Materials. B. striata was obtained from Seng Chang Pharmaceutical Co., Ltd., (Taoyuan, Taiwan). Aβ42 peptides were synthesized by Gendanio Biotech Inc. (New Taipei City, Taiwan). 2,7-dichlorodihydrofluorescein diacetate (DCFDA) and aluminum chloride were purchased from Sigma Aldrich (St Louis, MO, USA). The RT-PCR primers were synthesized by MDBio Inc. (Taipei, Taiwan). The anti-BACE1 antibody and the Aβ (C-Terminal) antibody were purchased from Merck (Darmstadt, Germany) and Proteintech (Illinois, USA), respectively. The Aβ42 peptides were purchased from ASIA BIOSCIENCE CO., LTD., Taiwan.
BSP Extraction and Purification. In the study, a new method was developed to extract BSP at low temperature by combining the cold extraction method with the vacuum system at 0.5 atm to retain the bioactivity of BSP. Briefly, the as-received B. striata was chopped into pieces and ground to dry powder. Then 100 g B. striata dry powder was homogenized and dispersed by double distilled water in a low-pressure container at 25 oC for 4 h. The solution was then centrifuged at 10000 g for 10 min; the supernatant was collected and precipitated by adding 3000 mL 95% (v/v) ethanol and allowed to stand for overnight. Afterward, the solution was filtered using a filter paper, and the precipitate was lyophilized and kept in a desiccator for later use. Subsequently, 100 g extracted dried powder was resuspended in 1800 mL distilled water and then mixed with 600 mL Sevage reagent (n-butanol: chloroform = 1:4); the solution was magnetically stirred overnight. On the next day, the mixture was centrifugated at 6000 rpm for 10 min, and the supernatant was collected and dialyzed using an MWCO-3500 dialyzer (Thermo Scientific™, CA, USA) against double-distilled water to remove n-butanol. The final extract was lyophilized to obtain BSP.
The Characterization of Extracted BSP by Fourier-transform Infrared (FTIR) Spectroscopy and Nuclear Magnetic Resonance (NMR). The FTIR analysis was carried out by mixing 10 mg BSP with KBr at a ratio of 1:9 and then pressing it into a disc in an aluminum ring at10 MPa. After that, the ring was mounted on an FTIR spectrophotometer (Spectrum 100 FTIR Spectrometer, PerkinElmer, USA) at the wavenumber range of 450 to 4000 cm-1 and 400 nm/min scanning rate.
The molecular structure of BSP was analyzed by 1H NMR and 13C NMR spectra measurements. BSP was dissolved by Chloroform-d (CDCl3) at a concentration of 50 mg/mL, and then the spectra were recorded on a Bruker ARX-600 instrument (600 MHz, Bruker Co., Ltd. Switzerland).
Preparation of Aβ Fibrils. The Aβ42 peptides were dissolved in hexafluoro-2-propanol (HFIP, Oakwood Products, Estill, SC, USA) for monomerization to obtain a final concentration of 1 mM. Then the Aβ42-HFIP solution was transferred to Eppendorf tubes in aliquots and kept at 25 oC to evaporate HFIP, and then stored at −80°C for later use.
Immediately before use, the monomerized Aβ42 peptides in Eppendorf tubes were completely resuspended in 5 mM in anhydrous dimethyl sulfoxide (DMSO, catalog number D-2650, Sigma) by pipette mixing, and diluted to 100 μM with DMEM medium addition (Dulbecco’s modified Eagle’s medium, Sigma). It was homogenized in a shaker at 37°C for 7 days to aggregate into Ab fibrils, the final concentration of Ab fibrils was 100 μM 19, 20.
Measurements of Thioflavin T Fluorescence. Thioflavin T (ThT), a commonly used probe to monitor Ab fibril formation emits fluorescence upon binding to Ab fibrils and the intensity of fluorescence is used to measure the concentration of Ab fibrils. To monitor the aggregation of Aβ42 into Ab fibrils, 10 μM Aβ42 peptides were added to phosphate-buffered saline (PBS, pH 7.4) at 37°C and transferred onto 96-well plates (Bio-One, Greiner) containing 10 μM ThT. The fluorescence intensity at 485 nm was measured by an ELISA reader (Infinite 200Pro, Tecan) under an excitation wavelength of 440 nm, after 1, 4, 7, 11, and 14 days.
