Resistance Traits and Molecular Characterization of Multidrug-resistant Acinetobacter baumannii Isolates from an Intensive Care Unit of a Tertiary Hospital in Guangdong, Southern China

doi:10.21203/rs.3.rs-638208/v1

Purpose:

This study aims to characterize antimicrobial resistance (AMR), with particular reference to carbapenems and aminoglycosides, in MDR A. baumannii isolates recovered from an intensive care unit in a tertiary hospital.

Methods:

A. baumannii (n = 95 strains) isolated from patients were subjected to antimicrobial susceptibility test (AST) by Vitek 2 Compact system to determine minimum inhibitory concentrations, followed by genotyping by enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR). Resistance genes of interest were PCR-amplified and sequenced.

Results:

All isolates were qualified as MDR, with a resistance rate of >80% to 8 antimicrobials tested. In terms of beta-lactamase detection, the bla_OXA23 and bla_TEM-1 genes were detected frequently at 92.63% and 91.58%, respectively. The metallo-β-lactamase genes bla_IMP, bla_VIM, and bla_NDMwere undetected. Aph (3’)-I was detected in 82 isolates (86.32%), making it the most prevalent aminoglycoside-modifying enzyme (AMEs) encoding gene. In addition, ant (3”)-I was detected at 30.53%, while 26.32% of the strains harboured an aac (6')-Ib gene. ERIC-PCR typing suggested moderate genetic diversity among the isolates, which might be organized into 10 distinct clusters, with Cluster A (n = 86 isolates or 90.53%) being a dominant cluster of epidemic clones.

Conclusions:

Substantial fractions of the A. baumannii strains prevailing in the ICU were MDR clones exhibiting extremely high resistance to carbapenems and aminoglycosides as monitored throughout the study period. They principally belonged to a single cluster of isolates carrying bla_OXA23 and armA co-producing different AMEs genes.

General Microbiology

Immunology

Acinetobacter baumannii

antimicrobial resistance

resistance genes

healthcare associated infection

intensive care unit

Funding This work was supported by 2020 Li Ka Shing Foundation Cross-Disciplinary Research Grant (2020LKSFG06A) , a grant from Medical Science and Technology Foundation of Guangdong Province (B2018168), China, and Scientific Research Project of Hunan Provincial Department of Education (18C1145).

Competing interests The authors declare no competing interests.

Availability of data and material Not applicable

Code availability Not applicable

Authors' contributions Yuan-Chun Huang designed the experiments, carried out the study, interpreted the data and reviewed the manuscript. Zhuo-Ran Chen, Hui-Wu Guo designed, performed the experiments and wrote the paper. Jun Liu, Mao-Zhang Fu, Ying-Kun Qiu, Qing Pan collected and analyzed the data. All authors read and approved the final manuscript.

Ethics approval Not applicable

Consent to participate Not applicable

Consent for publication Not applicable

Acknowledgements Nai-Kei Wong modified the manuscript.

Acinetobacter baumannii (A. baumannii) is an opportunistic pathogen adept at colonizing and thriving in the hospital environment. In the recent decade, carbapenemase-producing multidrug resistant (MDR) A. baumannii has emerged as a prominent cause of healthcare-associated infections (HAIs) notably at intensive care units (ICUs), whose incidence seems to be ascending alarmingly in parts of China (He C et al. 2011; Li Y et al. 2018; Mariana Bitrian et al. 2012; Behdad R et al. 2020). Patients undergoing invasive procedures, immunosuppressive therapy or treatment with broad-spectrum antibiotics are vulnerable to HAIs cause by A. baumannii, particularly in the contexts of ventilator-associated pneumonia, bacteremia, septicaemia, urinary tract and wound infections (Mariana Bitrian et al. 2012; del Mar Tomas M et al. 2005; Freire MP et al. 2016; Carmen Gomez‑Arrebola et al. 2021).

By virtue of its extraordinary aptitude to survive in the hospital environment and to develop extremely high resistance to an array of common antibiotics including aminoglycoside and carbapenem classes of antibiotics, A. baumannii has become a major challenge to medical care at the ICU (Shimose LA et al. 2016; Molter G et al. 2016; Shamsizadeh Z et al. 2017) . One of the most prevalent sequence types (ST) of epidemic clones in China is ST208, which has gained notoriety for causing outbreaks in local ICUs (Bahador A et al. 2015). Analysis on genomic relatedness among clinical isolates is necessary for determining an epidemic strain, as a first step toward informed diagnosis and anti-infective countermeasures.

Although substantial efforts have been made over the years in monitoring the epidemicity and AMR trends of A. baumannii in China, the scope of previous studies tends to be limited to highly populous urban centers in northern and eastern China (Ning NZ et al. 2017; Zhou K et al. 2018). In southern China including Guangdong province (population 108.5 million), where the humid subtropical climate indeed favors microbial growth, epidemiological surveys on A. baumannii in HAIs were only with moderate frequencies and again covered only very large urban centers such as Guangzhou (population 14.9 million)(Zhou Y et al. 2015; Li Y et al. 2013). In contrast, studies on HAIs by A. baumannii and underlying mechanisms of AMR are otherwise scant in other Chinese regions overlooked in epidemiological survey. In this regard, we undertook the current study to examine the AMR traits, molecular determinants of AMR and clonal relationship of A. baumannii strains isolated from an ICU of a teaching tertiary hospital in the Chaoshan metropolitan area (13.93 million residents) in Guangdong province, southern China. We found that the isolates (n = 95) generally exhibited very high resistance to most of the commonly used clinical antibiotics including aminoglycosides and carbapenems, carried blaOXA23, blaTEM-1 and aph (3’)-I as major resistance genes and consisted mostly of strains belonging to a single dominant cluster (Cluster A in ERIC-PCR analysis).

