma-Aldrich Cat# P9416) (pH adjusted to 6.0 with 1N hydrogen chloride (HCl)) and incubated in a steamer for 20 minutes. Slides were allowed to cool to room temperature, for at least an hour, before continuing the staining protocol. After antigen retrieval, the slides were dried and the sections were outlined with a hydrophobic barrier pen (SuperHT Pap Pen, Polysciences Cat# 24230-1). Tissue was rinsed twice (ten minutes each rinse) with PBS and rinsed twice (fifteen minutes each rinse) in PBS with 0.1% Triton™ X-100 (Sigma-Aldrich, X100, Cat# 9002-93-1) (PBST). Non-specific binding was blocked against using 10% normal horse serum (ThermoFisher, Cat# 16050122) in 0.1% PBST for one hour at room temperature. Primary antibodies, diluted in the blocking solution, were applied and allowed to incubate in the 4°C cold room overnight. All antibodies are listed in the below table. The following day, slides was rinsed with four 15-minute washes in 0.1% PBST, sections were incubated in secondary antibodies, diluted in blocking solution, for two hours at room temperature. The tissue was then rinsed in 0.1% PBST with two ten-minute washes, and counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific, Cat# D1306) at a concentration of 1:5000 for five minutes. Lastly, tissue was rinsed for ten minutes in PBS, and coverslips were mounted to the slide after applying mounting medium with anti-fade agent (Electron Microscopy Services, Cat# 17985-11). Slides were sealed using with CoverGripTM Coverslip Sealant (Thermo Fischer Scientific, Cat# NC0154994).
1° Antibodies
Antibody
|
Vendor
|
Cat#
|
Dilution
|
rabbit polyclonal a-MYO6
|
Proteus Biosciences Inc.
|
25-6791
|
1:500
|
chicken a-GFP
|
Abcam Inc.
|
ab13970
|
1:1000
|
mouse monoclonal a-Tuj1
|
Biolegend
|
MMS-435P
|
1:1000
|
2° Antibodies
Antibody
|
Vendor
|
Cat#
|
Dilution
|
488 donkey a-chicken
|
Jackson ImmunoResearch Alexa Fluor
|
703-545-155
|
1:1000
|
555 donkey a-rabbit
|
Invitrogen Alexa Fluor
|
Ab150062
|
1:1000
|
647 donkey a-mouse
|
Invitrogen Alexa Fluor
|
A-31571
|
1:1000
|
Microscopy and Image processing.
All immunohistochemical imaging was performed on a Leica inverted light microscope. Images were exported as raw Leica Image File Format (LIF) files and processed in FIJI (Fiji Is Just ImageJ). The resolution of each image was adjusted to 300 dots per inch, which reflects pixels per inch (DPI) in Photoshop, and all resulting JPEGs were assembled using Adobe Illustrator.
sTSLIM macro light-sheet microscope
In 2008 we developed a high-resolution microtome/microscope called scanning Thin Sheet Laser Image Microscope (sTSLIM) that can image whole cochleas, nondestructively (33-37). sTSLIM optically sections and digitizes all cochlear tissues to allows for a complete quantitative assessment of normal and pathological structures. The Santi laboratory has used sTSLIM to characterize mouse cochlear development (38), analyze normal spiral ganglion cell number in the mouse (39), and illustrate alterations in cochlear structures in two knock-out mouse models (Atonal homolog1, ATOH1 and N-Myc proto-oncogene protein, N-Myc) (40, 41). Since light scatter and absorption are the greatest limiting factors in resolution, we have performed both tissue engineering (improved transparency and accessibility to antibody labeling through decellularization) and optical engineering (scanned light-sheet, Bessel beam illumination, structured illumination, confocal line detection, and radial sectioning) to improve imaging of large specimens such as the mouse cochlea with portions of the brain attached. Microscope performance will be tested on a regular basis using 150 nm gold fluorescent beads to ensure that the point spread function of the microscope is stable and optimal for reproducible imaging.
Tissue preparation for sTSLIM
Inner ears processed for sTSLIM were fixed and decalcified (described above) and then underwent a dehydration series in ascending concentrations of ethanol (30%, 50%, 70%, 100% EtOH) and then lightly stained by Rhodamine-B isothiocyante (5mg/mL in 100%) for 1 hour. After rinsing in 100% EtOH, inner ears were cleared to transparency with BABB (benzyl alcohol: benzyl benzoate 1:2), and specimens were mounted to a specimen rod and placed in a BABB-filled chamber for imaging by sTSLIM.
sTSLIM imaging
sTSLIM optically sections non-destructively by moving a thin light sheet in the X- and Z-axes. A z-stack of well-aligned 2D optical sections of the inner ear was automatically imaged with x-axis scanning across the width of the specimen and with a z-step size of 5 µm. At this thickness the whole mouse cochleae contained ~300 images that take ~30 minutes to produce. Images were adjusted for brightness, contrast, and either unsharp masking or deconvolution using ImageJ (National Institutes of Health). The z-stack was then loaded into the Amira 3D program and structures of interest were manually segmented, by drawing along their borders in different colors to prepare 3D reconstructions and volume calculations. Supplemental Fig. 3 shows an example of a 2D optical section through the cochlea and Supplemental Movie 1 shows segmented inner ears rotating horizontally.