Transmission Electron Microscopy (TEM). A 400-mesh copper grid covered with Formvar and carbon (01754-F) was obtained from Ted Pella, INC, Taiwan. Ten microliters of Aβ42 (10 mM) were dropped onto the copper grids and dried at room temperature. It was then stained with 10 μL 1% (w/v) uranyl acetate (UA) for 20 s. The grid was washed with 10 μL distilled water two times and dried at room temperature. The images of aggregated Ab fibrils at different time intervals (day 7 and day 14) were examined using a transmission electron microscope (TEM, Hitachi H7650) operated at an acceleration voltage of 70 kV.
Evaluation of Cell Viability. The effects of BSP on cell viability were evaluated by the water-soluble tetrazolium (WST-1) assay (TaKaRa, Kusatsu, Shiga, Japan) using the N2a cell lines obtained from Bioresource Collection and Research Center (Hsinchu, Taiwan). The N2a cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma) containing 1% Antibiotic-Antimycotic (Gibco) and 10% Fetal bovine serum (FBS, Hyclone) and incubated at 37 °C and 5% CO2 in a 95% humidified incubator 21.
The overall process was based on the regulation of ISO 10993-5. Prior to the assessment, first, the extraction solution was obtained by soaking 1 mg/mL BSP in 10 mL culture medium for a day. In addition, the pre-cultured N2a cells were seeded onto 96-well plates with a density of 1×104 cells/well and cultured for one day. Subsequently, the extraction solution was added into the culture wells and further cultured for one day. After that, 200 μL WST-1 reagent was added into each well and incubated at 37°C for 2 h. The OD value of each well was determined at 450 nm by using an ELISA plate reader (SpectraMax iD3, Molecular Devices, Inc, USA). The cell viability was calculated using the following formulae:
Zinc diethyldithiocarbamate (ZDEC, Sigma-Aldrich) and aluminum oxide (Sigma-Aldrich) were used as positive and negative controls, respectively. The cells cultured only in the fresh medium were used as the control group. The observations were repeated six times (n = 6) in each group.
Evaluation of Cytotoxicity. Cytotoxicity was evaluated using the LIVE/DEAD staining kit (L3224, Invitrogen) according to the manufacturer’s instructions. Briefly, 0.2 g BSP and Aβ-BSP were immersed in 1 mL culture medium at 37 °C for 24 h, respectively, and the medium was used as the extracted medium for subsequent experiments. As described earlier, the pre-cultured N2a cells were seeded on a 24-well plate at a density of 2 × 104 cells/well and incubated for 24 h. Afterward, the 100 μL extracted medium was added to each well, followed by the simultaneous addition of 10 μM Aβ fibrils and 1 mg/mL BSP, and cultured for 1 day. Subsequently, 2 μM calcein AM and 4 μM ethidium homodimer-1 (EthD-1) was added to each well and incubated at 37°C for 30 min to stain the live and dead cells, respectively. Finally, the LIVE/DEAD staining was observed using a fluorescence microscope (IX81, Olympus) at excitation and emission wavelengths of 488 nm and 515 nm, respectively. N2a cells cultured in the extracted medium only were used as the control group. ZDEC and aluminum oxide were used as positive and negative controls, respectively.
Determination of Cellular ROS Generation. The ability of BSP to diffuse ROS induced by Aβ fibrils was measured by a 2’,7’ –dichlorofluorescin diacetate (DCFDA)-cellular ROS detection assay kit (ab113851, Abcam). In brief, N2a cells were seeded on 96-well plates at a density of 2.5 ×104 cells/well and cultured for 1 day. Afterward, 1 mg/mL BSP and 10 μM Aβ fibrils were added to each well to induce ROS generation. On the next day, the medium was removed and washed with PBS. Subsequently, a culture medium containing 20 μM DCFDA was added to each well and further cultured for 45 min. The fluorescence intensity representing the ROS level induced by Aβ fibrils was detected using a multimode microplate reader (Molecular Devices, SpectraMax i3x, USA). The excitation and emission wavelengths were 495 and 535 nm, respectively.
