Cell culture
Two human ESCC cell lines, KYSE150 and TE-1, were obtained from the Chinese Academy of Sciences (Shanghai, China), and Eca109 cells were from Wuhan University(Wuhan, China).The three cell lines were cultured in RPMI-1640 (Invitrogen, Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA) and 1% penicillin-streptomycin (Gibco;Thermo Fisher Scientifc, Inc.). All the ESCC cell lines were cultured in a 5% CO2 humidified incubator at 37°C.
Tissue microarray
Tissue microarrays of clinical samples consisted of ESCC and paired normal adjacent tissues (NAT) .One tissue microarray included 34 paired cases of ESCC and matched NAT (catalog number: # HEsoS180Su08; Outdo Biotech, Shanghai, China), and another 50 additional independent , subjected to esophagectomy, obtained from the First Affiliated Hospital of Xinjiang Medical University. Tumor tissues and clinicopathological parameters were collected after obtaining the informed consent from each participant involved. The study was approved by Medical Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University( approval number:2018K06–20).
Immunohistochemistry (IHC)
Tissue microarrays were de-waxed and hydrated, boiled in 0.01 M citrate buffer, and treated with 3% hydrogen peroxide after natural cooling. The primary polyclonal rabbit anti CALM1(catalog number: #10541-1-AP; dilution at 1:400; Proteintech, Wuhan, China), EGFR (catalog number: # 18986-1-AP ;1:600; Proteintech), cleaved caspase-3(Catalog number: 19677-1-AP, dilution at 1:200; Proteintech, Wuhan, China) and Ki-67(Catalog number: 27309-1-AP, dilution at 1:10000; Proteintech, Wuhan, China) were incubated overnight in 4°C by adding drop of glass slide, followed by treatment with biotinylated anti-rabbit secondary antibody (Catalog number:# ZLI‐9032, Zhongshan Jinqiao Biotechnology) for 60 min at 37°C. overnight in 4°C. The immunostainings results were evaluated by two pathologists (Qing Liu and Xiaomei Lu) under optical microscopy and cellular sub-localization of immunostaining was assessed in each section. The intensity of staining was divided into four grades (0, none; 1, weak; 2, moderate; and 3, strong) and percentage of positive cells (0, <10%; 1, 10%-25%; 2, 25%-50%; and 3, >50%). According to the immunoscoring (staining intensity plus positive cell score), ESCC patients were divided into two groups, specifically "low expression "(total score,0-3) and" high expression "(total score ,4-6), which were used to analyze the prognostic significance of EGFR and CALM1 in ESCC.
CRISPR-Cas9 knock-out construction and lentiviral transfection
The LentiCRISPR P2A-GFP-CALM1 CRISPR/Cas9 construct was outsourced to Shanghai Genechem Co Ltd (Shanghai, China). Lentiviruses carrying green fluorescent protein (GFP) is along with scrambled Lv-sgRNA-control (sgCtrl) and CALM1 sgRNA (Lv-sgCALM1-1, Lv-sgCALM1-2, and Lv-sgCALM1-3). A suitable amount of lentivirus was added to the culture medium of ESCC for transduction, according to the multiplicity of infection (MOI), and the cells were incubated further for 8 h. After 72 hours, all fluorescent cells were sorted via flow cytometry and transfection efficiency was evaluated by Western blots and Quantitative real-time polymerase chain reaction (qRT-PCR). The sgRNA target sequences we used were as follows: sgCALM1-1(GACGGACAAGTCAACTATGAA), sgCALM1-2 (CGTGAGGCATTCCGAGTCTTT), sgCALM1-3(AGAAGCTGAATTGCAGGATAT), and sgRNA control (TTCTCCGAACGTGTCACGT).
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was extracted with TRIzol reagent and then reversely transcribed into cDNA using a Pria Revert Aid First Strand cDNA Synthesis Kit(catalog number: #A5001,promega). Following the manufacturer’s protocols, Real-time PCR was performed using a SYBR Green Premix PCR Master Mix(catalog number: #DRR041B, TAKARA). Relative mRNA expression of CALM1 and EGFR was calculated using the 2-ΔΔCt method after being normalized to GAPDH, which served as internal loading control. PCR was performed with the following primer sets: CALM1 forward, 5'‑GGTCAGAACCCAACAGAA‑3' and reverse, 5'‑AGACTCGGAATGCCTCA‑3'; and EGFR forward, 5'‑AGGCACGAGTAACAAGCTCAC‑3' and reverse, 5'‑ATGAGGACATAACCAGCCACC‑3'. GAPDH forward, 5'‑TGACTTCAACAGCGACACCCA‑3' and reverse, 5'‑CACCCTGTTGCTGTAGCCAAA‑3'.all experiments were performed independently three times and shown was the representative one.
Western blots
The cells were lysed on ice with the RIPA (Radio Immunoprecipitation Assay) lysis buffer (Thermo Fisher Scientific, USA) for 30 min to prepare the cell suspension, followed by centrifugation at 14000 rpm for 10 min at 4°C. The protein concentration was determined with bicinchoninic acid protein assay (Thermo Fisher Scientific, USA), 0.1 mg total protein were subjected to 10% SDS-PAGE separation and then transblotted to PVDF membranes (Millipore, Billerica, MA,USA). The membrane was blocked in 5% nonfat milk for 1 hour at room temperature, and then incubated with the primary antibodies. Target proteins were detected by using specific antibody against CALM1 (catalog number: #10541-1-AP; dilution at1:800; Proteintech Group, Wuhan, China). GAPDH (catalog number:10494-1-AP; dilution at1:5000, Proteintech Group, Wuhan, China) was chosen as an internal control and the CALM1 and GAPDH dilutions were incubated at 4°C with gentle shaking overnight. Then, secondary antibody (goat anti-rabbit, catalog number:SA00002-2, Proteintech Group, Wuhan, China) were added onto the membrane for incubation at room temperature for 2h.The blots were visualized with Pierce™ ECL Western Blotting Substrate (Thermo Fisher Scientific, CA, USA), according to the manufacturer's protocol.
