Honeybees and Varroa mites
A.cerana and A. mellifera colonies were maintained with the standard beekeeping practice in Guangdong Institute of Applied Biological Resource, Guangzhou, China. Freshly capped larvae (the 5th stage) of A. mellifera and A. cerana were randomly collected from colonies without chalkbrood and foulbrood symptoms according to the published method [9, 26]. V. destructor mature female mites were collected from worker pupae in A. mellifera hives, using a soft camel hairbrush. The hives were not been treated with acaricides. Approximately 20 mites were placed in sterile petri dishes (diameter = 9 cm) and used for RNA extraction and bioassays within one hour.
Virus and microsporidia loads
Viruses and microsporidia loads were examined from honeybee by RT-PCR amplification using the sequences of 16 bee viruses available from NCBI (acute bee paralysis virus [ABPV], chronic bee paralysis virus [CBPV], deformed wing virus [DWV], Kashmir bee virus [KBV], sacbrood virus [SBV] and Israeli acute paralysis virus [IAPV], black queen cell virus [BQCV], A. mellifera filamentous virus [AmFV], Big Sioux River virus [BSRV], Lake Sinai virus complex [LSV], slow bee paralysis virus [SBPV], V. destructor macula-like virus [VdMLV]), cloudy wing virus [CWV], Apis iridescent virus [AIV], Varroa destructor virus 1 [VDV-1], Moku virus [MV] and Chinese Sacbrood Virus [CSBV], together with two microsporidia parasites (Nosema apis and Nosema ceranae). Total RNA was isolated from honeybees, mite saliva and mites using RNAqueous kits (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The PCR reaction mixtures (25 µL volume in total) containing 4 mM MgCl2, 100 µM dNTPs, 0.4 µM forward and reverse primers (Table 1) [9], 2 units of Taq DNA polymerase (5 U/µL, Sangon Biotech Co., Ltd., Shanghai, China) and 1 µL template DNA were performed in a C1000 TM Thermal Cycler PCR system (Bio Rad, Hercules, California, USA)with the following parameters: initial denaturation at 95 °C for 3 min; followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 60 °C for 30 s; and a final extension at 72 °C for 10 min. The amplicons of the expected bands were verified from a 1% agarose gel and visualized after SYBR green staining with an imaging system (Sagecreation Science co., Beijing, China). The PCR product was purified using a gel extraction kit (Promega, Madison, WI, USA) and subcloned into a pGEM-T Easy Vector (Promega) before transformation into Escherichia coli DH5α-competent cells (Takara, Kyoto, Japan). Five independent positive clones were selected using a blue-white screen and sequenced in both directions using an Applied Biosystems 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA) at Sangon Biotech Co., Ltd (Shanghai, China).
Table 1
Primer list for the detection of the viruses and microsporidia
Virus | Organism Primer sequences | References |
1. Deformed Wing Virus (DWV) | F: GACAAAATGACGAGGAGATTGTT | (Yang & Cox-Foster 2005) |
R: CAACTACCTGTAATGTCGTCGTGTT |
2. Acute Paralysis Bee Virus (APBV) | F: TTATGTGTCCAGAGACTGTATCCA | (Chen et al. 2006) |
R: GCTCCTATTGCTCGGTTTTTCGGT |
3. Chronic Bee Paralysis Virus (CBPV) | F: AGTTGTCATGGTTAACAGGATACGAG | (Chen et al. 2006) |
R: TCTAATCTTAGCACGAAAGCCGAG |
4. Black Queen Cell Virus (BQCV) | F: TGGTCAGCTCCCACTACCTTAAAC | (Chen et al. 2006) |
R: GCAACAAGAAGAAACGTAAACCAC |
5. Kashmir Bee Virus (KBV) | F: GATGAACGTCGACCTATTGA | (Chen et al. 2006) |
R: TGTGGGTTGGCTATGAGTCA |
6. Sacbrood Virus (SBV) | F: GCTGAGGTAGGATCTTTGCGT | (Chen et al. 2006) |
R: TCATCATCTTCACCATCCGA |
