OS specimens
The OS tissue specimens and paired normal controls were collected from 45 patients who were underwent wide-excision surgery in Yantaishan Hospital from January 2015 to January 2016. The postoperative pathology specimens were all confirmed for osteosarcoma.
Cells culture and grouping
U2OS cells (OS cell line, ATCC, USA) were incubated in DMEM (12100, Solarbio, China) with supplement of 10% FBS (11011-8611, Solarbio) in a 37 ℃ incubator with 5% CO2.
First, to reveal the function of microRNA-26a-5p (miR-26a-5p) on phenotypes of U2OS cells, U2OS cells were divided into Blank, MC and M groups. Cells in blank group were only cultured with DMEM. Cells in MC group or M group were separately subjected to mimic control or miR-26a-5p mimic transfection and then cultured in DMEM for the specified times.
To determine whether miR-26a-5p could bind to NAMPT to regulate phenotypes of U2OS cells, U2OS cells were divided into Blank, MC, M, NC, NAMPT, M+NAMPT groups. Blank, MC, M groups were carried out according to described above. NC group: cells were subjected to pcDNA (negative control) transfection and then cultured in DMEM for the specified times; NAMPT group: cells were transfected with pcDNA-NAMPT and then cultured in DMEM for the specified times; M+NAMPT group: cells were co-transfected with miR-26a-5p mimic and pcDNA-NAMPT and then cultured in DMEM for the specified times.
To determine whether lncRNA NORAD (NORAD) could target miR-26a-5p to regulate phenotypes of U2OS cells, U2OS cells were divided into Blank, MC, M, NORAD-NC, NORAD, NORAD+M group. Blank, MC, M groups were performed as described above. NORAD-NC group: cells were transfected with pcDNA empty vector and then cultured in DMEM for the specified times; NORAD group: cells were transfected with pcDNA-NORAD and then cultured in DMEM for the specified times; NORAD+M group: cells were subjected to miR-26a-5p mimic and pcDNA-NORAD transfection and then cultured in DMEM for the specified times.
Transfection
The miR-26a-5p mimic (miR10000082-1-5), mimic control (miR1N0000001-1-5) were purchased from RiboBio Co., Ltd. (Guangzhou, China). The overexpression plasmid containing the NAMPT sequence (pcDNA-NAMPT), or the NORAD sequence (pcDNA-NORAD), and pcDNA (empty vector) were acquired from GenePharma Co., Ltd. (Shanghai, China). U2OS cells were transfected for 48 h with 50 µM miR-26a-5p mimic and mimic control, 5 mg/L pc-DNA plasmids using lipofectamine 2000 (11668, Invitrogen). After that, the transfected cells were collected and used for other research.
Dual-luciferase reporter assay
The targeting relationships between miR-26a-5p and two genes (NAMPT and NORAD) were predicted by TargetScan V7.2 (http://www.targetscan.org/vert_72/). The 3-UTR of NAMPT and the mutated sequence were designed and synthesized by GenePharma Co., Ltd. The fragments were inserted into the pmirGLO control vector (E1330, Promega, USA) to construct the NAMPT-wild-type (WT) vector and NAMPT-mutant (MUT) vector, respectively. Similar procedures were performed to construct reporter plasmids NORAD-WT and NORAD-MUT. For the dual-luciferase reporter assay, either a WT or MUT reporter plasmid and either miR-26a-5p mimic or mimic control were co-transfected into U2OS cells for 48 h using lipofectamine 2000 (11668, Invitrogen). Dual-luciferase reporter assay kit (E1910, Promega) was applied to determine luciferase activity of transfected cells.
CCK-8
Transfected U2OS cells were harvested and cultured in 96-well plates (5 × 103 cells/well). Cell viability was indicated at 24 h, 48 h and 72 h with a CCK-8 Kit (CA1210, Solarbio). The viability of U2OS cells was evaluated by monitoring the absorbance at 490 nm using an enzyme-labeling instrument (Bio-Rad, USA).
