Visualizing Sphingosine-1-Phosphate Receptor 1(S1P1) Signaling During Central Nervous System De- and Re-Myelination

doi:10.21203/rs.3.rs-657784/v1

Download PDF

Research Article

Visualizing Sphingosine-1-Phosphate Receptor 1(S1P₁) SignalingDuringCentral Nervous System De- and Re-Myelination

https://doi.org/10.21203/rs.3.rs-657784/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system (CNS) mediated by aberrant immune responses. The current immune modulatory therapies are unable to protect and repair the brain damage caused by the immune attack. One of the therapeutic targets for MS is the sphingosine-1-phosphate (S1P) pathways, which signals via sphingosine-1-phosphate receptors 1-5 (S1P_1-5), in the CNS and immune cells. In light of the potential neuro-protective properties of S1P signaling, we utilized the S1P₁-GFP (Green fluorescent protein) reporter mice in the cuprizone-induced-demyelination model, to investigate the in vivo S1P- S1P₁ signaling in the CNS. We observed S1P₁ signaling in a subset of neural stem cells in the subventricular zone (SVZ) during demyelination. Additionally, oligodendrocyte progenitor cells in the SVZ and mature oligodendrocytes in the medial corpus callosum (MCC) expressed S1P₁ signaling during remyelination. We did not observe S1P₁ signaling in neurons and astrocytes in the cuprizone model. This approach was unable to determine S1P₁-GFP signaling in the myeloid cells because of their aberrant GFP expression in GFP reporter mice. Significant S1P₁ signaling was observed in lymphocytes during demyelination and inflammation. Our findings reveal β-arrestin dependent S1P₁signaling in oligodendrocyte lineage cells, indicating a role of S1P₁ signaling during remyelination.

Molecular Biology

Neurology

Multiple sclerosis

demyelination

oligodendrocyte

sphingosine-1-phosphate receptor 1 and GFP reporter mice

Multiple sclerosis (MS) is a chronic, progressive, inflammatory demyelinating disease of the

central nervous system (CNS) affecting more than two million young adults worldwide [1]. The pathological hallmarks of MS are CNS inflammation and dysregulated auto-reactive immune response [2]. Chronic neuroinflammation results in myelin loss, axonal damage and eventually neurodegeneration [3, 4]. Brain atrophy is observed in the very early stages of MS and secondary progression is associated with significant neurodegeneration [5, 6]. Current immune-modulatory therapies successfully suppress relapses but fail to halt progression and irreversible disability accumulation, indicating that mechanisms other than autoimmunity and aberrant immune response contribute to disease progression. Over time, approximately 80% of MS patients develop irreversible neurological disability and thereby become refractory to immunomodulatory therapies.Recognizing mechanisms dictating demyelination and repair in the CNS is essential to limit CNS injury, enhance repair and prevent permanent damage.

Sphingosine-1-phosphate (S1P) is a signaling molecule and has important regulatory functions in normal physiology and disease processes, particularly in cardiovascular, central nervous and immune systems. It can act as an intracellular mediator as well as a ligand for five specific high-affinity S1P receptor subtypes (S1P_1–5). S1P and its receptors (S1P_1-5) are crucial targets for immune regulatory functions such as lymphocyte development, egression, and adaptive immune response [7, 8]. S1P receptors are lipid G protein-coupled receptors (GPCRs) and express ubiquitously in all CNS cells [9, 10]. Previous reports reveal that, astrocytes express S1P_1,2,3,5, oligodendrocytes express S1P_1,3,5 and microglia express S1P_1,2,3,5[10-12]. However, the mechanism of S1P signaling in the CNS remains unclear, due to receptor diversity, variation in expression levels, different signaling pathways and complex signaling functions. The recognition of S1P signaling in the CNS is important since multiple S1P receptor-specific modulators are in the pipeline for treatment of neurological disorders.