Research settings and bacterial isolates

This study was conducted at the ICU of a tertiary-level teaching hospital affiliated to the Shantou University Medical College (SUMC) in Shantou city in Guangdong, a populous province in southern China. The hospital (1816 inpatient beds) serves the Chaoshan metropolitan area in eastern Guangdong. A total of 95 non-duplicated A. baumannii isolates were systematically collected from patients’ samples during the period of January 1^st to December 31^st, 2015. This study had been reviewed and approved by the Research Ethics Committee of the First Affiliated Hospital of Shantou University Medical College. The study was given a waiver of informed consent on the ground that it focuses only on characterizing bacterial isolates and involves no patient’s information.

Antimicrobial susceptibility

All isolates were first identified by using Vitek 2 Compact system (bioMérieux, France) and their antimicrobial susceptibility profiles obtained by using the Gram negative susceptibility cards (GN16 cards), according to the manufacturer’s instructions. Antimicrobial susceptibility test (AST) results for MICs (minimum inhibitory concentrations) were interpreted according to the criteria recommended by the Clinical and Laboratory Standards Institute (CLSI 2015). Additional validation for A. baumannii was done by PCR to test for the intrinsic bla_OXA51gene. Confirmed A. baumannii isolates were stored at -80°C for subsequent experiments.

Detection of antimicrobial resistance genes

Whole genomic DNA was extracted by using TIANamp Bacteria DNA kit (Tiangen Biotech, China), according to the manufacturer’s instructions. Detection of antimicrobial resistance (AMR) genes by PCR amplification was carried out with specific primers (See details in Table 1) to screen for the following genes of interest: extended-spectrum β-lactamases (ESBLs) encoding gene (bla_TEM-1, bla_sh_v), metallo-β-lactamases encoding genes (bla_IMP, bla_VIM-2, bla_NDM-1), cephalosporinase encoding gene (bla_ADC), OXA carbapenemases encoding genes (bla_OXA51, bla_OXA23, bla_OXA24, bla_OXA58), aminoglycoside-modifying enzyme (AME) encoding genes (aac(6')-Ib, ant(3”)-I, aph(3’)-I) and 16s rRNA methylase encoding gene (armA) were detected. For PCR amplification, the following thermal cycling conditions were adopted: initial denaturation at 94°C for 3 min, followed by 30 cycles (94°C for 1 min, 58-62°C for 1 min and 72°C for 1 min), and a final extension step of 8 min at 72°C. PCR products were separated by electrophoresis (at 100 V through a 1% agarose gel in 0.5×TBE running buffer), stained with ethidium bromide and observed under ultraviolet light. Identity of all PCR products was confirmed by DNA sequencing (Beijing Genomics Institute, BGI).

Genotyping of isolates

For determination of genetic relatedness of the isolates, enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) was performed with primer ERIC2 (5’-AAGTAAGTGACTGGGGTGAGCG-3’) (Bahador A et al. 2015) to amplify the conserved sequences of bacterial strains, by using the following thermal cycling conditions: initial denaturation at 94°C for 5 min, 4 cycles (94°C for 1 min, 26°C for 1 min, 72°C for 1 min), then 40 cycles (94°C for 30 sec, 40°C for 30 sec and 72°C for 1 min), and extension at 72°C for 5 min. To resolve the PCR products, each PCR product was analyzed by electrophoresis in a 1.5% agarose gel stained with ethidium bromide. Results for ERIC-PCR banding patterns were appraised by the software Quantity One (version 4.6.2) and scored as absent (0) or present (1) to construct a dendrogram according to the the unweighted pair group (UPGMA) method, using the software NTSYS-pc (version 2.10e). Isolates with more than 90% similarity were considered as belonging to the same cluster.

Statistics analysis

Statistical analysis on the correlation between different resistance genes was performed by rank-order correlation with SPSS 19.0 software. The difference in AMR rates was analyzed by Chi-squared test. Statistical significance was determined at p value <0.05.

Isolate characteristics and resistance rates

As shown in Figure 1, resistance rates of total A. baumannii against commonly used antibiotics (notably imipenem, gentamycin and tobramycin) had been persistently high( >70%) at the ICU in recent years, especially in a spiral upward trend to the antibiotics such as cefepime (FEP), imipenem (IPM), piperacillin/tazobactam (TZP), gentamycin (GEN) and ciprofloxacin (CIP). LVX was the only suvival with a resistance rate under 70.00%. In this study, a total of 95 non-duplicative A. baumannii strains were isolated from ICU patients. Strains from male patients evidently outnumbered those from females at a ratio of 65 (68.42%) to 30 (31.58%). Affected patients had a mean age of 61.93±1.87 years (range of 7 to 89 years old). The major isolation sites were sputum (n = 91), drain (n = 2) and stool (n = 2). As shown in Table 2, AST results suggested that all isolates could be qualified as multidrug resistant (MDR) A. baumannii, which showed high rates of extensive resistance to 8 antibiotics tested including cefepime (FEP), ceftriaxone (CRO), imipenem (IPM), gentamycin (GEN), tobramycin (TOB), ciprofloxacin (CIP), trimethoprim/sulfamethoxazole (SXT), piperacillin/tazobactam (TZP) at 93.68%, 92.63%, 93.68%, 89.47%, 86.32%, 94.74%, 81.05% and 83.16%, respectively. Importantly, despite a full resistance rate of below 55.00%, levofloxacin (LVX) might not be deemed any more effective than the abovementioned agents against A. baumannii, as it had a notable rate of intermediate-level resistance (37.90%). The susceptibility rates of the isolates toward all tested antibiotics were below 20.00%.

