Bacterial strains
A total of 34 CRPA clinical bacterial isolates were collected from various clinical laboratories in Hunan Brain Hospital, China, during the period from October 2018 to March 2019. Reference strains P. aeruginosa ATCC 27853 and P. aeruginosa ATCC 15692 (PAO1) were purchased from the Clinical Laboratory Center of the Ministry of Health.
Antimicrobial susceptibility testing
All strains were identified and tested with TDR-300B Plus VitEK-2 compact automatic bacterial identification instrument. The minimum inhibitory concentration (MIC) method recommended by CLSI standards 2016-2018 was used for the determination. The antibiotics chosen were amikacin (AK), ceftazidime (CAZ), ciprofloxacin (CIP), levofloxacin (LEV), cefepime (CFPM), gentamicin (GM), tobramycin (TOB), imipenem (IPM), aztreonam (ATM), Polymyxin B (PB), piperacillin (PRL), piperacillin/tazobactam (TZP) and meropenem (MEM). Isolates shown to be resistant to IPM or MEM were defined as “CRPA,” and those resistant to three or more drugs class were defined as “MDR-PA or XDM-PA” [7]. P. aeruginosa ATCC 27853 was used as the control for antibiotic resistance.
Detection of carbapenemase production
Carbapenemase production was detected using Carbe NP test as described by Bouslah[8]. That carbapenemase in the bacteria was completely released through the non-denouement tissue lysate and hydrolyzed imipenem to produce acid. This changed the pH and led to the phenolic red color change from red to yellow or orange, indicating carbapenemase as positive.
Quantification of Mex A and OprD
Total RNA was extracted from exponential growth of bacteria in Luria Bertani medium using TRT-101(TOYOBO, China) and residual DNA was removed by DNase I. Then a cDNA synthesis was using reverse transcription kit (TOYOBO, China) with some modifications. PCR reaction system was as follows: the total volume of was 25 µl, including 1µl of reverse transcription product, 0.25 µl of upstream and downstream primers, 2× mix PCR buffer 12.5 µl, and 11.25 µl ddH2O. The reaction conditions were pre-denaturation at 94℃ for 2 min, 35 cycles of denaturation at 94℃ for 30 s, annealing at 54℃ for 30s, extension at 72℃ for 30s and at last extension at 72℃ for 10 min.
The cDNAs were subjected to semi-quantitative PCR using primers (Table 1), relative gene expressions were evaluated using RpsL representing housekeeping gene. P. aeruginosa-PAO1 was used as a reference for normalization of relative mRNA levels. The MexA were considered over expressed when their transcriptional levels were at least diploid higher than those of PAO1, and the expression of OprD decreased when their transcriptional levels were equal to or less than 30% those of PAO1[9].
Table 1. Primers used in the experiment
Genes
|
Primers
|
Primers sequences(5,-3,)
|
Amplicon size(bp)
|
rpsL
|
F R
|
CGCAACGTCGTGGCGTAT ACCCGAGGTGTCCAGCGAAC
|
226
|
OprD
|
F R
|
TTTCAACATCTACCGCACAAA CGTAGCCGTAGTTCTTATAGCC
|
389
|
MexA
|
F R
|
GGCCGTGAGCAAGCAGCAGT CGACGGAAACCTCGGAGAA
|
377
|
IntI1
|
F R
|
GGCATCCAAGCAGCAAG AAGCAGACTTGACCTGA
|
Variable
|
PCR amplification and sequencing of the class I integron
Class I Integron variable region primer was designed as previously described[10]. Total DNA was extracted by TIANamp Bacteria DNA Kit (TIANGEN@,China), PCR system was 25 µl, including Premix Taq 12.5 µl, template DNA 0.7 µl, upstream and downstream primers 0.8 µl each, ddH2O 10.2 µl. PCR amplification conditions were pre-denaturation at 9℃5 for 5 mins, 35 cycles of denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and last extension at 72 ℃ for 10 mins. The products were sequenced at Sunnybio (China).The nucleotide sequences of variable regionwere analyzed with BLAST tool of NCBI (https://www.ncbi.nlm.nih.gov/) by comparison with sequences of the reference strain and PAO1 retrieved from the data bank.
Statistical analysis
All experimental data were analyzed by WHONET 5.6 and SPSS 22.0 software.