Patients and clinical sample collection
From 2017 to 2019, we harvested CCA and paired non-tumor tissue samples from 60 patients without receiving chemotherapy or radiotherapy before the study. After retrieval we placed samples in liquid nitrogen instantly. We provided informed consent for the involved, and our research gained approval by the Ethics Committee of Lishui Hospital of Zhejiang University.
Cells and cell culture
We purchased human CCA cell lines (TFK-1, SNU-869, RBE, HuCCT1 and HuH28), normal human intrahepatic biliary cell (HIBEC), and HEK293T cells from the Chinese Academy of Scien ces (Shanghai, China). We maintained cells in a humidified atmosphere at 37 °C and 5% CO2 in RPMI-1640 (Gibco, Grand Island, NY, USA), which contains 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, CA, USA). We cultivated HEK293T cells in 10% FBS DMEM/high glucose medium. All cell lines were passaged for less than 6 months.
circRNAs Microarray and Data Analysis
With Arraystar Human circRNA Array V2 we analyzed three pairs of CCA and non-tumor tissue samples. With the NanoDrop ND-1000 we quantified total RNA from each sample. In conformity with the Arraystar’s standard protocols we conducted the microarray hybridization and sample preparation. In brief, we digested total RNAs with Rnase R (Epicentre Technologies, Madison, WI, USA) for removing linear RNAs and enriching circular RNAs. Afterward, with a random priming method (Arraystar Super RNA Labeling Kit; Arraystar) we amplified the enriched circular RNAs and transcribed them into fluorescent cRNA. We hybridized the labeled cRNAs onto the Arraystar Human circRNA Array V2 (8x15K, Arraystar). With the Agilent Scanner G2505C we scanned the arrays after washing the slides. For analyzing obtained array images, we used Agilent Feature Extraction software (version 11.0.1.1). We performed subsequent data processing and quantile normalization with the R software limma package. We performed hierarchical clustering for demonstrating the difference of circRNAs expression pattern in the midst of the samples.
Cell transfection
We purchased pLVX-EF1α, PLKO.1-puro and plasmid vectors from BioVector NTCC Inc., Guangzhou, China. A shRNA sequence that targeted circ-0006302 and a negative shRNA control sequence were designed and synthesized, and we cloned them into PLKO.1-puro. The sequences which encode circ-0006302, PD-L1, and a negative control were also synthesized, and cloned into pLVX-EF1α. We purchased the miR-1299 mimics and miR-1299 inhibitor from RIBOBIO, Guangzhou, China. We cultured cells for 24 hours, and transfected them with plasmids via Lipofectamine 3000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA), per manufacturer’s instructions. We harvested cells to conduct RNA extraction after 48 hours. We performed the experiments in triplicate.
RNA extraction and Quantitative real-time polymerase chain reaction (qRT-PCR)
Centrifugation was performed at 4 °C. From the upper aqueous phase, we obtained the isopropanol precipitates at room temperature (20–25 ºC), then based on the TRIzol total RNA manual (Invitrogen, Carlsbad, CA, USA) we rinsed and dried them. Consequently, DEPC-treated water was added and for each sample we calculated the RNA concentration. At -80 °C we stored the RNA. Via the OneStep PrimeScript® miRNA cDNA Synthesis Kit (Takara) we generated cDNA, per manufacturer's instructions. SYBR Green I fluorescence method was applied to conduct RT and we carried out PCR detection. We utilized primer sequences listed in Table 1. 2-△△Ct for calculating the relative concentration of the samples. We performed the experiments in triplicate.
Table 1
Sequences of primers for qRT-PCR
Name
|
Sequence
|
|
circ-0006302
|
Forward
|
5’- GCTGGGCAGGAAAACCTATT-3’
|
Reverse
|
5’- TTTCCCAGGTCTCTGTCTGG -3’
|
|
E-cadherin
|
Forward
|
5’- GCTGGACCGAGAGAGTTTCC -3’
|
|
Reverse
|
5’- CAAAATCCAAGCCCGTGGTG -3’
|
Vimentin
|
Forward
|
5'- CGGGAGAAATTGCAGGAGGA -3'
|
|
Reverse
|
5'-AAGGTCAAGACGTGCCAGAG-3'
|
Snail
|
Forward
|
5'-TCGGAAGCCTAACTACAGCGA-3'
|
|
Reverse
|
5'-AGATGAGCATTGGCAGCGAG-3'
|
miR-1299
|
Forward
|
5'-ACACTCCAGCTGGGAGGGAGUGUGUCUUAA-3'
|
|
Reverse
|
5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTCTGGAT -3'
|
PD-L1
|
Forward
|
5'- GGTGAGGATGGTTCTACACAG -3'
|
Reverse
|
5'- GAGAACTGCATGAGGTTGC -3'
|
|
RNase R digestion
3 units of RNase R (Epicentre Biotechnologies) per 1 μg circ-0006302 were added and at 37 °C we incubated the mixture for 15 minutes. Consequently, qRT-PCR was performed to assess the levels of GAPDH and circ-0006302.
Western blotting
Total cell lysates were prepared in 1× sodium dodecyl sulfate (SDS) buffer. By polyacrylamide gel electrophoresis we separated protein lysates and transferred them onto nitrocellulose membranes. In 5% non-fat milk we blocked membranes, then incubated them with primary antibodies to PD‐L1 (ab205921; 1: 1000), E-cadherin (ab40772; 1:10000), Snail (ab216347; 1: 1000), and vimentin (ab45939; 1: 1000) at 4 °C overnight. Afterward, we incubated them with goat anti-rabbit secondary antibody (Abcam, Shanghai, China). We performed the experiments in triplicate.
