Materials
Primer STAR Max DNA Polymerase, restriction enzymes, ligation enzyme were purchased from Takara (Shiga, Japan). pET-28a (+) expression vector was provided from Novagen. Plasmid, gel extraction, and PCR purification kits were provided from Omega bio-tek(USA). E. coli BL21 (DE3) competent cell, Isopropyl-β-D-thiogalactopyranoside (IPTG), kanamycin and SDS-PAGE kit were purchased by Transgen (Beijing, China). Modified Bradford Protein Assay Kit, LB broth, D-glucose, NADH and NAD+ were purchased by Sangon biotech (Shanghai, China). Trimethylpyruvic acid, L-tert-leucine and D-tert-leucine were bought from Sigma-Aldrich (USA).
Gene synthesis
Using E. coli as the expression host, the amino acid sequence of LeuDH from Bacillus cereus (Sequence ID: WP_000171362.1) was optimized, and then synthesized by Sangon Biotech (Shanghai, China). Using E. coli as the expression host, the amino acid sequence of GDH from Bacillus megaterium (Sequence ID: WP_033578120.1) was optimized, and then synthesized by Sangon Biotech (Shanghai, China).
PDB structure analysis
The Swiss Model automated comparative protein modeling server [37] (http://swissmodel.expas). According to the amino acid sequence homology, LeuDH from Bacillus sphaericus (PDB ID: 1LEH) and GDH from Bacillus megaterium (PDB ID: 1GCO) were regarded as structural templates. The molecular graphics software program PyMOL (http://www.pymol.org/) was used for explaining the structure of the enzyme.
Gene construction
OE-PCR (Overlap Extension Polymerase Chain Reaction) was used to construct a sequential chimeric gene encoding LeuDH and GDH mediated by a rigid peptide linker. The oligonucleotides sequences encoding the corresponding amino acid sequences and rigid peptide linkers were shown in Table S1. The construction of GDH-R3-LeuDH (R3 indicated three units of rigid peptide linker, (EAAAK)3) chimeric gene was taken the cloning process. First, the GDH gene from pUC-GDH was amplified using Fusion-P1 (5'- GGAATTCCATATGTACAAAGATCTGGAAGGTAAAGTTGT -3') with NdeI restriction site (underlined) and Fusion-P2 (5'- GATTTCCAATGTCATTTTAGCAGCAGCTTCTTTAGCAGCAGCTTCTTTAGCAGCAGCTTCGCCACGGCCCGCCTG -3') with sequences that encoding one repeat of rigid peptide linker (R3, underlined). Second, the LeuDH gene from pUC-LeuDH was amplified using Fusion-P3 (5'- ATGACATTGGAAATCTTCGAATAT -3') and Fusion-P4 (CCGCTCGAGTTACCGGCGACTAATGATGT) with XhoI restriction site (underlined). Finally, PCR products from the first two amplifications were extracted and used as templates for OE-PCR to obtained GDH-R3-LeuDH chimeric gene using Fusion-P1 and Fusion-P4. Then the obtained chimeric gene and pET-28a (+) were digested with NdeI and XhoI and ligated together. The constructed plasmid was named pET-28a-GDH-R3-LeuDH and then transformed into E. coli BL21(DE3).
The gene of GDH and LeuDH was also performed PCR by corresponding primers. the GDH gene from pUC-GDH was amplified using GDH-P1 (5'- GGAATTCCATATGTACAAAGATCTGGAAGGTAAAGTTGT -3') with NdeI restriction site (underlined) and GDH-P2 (5'- CCGCTCGAGTTAGCCACGGCCCGCCTGGAAGCTC -3') with XhoI restriction site (underlined). the LeuDH gene from pUC-LeuDH was amplified using LeuDH-P1 (5'- GGAATTCCATATGACATTGGAAATCTTCGAATATCTG -3') with NdeI restriction site (underlined) and LeuDH-P2 (5'- CCGCTCGAGTTACCGGCGACTAATGATGT -3') with XhoI restriction site (underlined). The obtained gene and pET-28a (+) were digested with NdeI and XhoI and ligated together. The constructed plasmids were named pET-28a-GDH and pET-28a-LeuDH and then transformed into E. coli BL21(DE3).