Genotypic patterns in ERIC-PCR analysis

ERIC-PCR was used to compare the genetic relatedness among the A. baumannii isolates. All PCR banding patterns ranging from 550 bp to 2000 bp were analyzed by the NTSYS software to construct a dendrogram, as shown in Figure 2. In general, the analyzed A. baumannii strains could be organized into 10 distinct clusters, where 86 (or 90.53%) of the isolates belonged to the major Cluster A, while the remaining 9 isolates exhibited substantially different banding patterns, additionally designated as Clusters B, C, D, F, G, H, J and K. In longitudinal analysis, strains belonging to Cluster A were detectable throughout the study period in 2015, indicating that members of this cluster correspond to major epidemic clones.

Determination of antimicrobial resistance genes

Analysis on AMR genes suggests that the A. baumannii isolates included in this study had high carriage rates for some specific AMR genes. Among the 95 strains, 87 (91.58%) were tested positive for the ESBL encoding gene bla_TEM-1, whileall strains contained the cephalosporinase gene bla_ADC. In terms of detection of carbapenemase genes, 88 strains (92.63%) were found to harbour the bla_OXA23 gene, while the bla_OXA51gene was universally detected in all isolates, consistent with the premise that it is an intrinsic resistance determinant in A. baumannii. Gene armA, a member of 16S rRNA methylases, was detected in 84 isolates (88.42%), while the most prevalent AMEs encoding gene aph (3’)-I was found in 82 isolates (86.32%). In comparison, 29 (30.53%) and 25 (26.32%) of the isolates harboured the ant (3”)-I and aac (6')-Ib genes, respectively. In further analysis, the genes bla_SHV, bla_IMP, bla_VIM-2, bla_NDM-1, bla_OXA24 and bla_OXA58were undetected in any of the A. baumannii strains.

Through genotyping and detection of resistance genes, we classified the 95 isolates of A. baumannii in this study, as shown in Table 3. Cluster A could be categorized into 9 subtypes on the basis of different AMR gene combinations. The most prevalent subtype in Cluster A was subtype Ai, comprising 55 (63.95%) isolates expressing the genes bla_OXA23, bla_OXA51, bla_TEM-1, bla_ADC, armA and aph (3’)-I. Among subtype Ai isolates, 38 (44.19%) were insensitive to all of the antibiotics tested. Twenty two (25.58%) isolates in group Aii harboured 8 different genes, namely, bla_OXA23, bla_OXA51, bla_TEM-1, bla_ADC, armA, aph (3’)-I, aac (6’)-Ib, and ant (3”)-I. The 20 isolates in subtype Aii were also insensitive to all antibiotics tested. Gene bla_TEM-1 was absent in group Aix which, however, was also found to be insensitive to cefepime and ceftriaxone. The aminoglycoside resistance genes aph (3’)-I and ant (3”)-I were only detected in subtypes Aviii and Aix, but surprisingly these were susceptible to gentamycin and tobramycin. The rest of the cluster showed various combinations of AMR genes, presumably giving rise to different resistance patterns. Members of Clusters C, E, J and K also expressed the genes bla_OXA51 and bla_ADC and showed an appreciably higher level of susceptibility than isolates in other clusters. Notably, despite the absence of carbapenemasegene bla_OXA23 in Cluster F, its members showed insensitivity to imipenem, in comparison with other clusters.

ERIC-PCR, a genotyping method premised on amplification of conserved regions of genomic DNA, has the advantage of facile instrumentation and reliability comparable to Pulsed Field Gel Electrophoresis (PFGE). It has been proven useful for determining genomic relationship across strains with heterogeneous backgrounds (Cartelle Gestal M et al. 2016; Ece G et al. 2015). In the present study, a dendrogram based on ERIC-PCR results identifies 10 distinct clusters (A, B, C, D, E, F, G, H, J, K). Notably, 90.52% (86/95) of the strains were classified into Cluster A, the principal cluster. Indeed, throughout the study period, isolates belonging to Cluster A were detected each month. In terms of resistance phenotype, strains in Cluster A were consistently more insensitive to all tested antibiotics than were strains in other clusters. This suggested that a single dominant clone of MDR-A. baumannii prevailed in the ICU in 2015 (Jan. to Dec.). By using ERIC-PCR as a genotyping method, Ning and coworkers reported carbapenem-resistant clones of A. baumannii spreading at an ICU in western China (Ning NZ et al. 2017). Chen and coworkers also described a major epidemic strain spreading at different hospital units in Hunan province of southern China (Chen D et al.2016). In our study, the spreading of A. baumannii strains in the ICU lasted for a substantial period and their resistance rates to antibiotics were extremely high. We found that among the 9 subtypes of strains within Cluster A, the most frequent type of AMR gene combination was bla_OXA23-bla_OXA51-bla_TEM-1-bla_ADC-aph (3’)-I-armA, which accounted for 63.95% (55/86) of the cases. Strains harbouring this gene combination could be routinely isolated throughout the study period, suggesting the existence of entrenched extrinsic factors favoring their spread. Cross-transmission and contamination within the ward environment might underpin this process, which calls for greater awareness for monitoring and timely disinfection of the ward environment.

