2.1 Virus and samples
Porcine circovirus type 3(PCV3) nucleic acid and plasmid, porcine circovirus type 1/2(PCV1/2), porcine respiratory and reproductive system syndrome virus(PRRSV), swine fever virus(CSFV), and pseudorabies virus(PRV), etc. are all from the Shandong Provincial Key Laboratory of Prevention and Control of Livestock and Poultry Diseases. 100 samples used in clinical trials were from farms in Yantai, Linyi and Liaocheng.
2.2 LAMP-related primers and hybrid probe design
Refer to the PCV3 related conserved sequence uploaded by NCBI (GenBank accession number: MH107164.1), and design a set of LAMP using the LAMP primer online design website (http://primerexplorer.jp/elamp4.0.0/index.html). The primers include an upstream outer primer F3 (TCCAGTTTTTTCCGGGACAT), a downstream outer primer B3 (AACACTTGGCTCCAAGAC), an upstream inner primer FIP (CTTTTTCTCCAGACCCACCCCA-AAAGCAGTGCTCCCCATTG), and a downstream inner primer BIP (TTCCCGCCAGAATTGGTTTGG-GCGGAAAGTTCCACTCGTAA), as shown in Figure.1. A plurality of hybridization probes were designed using Primer 5.0 for screening according to the target amplified fragment, as shown in Table 1. The primers and hybridization probes were synthesized and modified by Bao Bio (Dalian) Co., Ltd. FIP 5' end modified biotin (Biotin), hybridization probe 5' end modified fluorescein isothiocyanate (FITC).
2.3 Conventional PCR method
The external primer F3/B3 was used as upstream and downstream primer for conventional PCR, and the PCR reaction system was prepared to be 20 μL according to the instructions of Nanjing Vazyma Biotechnology Co., Ltd. 2×Taq Plus Master Mix II, as shown below:
2×Taq Plus Master MixⅡ
|
10 μL
|
F3
|
1 μL
|
B3
|
1 μL
|
DNA Sample
|
1.5 μL
|
ddH2O
|
6.5 μL
|
Reaction conditions: denaturation 94 ℃, 4 min; 94 ℃ 30 s, 57 ℃ 30 s, 72 ℃30 s, a total of 32 cycles; total extension 72 ℃, 8 min. After the completion of the reaction, the product was stored at 4 ℃, subjected to 1.5% agarose gel electrophoresis, and observed under a gel imager.
2.4 Establish LAMP system and condition optimization
Using a PCV3 positive plasmid as a DNA template and 25 μL of the LAMP system was prepared according to the NewEngland Biolabs Bst 2.0 DNA polymerase instructions as follows:
10× ThermoPol® Buffer
|
2.5 μL
|
MgSO4(100 mmol/L)
|
1.5 μL
|
dNTP Mix(2.5mM)NTP rMO
|
5 μL
|
Betaine
|
2 μL
|
F3/B3(10 mmol/L)
|
0.25 μL
|
FIP/BIP(10 mmol/L)
|
1 μL
|
Bst DNA Polymerase(8000U/mL)
|
1.5 μL
|
DNA Sample
|
1.5 μL
|
Nuclease-free Water
|
add to25 μL
|
The optimal reaction time was explored in a 60℃water bath. The reaction time was set at 35, 40, 45, 50, 55, 60, 65, 70, and 75 minutes for each gradient. After the LAMP reaction time was selected, the optimal reaction temperature exploration test was carried out, and the reaction temperatures of 56, 58, 59, 60, 61, 62, 63, and 64 ° C were respectively set. Determine the optimal reaction time and temperature, in order to obtain the experimental results quickly and easily in the actual application process.
2.5 LAMP-LFD detection
The test strips used in the LFD test were from Milenia® HybriDetect 2T. After the LAMP reaction was completed, 2 μL of hybridization probe was added to continue the reaction for 5-6 min, and then 5 μL of the product was taken and added to 100 μL of HybriDetect Assay Buffer for 1-2 min. The test results were observed after adding a lateral flow test strip.
2.6 Specificity and sensitivity test of LAMP-LFD detection
Under optimized conditions, the LAMP-LFD specificity tests were performed simultaneously using PCV1, PCV2, PRV, CSFV, PRRSV and PCV3 as templates. Under optimized conditions, the PCV3 positive plasmid was diluted 10-fold (initial concentration was 200 ng/μL) for routine PCR and LAMP-LFD sensitivity tests.
2.7 Repeatability testing and clinical application of LAMP-LFD detection
Under optimized conditions, the LAMP-LFD repeatability test was carried out using a PCV3 positive plasmid (plasmid concentration: 200 ng/μL and the lowest concentration in the sensitivity test, respectively) as a template.
The conventional PCR and LAMP-LFD methods were used to detect 100 suspected diseased pig tissues from Yantai, Linyi and Liaocheng in Shandong Province to evaluate the applicability of the LAMP-LFD method in clinical testing.