Flow cytometry assay
Cell cycle of U2OS cells was examined with propidium iodide (PI) kit (CA1510, Solarbio). Transfected U2OS cells (5 × 104/dish) were cultured in 6 cm dishes. After 72 h culture, cells were fixated in 70% ethanol overnight at 4°C, washed by PBS and suspended in 100 µL R RNase A solution. Next, after incubation at 37 °C for 30 min, cells were treated with 400 µL PI for 30 min at 4 °C. Cell populations in in each of the cell cycle phases were quantified using FACS Caliber cytometer (BD Biosciences) and the data were analyzed by the Modfit LT software (Verity Software House, USA).
For apoptosis experiment, transfected U2OS cells were harvested and dyed by both Annexin V-FITC and PI as manufacturers’ protocol (CA1020, Solarbio). Briefly, harvested U2OS cells were centrifuged at 300× g for 10 min. After discarding the supernatant, the cells were resuspended in 1 ml 1 × binding buffer and the cell concentration was adjusted to 1×106 cells/ml. 100 µL of cells (1 × 105) was added to each labelled tube, incubated with 5 µL Annexin V-FITC for 10 min and then incubated with 5 µL PI for 5 min. Apoptosis of U2OS cells was examined by FACS Caliber cytometer (BD Biosciences) within 1 h.
Reverse transcription quantitativepolymerase chain reaction (RT-qPCR)
Total RNA was isolated from OS tissues and paired normal tissues and U2OS cells with TRIzol reagent (15596-026, Invitrogen). RT-qPCR was carried out to synthesize cDNA using total RNA with cDNA Synthesis Kit (RR036B, Takara). Then, qPCR was carried out with TB Green® Premix Ex Taq™ II (RR820Q, Takara) in an Thermal Cycler Dice Real Time System.
For miRNA analysis, miRNA was extracted using RNAiso for Small RNA (9753A, Takara). CDNA was synthesized using t Mir-X miRNA First-Strand Synthesis Kit (638315, Clontech). And qPCR was performed using Mir-X miRNA qRT-PCR TB Green® Kit (638316, Clontech) in athermal Cycler Dice Real Time System. The nucleotide sequence of the forward primer for miR-26a-5p, is as follows (TTCAAGTAATCCAGGATAGGCT). A universal reverse primer was provided in the kit. GAPDH or U6 was served as internal control for mRNA and miRNA quantification, respectively. The genes levels of were determined by the 2-ΔΔCt method (14). The nucleotide sequences of primer used in the qRT-PCRs are listed in Table 1.
Western blot
Treated U2OS cells were lysed in a RIPA buffer (R0010, Solarbio) containing 1 mM PMSF. The supernatant Protein concentration in each group was qualified by BCA Protein Assay Kit (C0020, Solarbio). After being isolated on 12% SDS-PAGE, soluble protein was transferred to PVDF membranes (YA1701, Solarbio). Protein markers (PR1910 (11-180kDa) and PR1920 (11-245KD)) were acquired from Solarbio Science & Technology Co., Ltd. (Beijing, China). After separation and transfer, the blots were blocked with 5% nonfat dry milk and reacted with primary antibodies (listed in Table 2) overnight at 4°C. Then membranes were reacted with secondary antibody (ab205718, 1:2000, Abcam) for 2 h. Blots were visualized by ECL Western Blotting Substrate (32209, Thermo Fisher Scientific) and digitized by NIH Image (National Institutes of Health, Bethesda, MD).
Statistical analysis
All cell-based experiments were performed independently and repeated at least three times. The data were shown as mean ± standard deviation (S.D.) and analyzed by GraphPad Prism 6.0 (GraphPad). Paired t-test was used for OS tissues and paired normal tissues. All P values were analyzed using Student’s t test or one‑way ANOVA followed by post hoc analysis using Bonferroni’s test. A p-value of less than 0.05 was taken as statistical significance.