In our study, we found that multidrug-resistant Acinetobacter baumannii (MDRAB) strains simultaneously carrying the bla_OXA23 gene and multiple aminoglycoside resistance genes are apparently spreading in southern China. The carriage of bla_OXA23 carbapenemases in A. baumannii has been documented worldwide and bla_OXA23 was one of the most prevalent carbapenemase genes detected in Chinese hospitals (Ruan Z et al. 2013; Shoja S et al. 2017). While the prevalence of A. baumannii co-expressing aminoglycoside resistance genes and carbapenemases genes have been reported in eastern China (Wang Y et al. 2016), to the best of our knowledge, there have been no studies on the epidemicity of A. baumannii co-carrying AMR genes against aminoglycosides and carbapenems in southern China.

A high percentage (95.80%; n = 91) of the total strains in our study originated from sputum, which is similar to findings in a recent epidemiological study covering 10 tertiary-care teaching hospitals in northern China (Jiang M et al. 2016).It has been suggested that most of the HAIs took the form of ventilator-associated pneumonia caused by mechanical ventilation, which occasionally even gave rise to outbreaks in ICUs by cross-infections (Munoz-Price LS and Weinstein RA. 2008; Peng H et al. 2015).

A. baumannii resistance rates to antibiotics seem to be increasing across the years. That high resistance to almost all antibiotics tested in this study indicated doctors were facing embarrassed situations on selecting antibiotic for infections caused by MDRAB in ICU. Since current treatment options for MDRAB were extremely limited, colistin is often considered as the last line of therapy for it (Gounden et al. 2009), although colistin-resistant A. baumannii had been reported (Al-Agamy MH et al. 2014).

The ESBL-producing genes bla_TEM-1 and bla_ADC identified in this study belong to Ambler class A and class C on β-lactamase coding genes, respectively. The gene bla_ADC along with the chromosomally located gene bla_OXA51 were consistently detected in A. baumannii, suggesting that they may be useful as signature genes for species confirmation. With the absence of bla_TEM-1gene, strains in Clusters C, D, E, H, J and K were susceptible to FEP compared to those in Cluster F and G, but were still insensitive to CRO. In view of the above observations, we speculated that strains with bla_TEM-1 gene may gain advantage in FEP resistance. It is noteworthy that bla_TEM-1 gene was the most prevalent ESBL gene in the present study, which differs from a previous study, where bla_CTX-M was reported to be the predominant ESBL gene (Mahamat A et al. 2016).

Conventionally, aminoglycosides are used in combination with β-lactams in anti-infective regimens to treat A. baumannii infections (Wang Y et al. 2016). However, aminoglycoside resistance A. baumannii has been reported with increasing frequency in China in recent years (Gao L et al. 2017; Jiang M et al. 2014; Lin T et al. 2015). The resistance rates for GEN and TOB in this study were 89.47% and 86.32%, respectively (Table 2). A study reported by Wen et al. (2014) showed high resistance rates in Jiangsu province, eastern China. Aminoglycoside modify enzymes (AMEs) and 16S rRNA methylase have been attributed as a molecular basis for aminoglycoside resistance. In the present study, 3 different AMEs and one 16S rRNA methylase genes were detected. The most prevalent of the AMEs was aph(3’)-I (86.32%), followed by ant(3”)-I (30.53%), with 84 (88.42%) of the strains carrying armA. In a study on A. baumannii from Jiangsu province, China the most prevalent AMEs were identified as aac(3')-I and aac(6')-Ib (Wen JT et al. 2014). We noted that A. baumannii from different parts of China feature different aminoglycoside resistance genes (Wang H et al. 2017). For example, the most representative aminoglycoside resistance gene combination in the present study was armA-aph(3’)-I (58.95%). It is known that AMEs genes could be detected in both aminoglycoside-resistant and susceptible strains (as in Cluster H). Gene products of AMEs are reportedly responsible for moderate-level resistance, whereas 16S rRNA methylase has been attributed to high-level aminoglycosides resistance (Wang Y et al. 2016). Interestingly, strains in Cluster B exhibited susceptibility to both GEN and TOB with only armA gene being detected. Some possible reasons include that 16S rRNA methylase may not be acting alone and that some uncharacterized mechanisms modulate armA activity.

