Plant material
The cultivars of Rehmannia glutinosa libosch, such as low verbascoside cultivar and high verbascoside cultivar (Chai et al., 2013), grown in cultivated land in Wen County, Henan, China. Their roots, stems and leaves were used as the experimental materials. The young leaves from plant tissue culture-derived cultivar Wen 85-5 plantlets were used for RgTAT genetic transformation, which were cultured in autoclaved Murashige and Skoog (MS) basal medium.
RT-PCR and RT-qPCR analyses
Based on known plant TAT enzymes and their EC numbers, their genes were reversely inferred and searched from NCBI. RNA extraction, RT-PCR and RT-qPCR analyses were carried out as stated by Zhou et al.(2016). Primers for these genes were designed by DNAMAN software based on the conserved sequences of their sequences from Erythranthe guttatus (XM_012976257.1), Sesamum indicum (XM_011102052.2), Salvia miltiorrhiza (KF220575.1), Scutellaria baicalensis (KF926690.1) and Vitis vinifera (XM_002276428.3).
RgTAT cloning
The full-length cDNA was cloned in three successive steps. First, RNA extraction and RT-PCR were carried out as stated by Zhou et al.(2016). Second, based on the cDNA fragment of RgTAT cloned by homology cloning method mentioned above, together with Rehmannia glutinosa SRA database in NCBI, Full-length cDNA was cloned by electronic cloning via the searching by tBLASTn and assembling with DNAMAN software of ESTs. Third, according to its coding sequence, a pair of primers were designed (Table 1). Its coding sequence (RgTAT) was amplified by RT-PCR(Zhou et al., 2016). The PCR product was cloned into the pMD19-Tvector (TAKARA, Japan). The pMD19-Tvectors with RgTAT were transformed into Ecoli strain DH5α, followed by PRC test and sequencing. The PCR products were fractionated on agarose gel and purified with OMEGA Gel Extraction Kit (Thermo Fisher Scientific, Japan).
Construction of plant expression vector
The vector pCAMBIA1300-35S, containing the nptII (neomycin phosphotransferase) gene coding for kanamycin resistance and Hyg (R) as a plant-selectable markers, was chosen for this experiment. A fragment containing the CDS was amplified with the primer pair RgTAT-F with the Xbal site and RgTAT-R with the KpnI site (Table 1) under the following PCR conditions: 1 cycle of 94℃ for 5 min, 35 cycles of 94℃ for 30s, 55℃ for 30s and 72℃ for 2 min, and finally 1 cycle at 72℃ for 10 min. Then the amplified fragment was subcloned into the pCAMBIA1300-35S. Recombinant plasmids (pCAMBIA1300-RgTAT) were identified by restriction analysis of purified plasmid DNA, were sequenced, and then mobilized into the Agrobacterium tumefaciens strain GV3101 using the freeze–thaw method and maintained in yeast extract broth (YEB) medium, supplemented with 50 mg/L rifampicin (rif) and 50 mg/L kanamycin (kan), followed by PCR identification.
Table 1 The primers and their sequences
Candidate genes
|
Primers
|
Primer sequences(5'-3')
|
Amplicons
|
TAT fragment
|
TAT-F
|
AGCCCGTTTGTTCCGATGG
|
110bp
|
TAT-R
|
GTGACAAGCCAGCCAAGCC
|
RgTAT
|
RgTAT-F
|
ATGGAGAACGGAGGGTC
|
1266bp
|
RgTAT-R
|
TCATTGTTTCTTAGCGTGTC
|
TIP41
|
TIP41-F
|
TGGCTCAGAGTTGATGGAGTGCT
|
74 bp
|
TIP41-R
|
CTCTCCAGCAGCTTTCTCGGAGA
|
Hyg
|
Hyg-F
|
ATCGAAATTGCCGTCAACC
|
794 bp
|
Hyg-R
|
ACAGCGTCTCCGACCTGAT
|
Generation of transgenic plantlets
The pCAMBIA1300-RgTAT was introduced into Rehmannia glutinosa by Agrobacterium-mediated transformation as stated by Zhou et al (2016). The original vector pCAMBIA1300-35S was also transformed. For transformation, the young explants from 10-day-old Rehmannia glutinosa plantlets were cut into about 0.5 cm pieces and then precultured, immersed in the Agrobacterium suspension, removed, blotted, and co-cultured on a solid MS medium supplemented with 0.1mg/L NAA, 2.0mg/L6-BA and 100μmol/L AS in dark at 25 C for 2 days. After co-cultivation, the explants were washed once with sterile water and transferred to a solid callus-inducing and shoot-differentiating medium (MS basal medium supplemented with 0.1mg/L NAA, 2.0mg/L6-BA, 100μmol/LAS, Hyg (10mg/L) and cefotaxime (100μmol/L)], and cultured for 3-4 weeks under a 16h photoperiod at 25℃ to induce calli or shoot formation. Three weeks, the shoots were transferred onto a root-inducing medium containing 1 mg/L NAA and10mg/L Hyg for rooting. The regenerated plantlets with well-developed shoots and roots (To) were finally transplanted into pots and then transferred to the greenhouse.
Hyg analysis of transgenic plantlets
Total genomic DNA was extracted from leaves of Rehmannia glutinosa T0 and non-transgenic Rehmannia glutinosa plantlets. The amplification reaction was carried out with a pair of primers (Table1) as stated by Zhou et al (2017). The amplified products were separated by electrophoresis on a 0.8 % agarose gel and analyzed to rapidly screen putative to on selective media.
Gene expression analysis by real-time quantitative PCR
Total RNA isolated from T0 transgenic Rehmannia glutinosa lines was treated with RNase-free DNase, whose quality and integrity were confirmed with agarose gel electrophoresis. Real-time quantitative PCR was performed with a pair of primers (Table1) as stated by Zhou et al (2016) using ddH2O as negative controls lacking the cDNA template and RgTIP41 as an internal control to normalize expression (Table1), and gene expression was quantified using the 2-ΔΔCt method.
Measurement of acteoside content in transgenic Rehmannia glutinosa
Acteoside was extracted from T0 transgenic Rehmannia glutinosa lines and wild type Rehmannia glutinosa separately. 0.2g dried samples were ground into a powder, extracted, whose final extract was used for HPLC analysis as reported by Ouyang (2017).
Statistical analysis
Statistical analysis was conducted with SPPS software (version 19.0) as stated by Zhou et al.(2016). Analysis of variance (ANOVA) was performed.