Enzyme preparation and purification
200 mL of LB medium and 40 mg/L kanamycin were added in 1 L shake flask. The transformed E. coli BL21 (DE3) harboring fusion enzyme or free enzyme plasmids were cultured at 37°C, 200 rpm in 1 L shaking flask. The expression of recombinant proteins was induced by the addition of 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) when the optical density (OD600) was reached at 0.6–0.8 and the E. coli was grown at 25°C for 16 hours. Cell was collected by centrifugation and then resuspended with PBS buffer. Cell was disrupted by ultrasonication and removed by centrifugation at 10000 rpm, 4°C for 20 min. Obtained crude cell extract was then added to His-Trap column (His-Trap HP 5 mL, GE Healthcare Corp., Piscataway, NJ, USA) which pre-equilibrated with binding buffer (20 mM sodium phosphate, 0.5 M NaCl, 20 mM imidazole, pH 7.4). The binding buffer was equilibrated the column and eluting buffer (20 mM sodium phosphate, 0.5 M NaCl, 0.5 M imidazole, pH 7.4) eluted at a gradient concentration. Target proteins were desalted and concentrated by Macrosep Advance Centrifugal Devices (cut-off 10 kDa, Pall, East Hills, NY, USA). The purity of the obtained enzymes was tested by 10% (w/v) SDS-PAGE. All the protein concentrations were determined using a modified Bradford Protein Assay Kit (Sangon Biotech Co. Ltd) with bovine serum albumin as standard.
Enzyme characterization
The Tecan M200 Pro plate reader (Tecan Group Ltd., Männedorf, Switzerland) was used to assay the activity of fusion enzyme, LeuDH and GDH by monitoring the NADH (ε = 6.22/mM/cm) concentrations at 340 nm at 30°C. For the LeuDH part of fusion enzyme and LeuDH, the assay mixture contained 4.5 mM trimethylpyruvic acid, 0.2 mM NADH, 0.8 M NH4Cl-NH3·H2O buffer (pH 10.0) and a certain amount of enzyme solution. For the GDH part of fusion enzyme and GDH, the assay mixture contained 20 mM D-glucose, 2 mM NAD+, PBS buffer (pH 7.4) and a certain amount of enzyme solution. The volume of the reaction mixture was 200 μL in all cases. Reactions were initiated by the addition of NADH or NAD+. Enzyme activities were tested in triplicates. One unit of LeuDH and GDH activity was respectively defined as the amount of enzyme catalyzing the consumption or generation of 1 μmol NADH per minute under standard measurement conditions. Protein concentration was assayed using the Modified Bradford Protein Assay Kit.
To study the effect of pH on fusion enzyme and free enzymes, enzyme activities were measured in buffers with different pH (0.2 M potassium phosphate buffer including NH4+, pH 6–8; 0.2 M NH4Cl-NH3·H2O buffer, pH 8–11). The effect of temperature on fusion enzyme and free enzymes were tested over the temperature range of 30–90°C. The activity was expressed as relative forms (%) with the maximal value of enzyme activity at a certain pH or temperature as 100%.
Determination of thermal stability
To determine the thermal stability of fusion enzyme and free enzymes, the purified fusion enzyme, GDH and LeuDH were pre-incubated at 40, 50 and 60°C water bath for 1 hour and assayed for the residual GDH and LeuDH activity. The activity which was measured was calculated as a percentage of the original activities assayed before incubation. All measurements were performed in triplicate.
Biocatalysis of L-tle and product analysis
The standard reaction mixture contained 8 g/L whole cells, 100 mM trimethylpyruvic acid, 100 mM D-glucose, 0.4 mM NAD+, pH 9.0 (adjusted by adding ammonia), followed by adding free enzyme mixture or fusion enzyme in a total reaction volume of 1 mL. To study the effect of different conditions on the catalytic efficiency of fusion enzyme, different kinds and concentrations of cofactor and different concentrations of substrate and fusion enzyme were all examined. The reaction was performed at 30°C with 200 rpm of horizontal shaking if not specifically noted. Aliquots of the reaction mixture were taken and stored in -80°C for further analysis.
In order to obtain the concentration of L-tle after a reaction, HPLC was used to analyze the samples. The reaction samples were heat-denatured at 90°C for 10 min, firstly. Then precipitate protein was removed by centrifuging at 12000 × g for 10 min. Finally, the supernatant samples were filtered using 0.22 μm filter. The concentration and the optical purity (e.e. %) of L-tle were determined at 35°C with HPLC column (Phenomenex Chirex 3126Dpenicillamine). The mobile phase was 2 mM Copper (II) sulfate in water/isopropanol (95:5) at a flow rate of 0.8 mL/min.