In addition, high levels of aminoglycoside resistance co-occurring with carbapenems resistance have been reported in epidemic clones of A. baumannii from western China (Lin T et al. 2015). The imipenem resistance rates of A. baumannii were extremely high in China and numerous studies have raised concerns over the emergence and spread of imipenem-resistant A. baumannii in hospitals (Neves FC et al. 2016). Resistance rates for imipenem reported in different Chinese ranged from 58% to 100% (Jiang M et al. 2016; Zong Z et al. 2008; Ji S et al. 2014; Wu W et al. 2015)，and this alarming trend seems to continue to rise unabated each year. For A. baumannii strains included in this study, the resistance rate for imipenem was 93.68%. Our current results suggested that efficacy of carbapenems as treatment for MDR-AB infections seemed to be fast diminishing, especially in ICU contexts. Ruan and coworkers found that a carbapenem-resistant status of A. baumannii isolates was predictive of high resistance rates to commonly used antibiotics. In terms of mechanisms, carriage of metallo-β-lactamases (MBLs) and carbapenem-hydrolyzing class D β-lactamases (CHDLs) has been attributed to carbapenem resistance (Ruan Z et al. 2013). A growing body of literature documents bla_OXA23 as a predominant carbapenemase genotype among epidemic clones in China (Chen Y et al. 2017; Rapee Thummeepak et al. 2016) and outbreaks caused by bla_OXA23 producing A. baumannii paralleled those occurring worldwide (Neves FC et al. 2016; Hammoudi D et al. 2015;Novovic K et al. 2015;Koh TH et al. 2007;Martins AF et al. 2009). In this present study, we found that 88 of the A. baumannii strains (92.63%) harboured a bla_OXA23gene, suggestive of a level of prevalence seen in other parts of China (Ana Kovacic et al. 2017). In contrast, alternative AMR genes supporting the developing of MDR phenotypes such as bla_OXA24, bla_OXA58, bla_IMP, bla_VIM-2, bla_NDM-1genes were detected. Collectively, we proposed that the presence of bla_OXA23gene could be a cardinal molecular determinant of carbapenem resistance in our study.

In this study, we described the resistance traits and genetic relatedness of MDR A. baumannii strains with high resistance that prevailed at the ICU of a teaching tertiary hospital in the Chaoshan area of Guangdong province, a populous yet epidemiologically overlooked region in southern China. Extreme resistance to carbapenem and aminoglycoside classes of antibiotics including imipenem and gentamycin/tobramycin may be associated with the carriage of bla_OXA23 and AMEs genes as determined in PCR assays. A single Cluster A of epidemic clones seemed to dominate the spread of MDR A. baummannii at the ICU. Surveillance work in this study represents a first step towards a better understanding of MDR A. baumannii as a causative agent in ICUs, which calls for greater attention to continued monitoring and rational use of antibiotics.