MTT assay
Cells were placed into the 96-well plates at the density of 4×104/mL in RPMI-1640. At the designated time point, the cells were coated with 100 μL sterile MTT (Sigma-Aldrich) in an incubator with 5% CO2 for 4 h at 37°C. Afatinib was added with the desired drug treatment concentrations ranging from 0 to 20 μM and incubated for 72 h. The reaction waster was performed by removing the culture medium and then adding 100 μL of dimethyl sulfoxide (Sigma-Aldrich) for 0.5 h to dissolve the formaldehyde. Finally, absorbance values were measured at 490 nm. The IC50 (half-maximum inhibitory concentration) was used as the measure of relative cytotoxicity.
Apoptosis assay and cell cycle
After transfection with sgCtrl and sgCAML1-1 with or without EGFR inhibitor for 72 h, ESCC were collected after washing twice with PBS. For cell cycle, cells were fixed in 70% ice-cold ethanol overnight, then washed twice with PBS and stained with 10μg/mL RNase A in the dark for 15 min at room temperature. The analysis was performed by a flow cytometer (BD FACS Calibur; BD Biosciences, Brea, CA, USA). For analysis of apoptotic cells, it was analyzed by flow cytometry using an FITC Annexin V Apoptosis Detection Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions after harvesting cells.
Transwell assay
Cells were added in the upper well of a Transwell chamber (8μm pore size) that was pre–coated with 50 µL Matrigel (BD, Bedford, MA). Cells at a density of 1×105 cells per well were placed into the upper chambers in 600 μL serum-free RPMI 1640 containing 10 % FBS, and the cells were incubated at 37 °C in a CO2 incubator(5 % CO2). After 24 hours, non–invaded cells on the upper chamber of the filter were scraped off with swabs. The migrated cells on the lower chamber were fixed with 4% formaldehyde for 10 min, and stained with 0.1 % crystal violet for 15 min. Finally, the number of invaded cells were photographed under a light microscope and counted using Image J software (NIH, Bethesda, MA, USA).
Wound healing assay
ESCC cells (5 × 104) were seeded in 6-well plates to reach more than 90% confluence. The samples were then scratched manually using a pipette tip. After scratching with a sterile pipette tip, removal of cell debris by washing 3 times with PBS, the wounded cell samples were then cultured in serum-free medium. Images were acquired at 0 h, 4 h, 8 h and 24 h post scratching by using a microscope. Four wound areas were photographed on each plate and counted under an Olympus inverted fluorescence phase-contrast microscope (Tokyo, Japan). Then the percentage of wound closure was calculated by the following formula: wound closure (%) = (original gap distance-gap distance at the indicated time)/original gap distance × 100%. wound healing assay was performed independently three times, with each group assayed in triplicate.
Colony formation assay
KYSE150 and Eca109 cells transfected with sgCtrl , sgCALM1-1 were plated in 6‑well plates (1000 cells/well) and incubated at 37°C for 14 days to allow colony formation. In the drug treatment group, the medium was changed with fresh medium containing Afatinib or vehicle (DMSO) every 2 days. The cell medium was subsequently removed. Cells were washed using PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were stained with crystal violet kit (Beyotime Institute of Biotechnology, Shanghai, China) for 15 min at room temperature. The colonies were washed, photographed by camera and counted using ImageJ software. Colony formation experiment was performed independently three times, with each group assayed in triplicate.
Tumorigenesis in nude mice and in vivo imaging
Nude mice (4 weeks old) were purchased from Shanghai Lingchang Biological Technology Co., Ltd. All animals (22±1.5 g) were handled according to the Guide for the Care and Use of Laboratory Animals and were housed at a controlled temperature (22-28˚C) and humidity (50%) under a 12-h light/dark cycle. All mice were randomly divided into three groups: sgCtrl group, sgCAML1-1 group, sgCAML1-1 plus EGFR inhibitor group. Then, the stably cells (4x106 for each side) were suspended in PBS and implanted subcutaneously into male BALB/c nude mice. Animals in the sgCAML1-1plus EGFR inhibitor group treated with 20 mg/kg paclitaxel every 3 days once when tumor size reached about 100 mm3 intraperitoneally (i.p.). After 7 days, the tumor weight was measured every 3 days for 4 weeks. After 27 days of monitoring, in vivo imaging of animals before they are sacrificed and the tumors were dissected and weighted.
Statistical analysis
Data were expressed as the mean ± standard deviation (SD), using SPSS for Windows version 19.0 (SPSS, Inc., Chicago, IL, USA). Student t test or one-way analysis of variance (ANOVA) was used to evaluate the differences among groups, and chi-square and Fisher's exact tests were applied to analyze correlation between CALM1/EGFR expression and clinicopathological characteristics. The Kaplan-Meier survival curve and log rank test were used to plot the survival curves and estimate survival rates. A two-tailed P < 0.05 was taken as significant in all tests.