Gene Expression Analysis. To assess the anti-inflammatory effects of BSP, we analyzed the expression levels of three inflammatory-related genes— tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-10 (IL-10) — using BV-2 as target cells. The relative expressions of the genes were estimated from three experimental groups—(1) control group: BV-2 cells seeded on 96-well plate with a density of 1 × 105 cells/mL were cultured without any treatment, (2) Aβ group: BV-2 cells at 1 × 105 cells/mL were cultured and treated with 10 μM Aβ fibrils, and (3) Aβ-BSP group: BV-2 cells at 1 × 105 cells/mL were cultured and treated with 1 mg/mL BSP and 10 μM Aβ fibrils.
Total RNA was extracted using Qiazol reagent (Qiagen, Valencia, CA) following the manufacturer’s protocol. Random hexamers (Vivantis Inc., California) and reverse transcriptase (Vivantis Cat No: RTPL12) were used for the first‐strand cDNA synthesis with the following PCR parameters: 95°C for 3 min (denaturation), 40 cycles of 95°C for 20 s, 60°C for 30 s (annealing), and 72°C for 30 s (elongation). The real‐time RT‐PCR was performed using the TOOLS 2X SYBR qPCR Mix (Biotools Co., Ltd., Taipei, Taiwan) on a CFX Connect Real-Time PCR Detection System (Bio-Rad, CA, USA). The specific primers (Biotools Co., Ltd., Taipei, Taiwan) used for real‐time RT‐PCR are shown in Table 1. The changes in expression of the target genes were calculated using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an endogenous control.
Table 1. Primers used for gene expression analysis
Name
|
Sequence
|
TNF-α- Forward
|
5’- CATCTTCTCAAAATTCGAGTACAA -3’
|
TNF-α- Reverse
|
5’-TGGGAGTAGACAAGGTACAACCC -3’
|
IL-6- Forward
|
5’-GGAGCCCACCAAGAACGATAGTCA -3’
|
IL-6- Reverse
|
5’-GAAGTAGGGAAGGCCGTGGTT -3’
|
IL-10- Forward
|
5’-TAAGGCTGGCCACACTTGAG -3’
|
IL-10- Reverse
|
5’-GTTTTCAGGGATGAAGCGGC -3’
|
GAPDH-Forward
|
5’- TGCTGAGTATGTCGTGGAGTCT -3’
|
GAPDH-Reverse
|
5’- AATGGGAGTTGCTGTTGAAGTC -3’
|
AlCl3-induced AD Rat Model to Develop Alzheimer’s Disease (AD). Eight-week-old Sprague Dawley (SD) male rats were purchased from BioLASCO Taiwan Co., Ltd. (Taipei City, Taiwan). All experiments were carried out in compliance with the National Taiwan University College of Medicine’s Institutional Animal Care and Use Committee (IACUC no. 20130429). We maintained the animals according to the Guide for the Care and Use of Laboratory Animals. The behavioral tests performed were approved by the Animal Ethics Committee of the National Taiwan University Hospital, Taiwan.
AD was induced by intraperitoneal (IP) injection of AlCl3 (7446-70-0, Sigma-Aldrich) (100 mg/mL AlCl3 dissolved in normal saline) three times a week as described in a previous study 22. The SD rats (n=18) were randomly categorized into 3 groups with 6 rats per group: (1) Control group: rats injected with normal saline, (2) AlCl3 group: rats injected with AlCl3 (100 mg/kg body weight) three times every week and consecutively for eight weeks, (3) AlCl3-BSP group: rats were injected with AlCl3 (100 mg/kg body weight), and then treated with BSP (10 mg/kg/day) by oral administration during the AD induction period. At the end of the experiment (after 8 weeks), the rats were subjected to the Morris Water Maze test to assess their memory and cognitive functions. The blood was collected to assess the hematological parameters, and serological analysis to check the safety. The cortex and hippocampus were harvested after sacrificing the rats using CO2 for western blotting and histological examination.