Al-Agamy MH, Khalaf NG, Tawfick MM, Shibl AM, El Kholy A (2014) Molecular characterization of carbapenem-insensitive Acinetobacter baumannii in Egypt. Int J Infect Dis 22:49–54. https://doi.org/10.1016/j.ijid.2013.12.004
Ana Kovacic MSerugaMSvjetlana, Dekic M, Tonkic A, Novak Z, Rubic et al (2017) Transmission and survival of carbapenem resistant Acinetobacter baumannii outside hospital setting. Int Microbiol 20(4):165–169. https://doi.org/10.2436/20.1501.01.299
Bahador A, Raoofian R, Pourakbari B, Taheri M, Hashemizadeh Z, Hashemi FB (2015) Genotypic and Antimicrobial Susceptibility of Carbapenem-resistant Acinetobacter baumannii: Analysis of is Aba Elements and bla OXA-23-like Genes Including a New Variant. Front Microbiol 6:1249. https://doi.org/10.3389/fmicb.2015.01249
Behdad R, Pargol M, Mirzaie A, Karizi SZ, Noorbazargan H, Akbarzadeh I (2020) Efflux pump inhibitory activity of biologically synthesized silver nanoparticles against multidrug-resistant Acinetobacter baumannii clinical isolates. J Basic Microbiol 60:494–507. https://doi.org/10.1002/jobm.201900712
Carmen GomezArrebola C, Solano I Lasa (2021) Regulation of gene expression by nonphosphorylated response regulators. International Microbiology Published online: 13 May 2021. https://doi.org/10.1007/s10123-021-00180-2
Cartelle Gestal M, Zurita J, Gualpa G, Gonzalez C, Paz YMA (2016) Early detection and control of an Acinetobacter baumannii multi-resistant outbreak in a hospital in Quito, Ecuador. J Infect Dev Ctries 10(12):1294–1298. https://doi.org/10.3855/jidc.7544
Chen D, Xie J, Chen H, Yang Y, Zhan Z, Liang L et al (2016) Infection in Southern Chinese Patients with Systemic Lupus Erythematosus: Spectrum, Drug Resistance, Outcomes, and Risk Factors. J Rheumatol 43(9):1650–1656. https://doi.org/10.3899/jrheum.151523
Chen Y, Gao J, Zhang H, Ying C (2017) Spread of the blaOXA-23-Containing Tn2008 in Carbapenem-Resistant Acinetobacter baumannii Isolates Grouped in CC92 from China. Front Microbiol 8:163. https://doi.org/10.3389/fmicb.2017.00163
del Mar Tomas M, Cartelle M, Pertega S, Beceiro A, Llinares P, Canle D et al (2005) Hospital outbreak caused by a carbapenem-resistant strain of Acinetobacter baumannii: patient prognosis and risk-factors for colonisation and infection. Clin Microbiol Infect 11(7):540–546. https://doi.org/10.1111/j.1469-0691.2005.01184.x
Ece G, Erac B, Yurday Cetin H, Ece C, Baysak A (2015) Antimicrobial Susceptibility and Clonal Relation Between Acinetobacter baumannii Strains at a Tertiary Care Center in Turkey. Jundishapur J Microbiol 8(2):e15612. https://doi.org/10.5812/jjm.15612
Freire MP, de Oliveira Garcia D, Garcia CP, Campagnari Bueno MF, Camargo CH, Kono Magri ASG et al (2016) Bloodstream infection caused by extensively drug-resistant Acinetobacter baumannii in cancer patients: high mortality associated with delayed treatment rather than with the degree of neutropenia. Clin Microbiol Infect 22(4):352–358. https://doi.org/10.1016/j.cmi.2015.12.010
Gao L, Lyu Y, Li Y (2017) Trends in Drug Resistance of Acinetobacter baumannii over a 10-year Period: Nationwide Data from the China Surveillance of Antimicrobial Resistance Program. Chin Med J 130(6):659–664. https://doi.org/10.4103/0366-6999.201601
Hammoudi D, Moubareck CA, Hakime N, Houmani M, Barakat A, Najjar Z et al (2015) Spread of imipenem-resistant Acinetobacter baumannii co-expressing OXA-23 and GES-11 carbapenemases in Lebanon. Int J Infect Dis 36:56–61. https://doi.org/10.1016/j.ijid.2015.05.015
He C, Xie Y, Fan H, Kang M, Tao C, Zhang R et al (2011) Spread of imipenem-resistant Acinetobacter baumannii of European clone II in Western China. Int J Antimicrob Agents 38(3):257–260. https://doi.org/10.1016/j.ijantimicag.2011.04.015
Jiang M, Liu L, Ma Y, Zhang Z, Li N, Zhang F et al (2016) Molecular Epidemiology of Multi-Drug Resistant Acinetobacter baumannii Isolated in Shandong, China. Front Microbiol 7:1687. https://doi.org/10.3389/fmicb.2016.01687
Jiang M, Zhang Z, Zhao S (2014) Epidemiological characteristics and drug resistance analysis of multidrug-resistant Acinetobacter baumannii in a China hospital at a certain time. Polish journal of microbiology 63(3):275–281
Ji S, Chen Y, Ruan Z, Fu Y, Ji J, Fu Y et al (2014) Prevalence of carbapenem-hydrolyzing class D beta-lactamase genes in Acinetobacter spp. isolates in China. Eur J Clin Microbiol Infect Dis 33(6):989–997. https://doi.org/10.1007/s10096-013-2037-z
Koh TH, Sng LH, Wang GC, Hsu LY, Zhao Y (2007) IMP-4 and OXA beta-lactamases in Acinetobacter baumannii from Singapore. J Antimicrob Chemother 59(4):627–632. https://doi.org/10.1093/jac/dkl544
Lin T, Tang CG, Li QH, Ji J, Ge HY, Zhang XY et al (2015) Identification of aac(2')-I type b aminoglycoside-modifying enzyme genes in resistant Acinetobacter baumannii. Genet Mol Res 14(1):1828–1835. https://doi.org/10.4238/2015.March.13.11
Li Y, Cao X, Ge H, Jiang Y, Zhou H, Zheng W (2018) Targeted surveillance of nosocomial infection in intensive care units of 176 hospitals in Jiangsu province, China. J Hosp Infect 99(1):36–41. https://doi.org/10.1016/j.jhin.2017.10.009
Li Y, Pan C, Zhao Z, Zhao Z, Chen H, Lu W (2013) Effects of a combination of amlodipine and imipenem on 42 clinical isolates of Acinetobacter baumannii obtained from a teaching hospital in Guangzhou, China. BMC Infect Dis 13:548. https://doi.org/10.1186/1471-2334-13-548