Clinical studies suggest that S1P receptor modulators directly affect the CNS beyond their immune modulatory function. For instance, Fingolimod (FTY720) is a S1P_1,3,4,5 modulator and a first-line immune modulatory therapy for relapsing-remitting MS [13]. Fingolimod enhances the production of various neuroprotective factors such as the brain-derived neurotrophic factor (BDNF) in microglia [14], while also increasing GABAergic transmission, cortical parvalbumin positive interneurons, axonal growth and regeneration [15-17]. FTY720 prevents dendritic spine loss and PSD-95 down-regulation in the hippocampus and attenuates Amyloid-b production in neurons [16, 18-20]. In MS, Fingolimod protects the brain from atrophy and halts disability progression; a feature lacking in most other therapies [20-22]. EXPAND studies indicate that Siponimod, a selective S1P_1,5 modulator, could reduce neurological injuries and progression of brain atrophy in secondary progressive MS [23, 24]. Increasing of S1P levels in cerebrospinal fluid, and a decrease of S1P in white matter and CNS lesions of MS patients further highlight the involvement of S1P signaling in neurodegeneration and inflammation [25, 26]. Taken together, these findings strongly suggest that S1P signaling is dysregulated in MS and that S1P targeting drugs may have direct beneficial effects on the CNS, independent of their immune modulatory function. However, whether S1P signaling has direct protective effects or whether it prevents inflammatory CNS damage via its immune modulatory function has not been clearly evaluated.

The present study aimed to investigate S1P₁ (S1P receptor 1) signaling during demyelination and repair in the CNS using GFP signaling mice, which are a potent model to reveal CNS signaling pathways. The cuprizone-induced demyelination model is a well-accepted model of CNS de- and re-myelination in the absence of overwhelming CNS inflammation caused by the peripheral immune response. In this study S1P₁-GFP signaling mice were exposed to a cuprizone diet for six weeks to induce demyelination followed by remyelination upon reintroduction of a regular diet. To analyze S1P₁-GFP signaling in the context of inflammatory demyelination, Experimental Autoimmune Encephalomyelitis (EAE) mice were utilized.

Our results revealed that upon cuprizone-induced demyelination a subtype of neural stem cells (Sox2⁺ cells) in the SVZ express S1P₁ signaling. During remyelination, a subpopulation of oligodendrocyte progenitor cells (NG2⁺ cells) and mature oligodendrocytes (CC1⁺ cells) express S1P₁. No significant S1P₁ signaling was identified in neurons and astrocytes during de- or remyelination. In both the cuprizone and the EAE models a significant increase in lymphocyte (T and B cells) S1P₁ signaling was revealed by flow cytometry. In both models, myeloid cells showed aberrant GFP expression in GFP reporter mice. S1P₁-GFP signaling mice are an appropriate model to analyze S1P₁ signaling in oligodendrocyte lineage cells during remyelination and lymphocytes in demyelination and inflammation phases.

Experimental Animals

The Tango design mice was used to monitor the S1P₁ signaling (S1P receptor 1) and signaling was visualized by the GFP reporter gene [27]. This model is able to detect S1P₁ signaling through β-arrestin interaction. In the Tango design mice, S1P₁ activation and coupling with β-arrestin released the tetracycline-controlled transactivator (tTA) from the C terminal of S1P₁, activating the histone-EGFP reporter gene (H2B-GFP) [27, 28]. The S1P₁ reporter mice were designed and developed by Kono, et al [27, 28]. Briefly, knock-in (ki) mice (S1P₁ki/ki) were generated with two fusion genes, with S1Pr1 linked to tTA via a TEV protease cleavage site and mouse β-arrestin linked to TEV protease gene. The S1P₁ki/ki mice were crossed with a histone-EGFP reporter mouse (H2B-GFP; Tg(tetO-HIST1H2BJ/GFP)47Efu/J; The Jackson Laboratory), to derive the S1P₁-GFP signaling mice. The transgenic mice expressed the histone H2B-GFP controlled by a tetracycline-responsive element (TRE) upstream of a CMV promoter (Figs. 1a, b). GFP reporter mice with one allele of the H2B-GFP reporter gene was used as a control in our experiments. We used heterozygous knock-in allele (S1P₁ki/wt) mice with one allele of the H2B-GFP reporter gene to assay S1P₁signalingin all of our experiments. These mice showed no phenotypic abnormalities. The mice were housed in groups of 3-5 within a 12-hour light/dark cycle at a controlled temperature with food and water provided ad libitum. All the animal protocols were approved by the Institutional Animal Care and Use Committee at Stanford University.