Morris Water Maze Test. The Morris water maze was used to assess working and spatial memory retention in the rats following a previous study 23. Briefly, the circular pool was divided into four quadrants, with a submerged platform placed in one of the quadrants. For each training session, the rat was gently placed in water at a different drop location and allowed to find the submerged platform; the rat was guided toward the platform if it could not find the platform within 2 min. Once the platform was reached, the rat was allowed to stay on it for 30 s. The training was continued in each quadrant for four consecutive days. After four training sessions, the time taken by the rat to reach the escape platform was recorded using the EthoVision software (Noldus Information Technology, Wageningen, Netherlands). The retrieval tests of working and spatial memories were performed as described in a previous study 24. To assess the spatial memory, we recorded the time taken (s) by each rat to reach the escape platform from their initial position, whereas working memory was assessed from the time spent (s) by the rat in the same quadrant (maximum 120 s) without the escape platform 25.
Blood Analysis. The safety in vivo would be evaluated by blood element analysis and serological analysis. Blood from the rats was collected by cardiac punctures at the end of the experiment. Serum was obtained by centrifuging the collected blood samples at1500 rpm at 4°C for 15 min. The collected serum samples were stored at −80°C for subsequent analyses. For biochemical tests, alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and lactate dehydrogenase (LDH) in serum were measured following a previously described method 26. For hematological parameter analysis, red blood cells (RBC), hemoglobin (HGB), hematocrit (HCT), mean cell volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), reticulocytes (RET), platelets (PLT), white blood cells (WBC), neutrophil (NEUT), lymphocytes (LYMPH), monocytes (MONO), eosinophils (EO), and basophils (BASO) were measured. Blood element and serum were measured by the National Taiwan University Veterinary Hospital, Taiwan. Reference: Charles River Laboratories, CD® IGS Rat Model Information Sheet 26, 27.
Western Blotting. The total protein was extracted from hippocampus and cortex tissues of the experimental animals using RIPA lysis buffer (89900, Thermo Fisher, USA) containing a protease inhibitor cocktail. The protein concentration was measured by the Bradford protein assay kit (Z5030028, BioChain Institute Inc., CA USA). The samples were resolved with equal amounts of protein (25 µg) using 12% SDS-PAGE. Three samples from each group were washed, lysed, and equal amounts of protein were separated and transferred onto a polyvinylidene difluoride membrane (Millipore, Burlington, MA, USA), blocked, and incubated with primary antibodies against (Anti-BACE1, cat. no. ab183612; dilution, 1:500, and anti-β-actin, T5168, Sigma-Aldrich; dilution, 1:5000). BACE1 protein was visualized by enhanced chemiluminescence. The band intensity of BACE1 protein was used to evaluate the recovery conditions of rats from AD.
Histological Analysis and Immunohistochemical (IHC) Staining. The cortex and hippocampus harvested from the experimental rats were treated with a series of alcohol and fixed by 4% glutaraldehyde. The specimens were then bisected and embedded in paraffin. Subsequently, the paraffin-embedded tissue blocks were cut into 5 μm thick sections, placed on the glass slides and stained with BACE1 immuno-histochemical anti-body. Hematoxylin and eosin (H&E) stain was used for contrast imaging. The slides were then deparaffinized and rehydrated with 0.1% hydrogen peroxide (Sigma-Aldrich, USA) in PBS solution for 10 min to block the endogenous peroxidases. For retrieval, nonspecific background staining was blocked by 20 μg/mL proteinase K (Sigma-Aldrich, USA) solution. The solution containing the slides was incubated in a humidified chamber at 37 ºC for 20 min. Primary antibody, Aβ [C-Terminal] antibody obtained from 25524-1-AP, Proteintech, was diluted with 1% BSA in a ratio of 1:500 v/v. The diluted primary antibody was then applied to the slides and incubated at 4 ℃ overnight. After incubation, the tissue sections were washed by TBS containing 0.025% Triton-X 100 with gentle agitation. The sections were further incubated in 1% BSA containing goat anti-rabbit HRP IgG secondary antibody at 1: 5000 (v/v) dilution. Finally, the sections were further treated with 3, 3’-diaminobenzidine (DAB, Sigma-Aldrich, USA) substrate solution as an enhancer to reveal more clear colors under the optical microscope.
Statistical Analyses. The data are expressed as mean ± standard deviation (SD). All statistical analyses were done using one-way ANOVA, where the p-values less than 0.05 were considered statistically significant.