Sample collection
Continuous monitoring of temperature and humidity index (THI) of cowshed, rectal temperature and respiratory rate of China Holstein cows under the same management level in summer (August, heat stress group (HS)) and winter (December, control group (Ctr)) in SiHong ranch of JiangSu province, China. 50mL milk from 6 Holstein cows with similar lactation periods and parity in the HS group and Ctr group were collected, transported to the laboratory at low temperature and stored at -80℃ for subsequent sequencing. The data of THI, rectal temperature and respiratory rate are shown in Table 1.
Extraction and identification of exosomes
The frozen milk sample was heated in a water bath at 37℃. After dissolution, the sample was added to a new centrifuge tube, and centrifuged at 4℃ for 30min at 2,000g. The supernatant was transferred to a new centrifuge tube at 10,000g at 4℃ for 45min. The supernatant was centrifuged at 100,000g for 120min at 4℃ in a new centrifuge tube. The supernatant was discarded and resuspended with 20mL precooled 1×PBS, centrifuged at 2,000g for 30min at 4℃. Supernatant was centrifuged at 4℃ of 2,000g for 30min. The centrifugation was repeated at 2,000g at 4℃ for 30min. Then the supernatant was centrifuged at 100,000g at 4℃ for 120min. The supernatant was discarded, resuspended and precipitated with 1mL precooled PBS, and temporarily stored at 4℃. 40%, 20%, 10% and 5% iodoxanol were prepared. Iodoxanol of different concentrations was added along the tube wall (3.6mL for each) according to the high to low concentration. Finally, 1mL resuspend temporarily stored at 4℃ was added to the top layer at 4℃, 100,000g for 120 min. After centrifugation, it was divided into 12 layers, the liquid in the middle 6-9 layers was taken out, and centrifuged again at 4℃ for 100,000×g for 120 min. The supernatant was removed, and the exosomes were resuspend with 1×PBS precooled with 100μL stored at -80℃.
Transmission electron microscopy
10μL of exosomes was absorbed and added to the copper net precipitation for 1 min, the floating solution was removed by filter paper, and the phosphotungstic acid was added to the copper net precipitation for 1min. The floating solution was removed by filter paper and dried for several minutes at room temperature. The transmission electron microscopy imaging was performed at 100 kv.
Nanoparticle tracking analysis
The samples were thawed in a water bath at 25℃, and placed on ice. Exosome samples were diluted with 1×PBS and directly used for NTA detection.
Western Blotting
The exosomes were centrifuged at 10,000g at room temperature for 5min, then supernatant was discarded, 50μL RIPA lysate was added, and the exosomes were incubated on ice for 30min. The concentration of exosomes was determined by BCA kit, and denaturated in metal bath at 100℃ for 10min; and then SDS-PAGE was performed. The protein was transferred to PVDF membrane by wet transfer method, and was sealed with 5% skim milk for 1h. Primary antibodies CD81, CD63, TSG101 and Calnexin (1:1000) polyclonal antibodies were added and incubated overnight at 4℃. Washing with 1ÍTBST buffer for 3 times, 5min each time, then add HRP-labeled secondary antibody and incubate at room temperature for 90min. After washing with 1×TBST buffer for 3 times, 5min each time, ECL chemiluminescence was developed and scanned in the infrared imaging system.
Small RNA sequencing and analysis
Total RNA was extracted from exosomes, and the Small RNA sequencing library was prepared by Truseq Small RNA Sample Prep Kits (Illumina, San Diego, USA). In simple terms, the total RNA was added with 3 'and 5' adapter, and the Small RNA connected by the adapter was used for reverse transcription PCR to create the DNA library, and the primer was annealed to connect the tow fringes adapter for PCR, and the Small RNA library was purified by gel. Finally, the High Sensitivity DNA Chip was used to test the sample library. The qualified libraries were sequenced using Illumina Hiseq2000/2500 with a single-ended read length of 1Í50bp.
Screening of differentially expressed miRNAs
Raw reads were subjected to ACGT101-miR (LC Sciences, Houston, Texas, USA) to remove adapter dimers, junk, low complexity, common RNA families (rRNA, tRNA, snRNA, snoRNA) and repeats. The final data is the valid reads, which can be used for subsequent analysis of small RNA data. According to the data of miRNAs expression in each sample, T test was used to analyze the differential expression of miRNAs, and according to the significance of expression difference (P < 0.05) differentially conserved miRNAs were screened out.
Target gene prediction and GO and KEGG enrichment analysis
miRNAs bind to target sites mainly through complementary pairing. The 3 ' UTR sequence of bovine mRNA was used as the target sequence to predict the target genes of differentially expressed miRNAs sequences. We used TargetScan (v5.0) and miRanda (v3.3a) software to predict the target genes of miRNAs with significant differences. The target genes were screened predicted with two software according to the scoring criteria. Target genes with the context score percentile less than 50 were removed in the TargetScan algorithm, and target genes with the maximum free Energy (Max Energy) > -10 were removed in the miranda algorithm (that is, the threshold was targetScan_score ≥ 50, miranda_Energy < -10). Finally, the intersection of software was selected as the final target gene of the differential miRNAs.
The GO functional significance enrichment analysis first mapped all the differentially expressed genes to each term in the Gene Ontology database (ftp://ftp.ncbi.nih.gov/gene/DATA/gene2go.gz), calculated the number of genes in each term, and then applied hypergeometric test to find the GO items significantly enriched in differentially expressed genes compared with the entire genome background. KEGG is the main public database on Pathways. Pathway significance enrichment analysis uses KEGG Pathway (http://www.genome.jp/kegg) as the unit, and hypergeometric tests are used to identify the pathways that are significantly enriched in differentially expressed genes compared with the overall genome background.
Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted with TRIzolTM reagent (Invitrogen, cat: 15596026, USA). Before exosomes RNA extraction, synthetic cel-miR-39 (GenePharma, Shanghai) was added as an internal control [23]. The density of samples RNA was quantified spectrophotometrically at 260/280 nm. miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme, cat: MR101-01/02, Nanjing) was used to reverse transcribe the total RNA, and mRNA expression was quantified with real-time PCR. Using comparative Ct (2−ΔΔCt) value method standardizes the expression levels of all target genes with the endogenous reference gene U6 or Cel-miR-39 (Forward primer: ATATCATCTCACCGGGTGTAAATC; Reverse primer: TATGGTTTTGACGACTGT
GTGAT). The primers sequences are listed in supplementary materials Table S1.
Statistical analysis
Dates are shown as mean values ± SEM. All results were analyzed by T test, using the software GraphPad Prism 8.0.1 (La Jolla, CA, USA). P < 0.05 was considered statistically significant.