7. ApismelliferaFilamentous Virus (AmFV) | F: CAGAGAATTCGGTTTTTGTGAGTG | (Hartmann et al. 2015) |
R: CATGGTGGCCAAGTCTTGCT |
8. Big Sioux River Virus (BSRV) | F: RGTGCAGCTTTATGCGTTGCC | (Charles et al. 2011) |
R: CCGCTGTTGAGAATAAGGATATCCAGG |
9. Lake Sinai Virus complex (LSV) | F: GCCWCGRYTGTTGGTYCCCCC | (Ravoet et al. 2013) |
R: GAGGTGGCGGCGCSAGATAAAGT |
10. Slow Bee Paralysis Virus (SBPV) | F: GATTTGCGGAATCGTAATATTGTTTG | (de Mir&a et al. 2010) |
R: ACCAGTTAGTACACTCCTGGTAACTTCG |
11. Varroa destructor Macula-like virus (VdMLV) | F: ATCCCTTTTCAGTTCGCT | (Parmentier et al. 2015) |
R: AGAAGAGACTTCAAGGAC |
12. Israeli Acute Paralysis Virus (IAPV) | F: AGACACCAATCACGGACCTCAC | (Maori et al. 2009) |
R: AGATTTGTCTGTCTCCCAGTGCACAT |
13. Cloudy Wing Virus (CWV) | F: ATCAGCGCTTAGTGGAGGAA | (Hong et al. 2011) |
R: TCGACAATTTTCGGACATCA |
14. Apis IridescentVirus(AIV) | F: GGCTAGTAAACGTAGTGGATATGACAAT | (Chantawannakul et al. 2006) |
R: CACCTGGTGGTCCAAGAGAAG |
15. Varroa destructor Virus 1 (VDV-1) | R: CTTCCAAGGGCTCATCCATA | (Zioni et al. 2011) |
F: CATGGAAATGGGATCAAACC |
16. Moku Virus (MV) | F: GTGCGATAGCTAAGCCTGAGATGG | (Mordecai et al. 2016) |
R: CAGTGCCCCCTATAGGTGTTGTT |
17. Chinese Sacbrood Virus (CSBV) | F: CCTGGGAAGTTTGCTAGTATTTACG | (Chen et al. 2006) |
R: CCTATCACATCCATCTGGGTCAG |
18.Nosema.apis | F: CCATTGCCGGATAAGAGAGT | (Li et al. 2012) |
R: CCACCAAAAACTCCCAAGAG |
19.Nosema.ceranae | F: GACAACAAGGAAGACCTGGAAGTG | (Li et al. 2012) |
R: TGTGAATAAGAGGGTGATCCTGTTGAG |
Larvae injection with recombinant VTP
VTP gene was obtained from the Varroa mites, and the expression and purification of recombinant VTP were conducted as previously described [9]. The purified recombinant VTP was injected into the 5th stage larvae according to the described method [9]. Briefly, a 0.2-µL aliquot of the purified recombinant-VTP at a concentration of 0.2 µg/mL was injected into the hemocoel of an A. mellifera or A. cerana larva near the end of the abdomen, by using pulled glass capillary needles in conjunction with a Harvard micro-injector system (IM-31, Narishige, Tokyo, Japan). Negative controls, such as uninjected bees (= CK) and bees injected with only sterile PBS (= PBS) or only the needle puncture, were established, with 3 replicates per each treatment.
After injection, larvae were reared in 48 well culture plates under regulated conditions (34 ± 1◦C temperature, 80% relative humidity and 16 h light/8 h dark photoperiod) without microbial infection and bled larvae were discarded. From each treatment, 10 live larvae were randomly collected 12, 24 or 48 h post-treatment, frozen in liquid nitrogen and stored at -80 °C for RNA extraction.
Expression profile of larval immune genes after VTP injection
Three immune genes (abaecin, domeless and defensin) were used to evaluate the immune response of the injected larvae by using qRT-PCR with the primers in Table 2. Housekeeping β-actin gene was used in the internal reference to normalize the target gene expression. Each reaction (20 µL volume) contained 1 µL (10 ng) cDNA template, 0.8 µL 10 µM forward/reverse primers, 10 µL 2X FastStart Essential DNA Green Master™ (Roche, Shanghai, China) and 7.4 µL RNase-free water. qRT-PCR was performed on a Rotor Gene Q Real Time Thermal Cycler (Qiagen, Hilden, Germany) with the following parameters: initial denaturation for one cycle at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, and 60 °C for 30 s. The qRT-PCR was repeated three times, and the independent RNA sample preparation consisted of three technical replicates.
Table 2
Primers used for VTP gene and qRT-PCR of the immune genes in this study.