Mahamat A, Bertrand X, Moreau B, Hommel D, Couppie P, Simonnet C et al (2016) Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008–2014. Int J Antimicrob Agents 48(1):51–55. https://doi.org/10.1016/j.ijantimicag.2016.03.006
Mariana Bitrian CM, Solari, Rodrigo H, González, Clara B, Nudel (2012) Identification of virulence markers in clinically relevant strains of Acinetobacter genospecies. Int Microbiol 15:79–88. https://doi.org/10.2436/20.1501.01.161
Martins AF, Kuchenbecker R, Sukiennik T, Boff R, Reiter KC, Lutz L et al (2009) Carbapenem-resistant Acinetobacter baumannii producing the OXA-23 enzyme: dissemination in Southern Brazil. Infection 37(5):474–476. https://doi.org/10.1007/s15010-009-9003-9
Molter G, Seifert H, Mandraka F, Kasper G, Weidmann B, Hornei B et al (2016) Outbreak of carbapenem-resistant Acinetobacter baumannii in the intensive care unit: a multi-level strategic management approach. J Hosp Infect 92(2):194–198. https://doi.org/10.1016/j.jhin.2015.11.007
Munoz-Price LS, Weinstein RA (2008) Acinetobacter infection. N Engl J Med 358(12):1271–1281. https://doi.org/10.1056/NEJMra070741
Neves FC, Clemente WT, Lincopan N, Paiao ID, Neves PR, Romanelli RM et al (2016) Clinical and microbiological characteristics of OXA-23- and OXA-143-producing Acinetobacter baumannii in ICU patients at a teaching hospital, Brazil. Braz J Infect Dis 20(6):556–563. https://doi.org/10.1016/j.bjid.2016.08.004
Ning NZ, Liu X, Bao CM, Chen SM, Cui EB, Zhang JL et al (2017) Molecular epidemiology of bla OXA-23 -producing carbapenem-resistant Acinetobacter baumannii in a single institution over a 65-month period in north China. BMC Infect Dis 17(1):14. https://doi.org/10.1186/s12879-016-2110-1
Novovic K, Mihajlovic S, Vasiljevic Z, Filipic B, Begovic J, Jovcic B (2015) Carbapenem-resistant Acinetobacter baumannii from Serbia: revision of CarO classification. PLoS One 10(3):e0122793. https://doi.org/10.1371/journal.pone.0122793
Peng H, Tao XB, Li Y, Hu Q, Qian LH, Wu Q et al (2015) Health care-associated infections surveillance in an intensive care unit of a university hospital in China, 2010–2014: Findings of International Nosocomial Infection Control Consortium. Am J Infect Control 43(12):e83–e85. https://doi.org/10.1016/j.ajic.2015.07.023
Rapee Thummeepak P, Kongthai U, Leungtongkam S, Sitthisak (2016) Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii clinical isolates. Int Microbiol 19:121–129. https://doi.org/10.2436/20.1501.01.270
Ruan Z, Chen Y, Jiang Y, Zhou H, Zhou Z, Fu Y et al (2013) Wide distribution of CC92 carbapenem-resistant and OXA-23-producing Acinetobacter baumannii in multiple provinces of China. Int J Antimicrob Agents 42(4):322–328. https://doi.org/10.1016/j.ijantimicag.2013.06.019
Shamsizadeh Z, Nikaeen M, Nasr Esfahani B, Mirhoseini SH, Hatamzadeh M, Hassanzadeh A (2017) Detection of antibiotic resistant Acinetobacter baumannii in various hospital environments: potential sources for transmission of Acinetobacter infections. Environ Health Prev Med 22(1):44. https://doi.org/10.1186/s12199-017-0653-4
Shimose LA, Masuda E, Sfeir M, Berbel Caban A, Bueno MX, dePascale D et al (2016) Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces. Infect Control Hosp Epidemiol 37(7):777–781. https://doi.org/10.1017/ice.2016.69
Shoja S, Moosavian M, Rostami S, Farahani A, Peymani A, Ahmadi K et al (2017) Dissemination of carbapenem-resistant Acinetobacter baumannii in patients with burn injuries. J Chin Med Assoc 80(4):245–252. https://doi.org/10.1016/j.jcma.2016.10.013
Wang H, Wang J, Yu P, Ge P, Jiang Y, Xu R et al (2017) Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing. Int J Mol Med 39(2):364–372. https://doi.org/10.3892/ijmm.2016.2844
Wang Y, Shen M, Yang J, Dai M, Chang Y, Zhang C et al (2016) Prevalence of carbapenemases among high-level aminoglycoside-resistant Acinetobacter baumannii isolates in a university hospital in China. Exp Ther Med 12(6):3642–3652. https://doi.org/10.3892/etm.2016.3828
Wen JT, Zhou Y, Yang L, Xu Y (2014) Multidrug-resistant genes of aminoglycoside-modifying enzymes and 16S rRNA methylases in Acinetobacter baumannii strains. Genet Mol Res 13(2):3842–3849. https://doi.org/10.4238/2014.May.16.9
Wu W, He Y, Lu J, Lu Y, Wu J, Liu Y (2015) Transition of blaOXA-58-like to blaOXA-23-like in Acinetobacter baumannii Clinical Isolates in Southern China: An 8-Year Study. PLoS One 10(9):e0137174. https://doi.org/10.1371/journal.pone.0137174
Zhou K, Tang X, Wang L, Guo Z, Xiao S, Wang Q et al (2018) An Emerging Clone (ST457) of Acinetobacter baumannii Clonal Complex 92 With Enhanced Virulence and Increasing Endemicity in South China. Clinical infectious diseases: an official publication of the Infectious Diseases Society of America 67(suppl_2):S179–Ss188. https://doi.org/10.1093/cid/ciy691
Zhou Y, Wu X, Zhang X, Hu Y, Yang X, Yang Z et al (2015) Genetic Characterization of ST195 and ST365 Carbapenem-Resistant Acinetobacter baumannii Harboring blaOXA-23 in Guangzhou, China. Microb Drug Resist 21(4):386–390. https://doi.org/10.1089/mdr.2014.0183
Zong Z, Lu X, Valenzuela JK, Partridge SR, Iredell J (2008) An outbreak of carbapenem-resistant Acinetobacter baumannii producing OXA-23 carbapenemase in western China. Int J Antimicrob Agents 31(1):50–54. https://doi.org/10.1016/j.ijantimicag.2007.08.019