Cell counting kit-8 assay
We utilized cell Counting Kit-8 (Beyotime Inst Biotech, China) to assess cell proliferation. In brief, into 96-well plates we seeded 5 × 103 cells/well. The cells were transfected with appropriate plasmids and controls after 24 hours. To assess proliferation a microplate reader (Bio-Rad, Hercules, CA, USA) (absorbance wavelength 450 nm) was used. We performed the experiments in triplicate.
Colony formation assay
In 6-well plates we seeded cells and in media containing 10% FBS we cultured them. The cells were fixed with methanol after 14 days, and with 0.1% crystal violet (Sigma-Aldrich) we stained them, then we counted clones. We performed the experiments in triplicate.
Ethynyl-2-deoxyuridine (EdU) incorporation assay
Ethynyl-2-deoxyuridine incorporation assay (EdU Apollo DNA in vitro kit, RIBOBIO, Guangzhou, China) was utilized to identify cell proliferation, per manufacturer's instructions. In brief, we added 100 μl of 50 μM EdU/well after transfecting cells with plasmids, and incubated the cells at 37 °C for 2 hours. Fluorescence microscopy was used for determining proliferation. We performed the experiments in triplicate.
Wound healing and transwell invasion assays
We cultured the different groups of CCA cells (1 × 106 cells/well) up to 90% confluency and with a sterile pipette tip (100 μl) we scratched the monolayer of cells in individual wells. We cultured the cells continually for 24 h and imaged them at 0 and 24 h post scratching with a digital camera (Leica, Heerburg, Germany). By the distance of migration into the denuded area we assessed the extent of wound healing.
TranswellTM chambers coated with Matrigel were utilized. We resuspended cells (5 × 104/L) in 200 μL serum-free medium and seeded them into the upper chambers. To the lower chambers 600 μL complete medium were added. We wiped cells that remained on the upper filter surface away after 48 hours at 37 °C. With formaldehyde we fixed cells migrated to the bottom of the filter and with crystal violet we stained them. Under an Olympus fluorescence microscope (Tokyo, Japan) we counted the cella.
RNA fluorescent in situ hybridization (FISH)
In short, we placed the cover glasses on the bottom of a 24‐well plate, and cultured the cells with 6 × 104 cells per well. We waited until the cell confluence reached about 60%–70%, then we fixed them in 4% paraformaldehyde and with the precooled permeation reagent (1 ml/well) we permeabilized them. With the prehybridization solution (20 μl/well) we sealed the cells and hybridized them with the Stellaris RNA FISH solution (Biosearch Technologies, Petaluma, CA), which contains the probe for circ-0006302. Then we rinsed the cells by lotion I, lotion II, lotion III, and 1× PBS ultimately. Consequently, we stained the cells for 10 min with FAM fluorescent dye liquor. Finally, with a mounting agent (like nail polish) we fixed the cover glasses on the glass slides, and under a fluorescence microscope (Olympus) we viewed them for fluorescence detection.
Dual-luciferase reporter assays
We established and amplified circ-0006302 wild type or PD-L1 wild type, which contained mutant sequences with target sites deletion or designed miR-1299 binding sites before they were cloned into the pRL-TK plasmid (Promega) vector. After that, HEK293T cells were seeded (2×104 cells/well) into 96-well plates. We co-transfected the cells with the luciferase plasmids (0.1 μg/well) and miR-1299 mimics or controls. We assessed firefly and renilla luciferase activity using the Dual-Luciferase Reporter Assay System (Promega) after two days as mentioned above.
Tumor xenograft implantation in nude mice
From Beijing HFK Bioscience, Beijing, China we gained male BALB/c nude mice (4 weeks old). In compliance with the institutional guidelines of Lishui Hospital of Zhejiang University, we designed the protocol and in obedience to the Use Committee for Animal Care we implemented the animal studies. In serum-free medium we suspended the stable transfection of RBE cells (1×107 cells/ml) with circ-0006302 or vector, and injected the cells in the right flank of the mice subcutaneously. After injection we assessed the tumors every 7 days. We calculated tumor volumes (as a rotational ellipsoid) with length × width2 × 0.5. 4 weeks later we sacrificed the mice and tumors weights were recorded.
Immunohistochemistry
Stained with H&E, representative areas were evaluated. With antibodies to Ki-67 (ab15580) (Abcam, Shanghai, China) we performed immunohistochemistry per manufacturer's instructions.
Statistical analyses
We performed the paired Student's t-test for detecting the differential expression of circ-0006302 and miR-1299 between CCA tissues and para-cancerous normal tissues. We then evaluated the deviations by one-way ANOVA or unpaired Student's t-test (other 2-group comparisons) before the post hoc Bonferroni test (multigroup comparisons) as appropriate. Via the Kaplan–Meier survival curves and log-rank test we analyzed the overall survival rates. Also, by Pearson’s correlation analysis we validated the relationships between circ-0006302 and PD-L1. By Fisher’s exact test we analyzed the association between circ-0006302 expression and clinicopathological characteristics of CCA patients. We displayed the data as the mean ± standard deviation; if p < 0.05 statistical significance was considered. All statistical tests were performed with SPSS version 19.0 software (SPSS Inc. Chicago, IL, USA).