Study area
Tick samples were collected from 5 provinces across Iran: Ardebil, Kerman, Tehran, Isfahan, and the Kurdistan Province (Figure S1).
Sample collection and identification
Animal dwellings were visited and Ixodidae ticks were collected seasonally from the abdomen, neck, throat and the legs of hosts (sheep, cows, goats and dogs) using forceps so as not to harm the ticks. The tick specimens were placed inside a collection tube [17]. Information such as collection site, date, humidity and temperature of collection sites, and livestock owner’ name were recorded for each specimen. Samples were identified to species level using standard morphological keys [18,19]. For the morphological differentiation of D. marginatus and D.niveus, the keys of [13,20] were used.
Genomic DNA extraction and PCR reactions
Samples were frozen in liquid nitrogen and homogenized. Genomic DNA was extracted from tick samples individually using AccuPrep® Genomic DNA Extraction Kit (Bioneer, South Korea), according to the manufacturer manual. The extracted DNA from each species was subjected to PCR reactions using super PCR mastermix® (Yekta Tajhiz Azma, Iran) and the primers:
DITS2-F, 5´‑GTGCGTCCGTCGACTCGTTTTGA‑3´ and
DITS2-R, 5´‑ACGGCGGACTACGACGGAATGC‑3´[12], in order to amplify the ITS2 region. The amplification condition for the ITS2 region was as follows: initial denaturation at 95°C for 5 min followed by 30 cycles of [95°C for 30 s, 49.5°C for 30 s, and 72°C for 30 s] and a final extension at 72°C for 5 min [11].
Also the COI fragment was amplified using the universal primers below: Forward: 5'‑ GGAGGATTTGGAAATTGATTAGTTCC ‑3' and Reverse: 5'‑ CCCGGTAAAATTAAAATATAAACTTC ‑3' [21]. The PCR conditions for COI amplification were set as follows: initial denaturation at 94 °C for 5 min; followed by 30 cycles of [94 °C for 30 s, 48 °C for 30 s, 72 °C for 30 s] and a final extension at 72 °C for 7 min.
All the amplicons were sequenced (Bioneer Co., South Korea) and the results were analyzed using BLAST search (http://www.ncbi.nlm.nih.gov).
Phylogenetic analysis
The phylogeny of the ticks in the present study was deduced by using the Maximum Likelihood method based on the Tamura-Nei model [22]. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter =2.0513 for the three genera of ixodide ticks and +G, parameter =0.0500 for the Dermacentor comparative analysis)). The MEGA6 software was used for the molecular evolutionary analyses [23]. A bootstrap test including 1000 replicates was performed for each tree and the values (expressed as percentages of 1000 replications) are shown at branch points.