Primer Name | Primer sequences 5'- 3' | Application |
VTP-F | GAATTCATGTTCAAACTTCTCGTTATCG | Protein expression |
VTP-R | AAGCTTTTAGGAGGCGAGCGCCTGCTGGA |
Abaecin-F | CAGCATTCGCATACGTACCA | qRT-PCR |
Abaecin-R | GACCAGGAAACGTTGGAAAC | |
Defensin-F | GTTGAGGATGAATTCGAGCC | qRT-PCR |
Defensin-R | TTAACCGAAACGTTTGTCCC | |
Domeless-F | TTGTGCTCCTGAAAATGCTG | qRT-PCR |
Domeless-R | AACCTCCAAATCGCTCTGTG | |
β-Actin -F | GCCCAATCCAAAAGAGGTAT | qRT-PCR Reference gene |
β-Actin -R | TCAAAGGTGCTTCCGTTAGT | |
Microbiota analysis of the larval hemolymph after VTP injection
The A. mellifera and A.cerana live larvae were collected after 12, 24 or 48 h post-treatments of VTP injection, PBS injection, injection only (needle puncture) or control (without any treatment). Prior to honeybee larvae dissection, the larvae were disinfected to remove external microbes with 75% ethanol and then rinsed 3 times with sterile ultra-pure water [17]. The larval abdomen was faced up in a sterile petri plate. After a small hole was carefully made using a sterile sharp-billed tweezers, the hemolymph (usually 30–60 µL from each larva) was collected with a pipette in a sterile tube. Three replicates with 10 larvae for each replicate were established for each treatment. The collected hemolymph was spread using the sterile L-rod onto the plates (diameter = 9 cm) respectively containing five growth media: TSA (tryptone 15 g, peptone 5 g, NaCl 5 g, agar 15 g, 1L distilled water, pH 7.2; TSA + 5% Sheep serum (TSA medium was heated evenly, then cooled to about 50 °C, and 5 ml of sterilized decalcified sheep serum (Sigma-Aldrich, Germany) were added into 100 mL TSA medium); HIA (Heart Infusion Agar) (Beef heart infusion 10 g, tryptone 10 g, NaCl 5 g, agar 15 g, and 1L distilled water; PDA (Potato Dextrose Agar) (Potato 200 g, sucrose 20 g, agar 15 g and 1L distilled water, pH 6.0;Gaoshi No.1 (Soluble starch 20 g,KNO3 1 g,K2HPO40.5 g,MgSO4•7H2O 0.5 g, NaCl 0.5 g,FeSO4 • 7H2O0.01 g, agar 15 g and distilled water 1L, pH 7.4).The plates were incubated respectively in anaerobical (5% CO2) and aerobical conditions at 36 °C and 80% relative humidity for 2 days. Bacterial colonies grew on different media plates (no fungal colonies were detected) were selected based on size, color, and morphology. The selected colonies were repeatedly streaked individually on fresh LB agar plates to obtain pure bacterial cultures. The resulting colonies were cultured in liquid LB and kept at -80 °C with 15% glycerol.
To identify the bacterial isolates from the plates, genomic DNA of each isolate was extracted, and bacterial 16S rRNA gene was amplified with the general bacterial primers 28F 5’-GAGTTTGATCNTGGCTCAG-3’ and1392R 5’--ACGGGCGGTGTGTRC-3’ [27, 28]. The PCR mixture contained 5 µL of 10 × Pfu buffer,4 µL of dNTP mixture (2.5 mM), 1 µL of eachprimer (10 µM), 2 µL of deionized formamide, 1 µL of MgCl2 (25 mM), 1 µL of genomic DNA, and0.5 µL of Pfu DNA polymerase in a total volumeof50 µL. PCR amplification was performed in aTGradient thermocycler (Applied Biosystems).The PCR condition was 10 min at 95 °C, followed by 25 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 45 sec, and 2 min for elongation at 72 °C; and a final extension step of 72 °C for 10 min. PCR products of different bacterial isolates were sequenced by Sangon Biotech Co., Ltd., (Shanghai, China).The resulting sequences were compared with the data set in NCBI GenBank.
Data analysis
The relative value of the gene expression was analyzed by the comparative CT method (2ˉ∆∆CT) [29]. All the graphs were performed using Prism 6.0 for Windows (GraphPad, La Jolla, CA, USA, www.graphpad.com). Percentage data were arcsine square-root transformed prior to statistical analysis by one-way ANOVA with SPSS 16.0 software (SPSS Inc., Chicago, IL, USA). Means were separated using Tukey’s test. Differences among means were considered significant at P < 0.05.