1.1 Subjects: were patients in China, who were newly diagnosed with diabetic ketosis. Also, a set of healthy people were randomly selected for the control group(the ethics number is 2019276 in Xinxiang Medical College).
1.2 Inclusion criteria for the ketosis-onset diabetic group were as follows [9, 10, 11]:
①The first symptom of the patient was ketosis or ketoacidosis.
Diagnosis of the newly onset diabetes was confirmed by clinical symptoms and laboratory examinations after admission, which was typical polyuria, polydipsia, and also polydipsia within six months, and no more than six months after the onset of ketosis (more than 2 + urinary ketone body) or ketoacidosis.
There were no obvious triggers, such as infection, trauma, inflammation, etc.
Secondary diabetes caused by gestational diabetes, drugs, pancreatic exocrine diseases, and other endocrine diseases were excluded from the study.
1.3 Grouping: was done based on positive glutamic acid decarboxylase antibody (GADA) and Islet Antigen-2 (IA-2) antibody (where A + means GAD Ab or IA-2 Ab were positive or more than one was positive, and A- means both were negative), and also on the preservation of β cell function (β + means fasting C peptide > 0.56 µg/L, and β- means fasting C peptide < 0.56µg/L). Based on this, patients were divided into four subgroups: A + β-, A-β-, A + β+, and A-β-group with 50 patients in each group. Simultaneously, 50 healthy people corresponding to the age and gender of the disease group were selected for the control group.
1.4 Specimen collection: when patients were admitted to the hospital, general information, such as age, gender, height, weight, medical history, and family history, were recorded. Also, indexes such as venous blood glucose, the urine ketone body, blood lipid, liver function, and kidney function were detected; samples for HbA1c, GAD Ab, and IA-2 Ab, were collected on an empty stomach, the next day morning. Within 24 h of correcting diabetic ketosis or DKA, fasting blood samples were collected to measure C-peptide or after one week of ketosis correction, islet function was measured.
1.5 Specimen preservation: Plasma: EDTA or heparin was used as an anticoagulant. The samples were centrifuged at 2–8°C at 1000 x g for 15 min within 30 min of blood collection, and stored at --20°C or − 80°C, for further use. Repeated freeze-thawing was avoided. For MicroRNA enrichment, plasma (serum) was extracted within 2 h of blood collection, out of which 200 µL was used for the miRNA enrichment experiment using The miRcute_miRNA isolation kit. The enriched microRNA was stored at − 80°C for subsequent use.
1.6 Detection of anti-aminoacyl-tRNA synthetase (ARS) antibody: was performed according to the instructions of human anti-histidyl-tRNA and human anti-tryptophan-tRNA synthetase ELISA kits.
1.7 miRNA detection:
1.7.1 Total RNA was extracted from whole blood or plasma, and then cDNA was prepared.
1.7.2 The reverse transcription primers were miRNA specific, synthesized by Tiangen biochemical technology (Beijing) Co. Ltd., and U6 was used as the internal reference gene. The gene sequence and primer sequences are as follows: MH-U6 5' ACACGCAAATTCGTGAAGCGTTCC 3', Hsa-miR-191–5p CGGAATCCCAAAAGCAGC TG, Hsa-miR-342–3p TCTCACACAGAAATCGCACCC, Hsa-miR-510 GCTACTCAGG AGAGTGGCAATCAC. RNA was denatured at 70°C for 10 min before reverse transcription and then placed on ice for standby.
1.7.3 Quantitative fluorescence PCR: was performed using the miRcute-miRNA fluorescent quantitative kit, where U6 was used as the internal reference gene. This method was used to detect the expression of miR-342, miR-191, miR-510. A 20 µL reaction system was prepared using 1.5 µL cDNA, 1.6 µL of 2.5 nm upstream primer, 0.4 µL of 10 nm downstream primer, 10 µL miR, and 6.5 µL of water. Each sample had three replicates. The reaction conditions were as follows: 94°C for 1 min, then 40 cycles of initial denaturation at 94°C for 20 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s.
1.7.4 Data analysis: the target miRNA and internal reference (U6) for each sample were subjected to real-time PCR. Relative quantitative analysis was done using the 2−ΔΔCT method by analyzing the changes in miRNA expression represented by a ratio of miRNA expression in the patients to the normal group. When detecting relative expression variables of miRNA, U6 were used as an internal reference gene to unify the target genes also ensure the same quantity in the number of samples. The relative expression level of miRNA in plasma (serum) was calculated as follows: RQ = 2 -ΔCT, where RQ represents the relative quantity, ΔCT = target gene CT - internal reference gene CT. Target gene CT and internal reference gene CT represent the CT value of target genes and internal reference gene in a sample; the miRNA expression level change between group A and group B was calculated by RQ = 2 –ΔΔCT, whereΔΔCT = (target gene CT – internal reference gene CT) group A - (target gene CT - internal reference gene CT) group B.
1.8 Treatments:
If a patient shows spontaneous ketosis, it is inferred that insulin in the body is very low, which needs exogenous insulin to meet the needs of the body; otherwise, the patient may develop a serious metabolic disorder that can even be life-threatening. In this study, all the patients in the disease group were given a continuous intravenous injection of human recombinant insulin until the urine ketone body was tested negative for 3 consecutive days. Insulin therapy was discontinued for at least one day before analyzing the data. The target peripheral blood glucose level was 4.4–5.6 mmol/L. All the patients in the study were under a controlled diet during the hospitalization, and the calorie intake was 30 kcal/kg/24 h
1.9 Statistical methods:
The data were analyzed by SPSS 19.0. Data processing of normal distribution was represented by the mean ± standard deviation (± s). Median and t-test were used for representing non-normal data, and group comparison, respectively. Analysis of variance was used for comparison between the groups. The P-value < 0.05 was statistically significant, and NS indicated no difference. Before statistical analysis, the relative expression level of miRNA, i.e., 2-ΔCT, was logarithmically transformed, and the transformed data was accorded with the normal distribution. The expression levels of miRNA in plasma and serum were compared by paired t-test. The relative expression level of microRNA was expressed by the difference between the threshold cycle number (Δ CT) of microRNA and the internal reference (U6).