Table 1. Primer sequences used in this study for detecting resistance genes.

Target gene	Sequence 5'→3'	Annealing temp. (°C)	Amplicon size (bp)
bla_TEM-1	ACCCAGAAACGCTGGTGAAA	57	724
	TGACTCCCCGTCGTGTAGAT
bla_shv	TTATCTCCCTGTTAGCCACC	55	795
	GATTTGCTGATTTCGCTCGG
bla_IMP	AATTGAGAAGCTTGAAGAAGGCG	56	621
	TTAACAGCCTGCTCCCATGT
bla_VIM-2	AGTCTCCACGCACTTTCAT	57	505
	CACAACCACCATAGAGCACA
bla_NDM-1	GGTTTGGCGATCTGGTTTTC	55	621
	CGGAATGGCTCATCACGATC
bla_ADC	TAAACACCACATATGTTCCG	58	663
	ACTTACTTCAACTCGCGACG
bla_OXA51	TCCAAATCACAGCGCTTCAA	57	703
	TCGAACAGAGCTAGGTATTCCTTT
bla_OXA23	TTTCTGGTTGTACGGTTCAGCA	57	646
	AACCAGCCCACTTGTGGTTTT
bla_OXA24	GTTTCTCTCAGTGCATGTTCATCT	55	664
	CCCAACCAGTCAACCAACCT
bla_OXA58	CCAATCGGCTTTTTCTTCAGCA	56	837
	TCATCACCAGCTTTCATTTGCAT
aac(6')-Ib	TTGCGATGCTCTATGAGTGGCTA	57	482
	CTCGAATGCCTGGCGTGTTT
ant(3”)-I	GCCATACAGCGATATTGATTTG	58	306
	AAGGCAACGCTATGTTCTCTTG
aph(3’)-I	CGTTGCCAATGATGTTACAGAT	58	333
	TTACGCTCGTCATCAAAATCAC
armA	TGAAAAGGTTGTTTCCATTTCTGA	57	669
	TCATTCCCTATAACCTTCGAATCA

Table 2 Antimicrobial susceptibility profiles of A. baumannii isolates.

Antibiotics	Resistance		Intermediate		Susceptible		MIC range	MIC₅₀	MIC₉₀
Antibiotics	n	Rate (%)	n	Rate (%)	n	Rate (%)	MIC range	MIC₅₀	MIC₉₀
FEP	89	93.68	0	0.00	6	6.32	1-64	64	64
CRO	88	92.63	7	7.37	0	0.00	1-64	64	64
IPM	89	93.68	0	0.00	6	6.32	1-16	16	16
GEN	85	89.47	2	2.11	8	8.42	1-16	16	16
TOB	82	86.32	0	0.00	13	13.68	1-16	16	16
LVX	51	53.68	36	37.90	8	8.42	0.25-8	4	8
CIP	90	94.74	0	0.00	5	5.26	0.25-4	4	4
SXT	77	81.05	0	0.00	18	18.95	1-16	16	16
TZP	79	83.16	4	4.21	12	12.63	4-28	128	128

Table 3. Classification of MDR A. baumannii isolates based upon ERIC-PCR and genotypic profiles.

Cluster	n (%)	Subtype (n)	Resistance genes^a	Resistance patterns (R+I)^b
A	86 (90.35)	Ai (55)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA, aph(3’)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT (40)
				FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT (6)
				FEP, CRO, IPM, GEN, TOB, LVX, CIP (5)
				FEP, CRO, IPM, GEN, TOB, LVX, CIP (4)
				FEP, CRO, IPM, GEN, TOB, CIP (1)
		Aii (22)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA, aph(3’)-I, aac(6’)-Ib, ant(3”)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT (20)
				FEP, CRO, IPM, GEN, TOB, LVX, CIP (1)
				FEP, CRO, IPM, GEN, TOB, LVX, CIP (1)
		Aiii (2)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA, aac(6’)-Ib, ant(3”)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT
		Aiv (1)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA, ant(3”)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP
		Av (1)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, aph(3’)-I, ant(3”)-I	FEP, CRO, IPM, GEN, LVX, CIP, SXT
		Avi (1)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA, aac(6’)-Ib, ant(3”)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT
		Avii (2)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, armA	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT
		Aviii (1)	bla_OXA51, bla_ADC, bla_OXA23, bla_TEM-1, aph(3’)-I	FEP, CRO, IPM, LVX, CIP, SXT
		Aix (1)	bla_OXA51, bla_ADC, bla_OXA23, ant(3”)-I	FEP, CRO, IPM, LVX, CIP
B	1 (1.05)	–	bla_OXA51, bla_ADC, bla_OXA23, armA	FEP, CRO, IPM, SXT
C	1 (1.05)	–	bla_OXA51, bla_ADC	CRO
D	1 (1.05)	–	bla_OXA51, bla_ADC, aph(3’)-I, ant(3”)-I	CRO, GEN, LVX, CIP, SXT
E	1 (1.05)	–	bla_OXA51, bla_ADC	CRO, CIP
F	1 (1.05)	–	bla_OXA51, bla_ADC, bla_TEM-1	FEP, CRO, IPM, GEN, TOB, LVX, CIP, SXT
G	1 (1.05)	–	bla_OXA23, bla_TEM-1, armA, aph(3’)-I	FEP, CRO, IPM, GEN, TOB, LVX, CIP
H	1 (1.05)	–	bla_OXA51, bla_ADC, aph(3’)-I	CRO
I	1 (1.05)	–	bla_OXA51, bla_ADC	CRO
J	1 (1.05)	–	bla_OXA51, bla_ADC	CRO, CIP, SXT

^aAll isolates were tested negative for bla_SHV, bla_VIM-2, bla_IMP, bla_NDM,, bla_OXA58,bla_OXA24;

^bR+I: Resistant and intermediate;

Resistance Traits and Molecular Characterization of Multidrug-resistant Acinetobacter baumannii Isolates from an Intensive Care Unit of a Tertiary Hospital in Guangdong, Southern China

Status:

Journal Publication

Version 1

Abstract

Figures

Declarations

Introduction

Materials And Methods

Results

Discussion

Conclusion

References

Tables

Status:

Journal Publication

Version 1