Polymerase Chain Reaction (PCR)

The S1P₁ knock-in genotypes were determined using PCR analyses of genomic DNA isolated from mouse tails. For genotyping by PCR, three primers were used, including 5′AGAGGAATGTGGGCTGTTGATCCT3′ (primer one for knock-in), 5′AGATGGCGGTAACTCGAGG3′ (primer two for the wild type), and 5′GGTTAGTGGTTGGCGATTAAATGCTGA3′ (primer three as reverse). Primers one and three detected the S1P₁ knock-in allele and amplified a 612-bp fragment. Primers two and three detected the wild type allele and amplified a 405-bp fragment. In total, 40 cycles of 95°C (30 s), 62°C (30 s), and 72°C (45 s) were used for the amplification of these DNA segments. In addition, the GFP-reporter was detected by the two primers, 5`TGTTCTGCTGGTAGTGGTCG3` (reverse) and 5`GCACCATCTTCTTCAAGGACG3` (forward) with a PCR product of 270 bp.

Cuprizone Experiments

The knock-in S1P₁-GFP signaling (H2B-GFP/S1P₁ki/wt) and H2B-GFP reporter (control) mice were fed with 0.2% cuprizone (TD.140800, ENVIGO) for six weeks followed by two weeks of normal chow. Brain and spleen samples were collected at sequential time points during the cuprizone diet (weeks 0, 2, 4, and 6) and after two weeks of normal chow (week 8) (Fig. 1c). Male mice aged 3-4 months were used for all of the experiments (groups of 3-5).

Luxol Fast Blue (LFB) Stain

LFB was applied to brain sections to assess loss of myelin. Brain tissues were placed in 0.1% LFB at 60^oC overnight and then rinsed with 95% ethyl alcohol and distilled water. 0.05% lithium carbonate solution was used to differentiate the stained tissues for 10-30 seconds and further differentiation was performed with 70% ethyl alcohol for 10 seconds. Slides were counterstained with cresyl violet and dehydrated with 75%, 95% and 100% alcohol, cleared in xylene and then coversliped.

Quantitative Label-free Imaging

We used QLIPP, a quantitative label-free imaging method that measures the density and alignment of molecular assemblies using polarized light [29]. The method reports the alignment of molecular assemblies, such as myelin sheath, in terms of retardance. Retardance is the differential delay experienced by light polarized along the axis of the axon and perpendicular to the axon. More precisely, retardance is the difference in the optical path length experienced by light when it is polarized along two orthogonal orientations: along the symmetry axis of the molecular assembly and perpendicular to the symmetry axis of the assembly. Figure 3 demonstrates the use of optical anisotropy from QLIPP to study the amount of myelination in the white-matter region of the mouse brain without fluorescence label. [29].

Immunohistochemistry

Mice were anesthetized by inhalation of isoflurane and perfused with 25 ml phosphate buffered saline (PBS) into the left cardiac ventricle, followed by 25 ml of 4% paraformaldehyde (PFA) in PBS solution. Brains were post-fixed with 4% PFA for 12-16 hours and then transferred to 30% sucrose solution at 4^oC for 2-3 days until the tissue sank to the bottom of the container. Afterwards, the brains were embedded in a tissue freezing medium (Tissue-Tek O.C.T compound 4583, Sakura) and stored at -80°C. A cryostat-microtome (Leica CM 1850, Huston TX) was used for tissue sectioning (12 um) at -20^oC. Slides were stored at -20 or -80^oC until further use.

Immunofluorescence staining was performed to assess S1P₁ signaling in glial and neuronal cells during demyelination and repair using various antibodies, including MBP (AB7349, Abcam,1/300), CD68 (MCA1957GA, AbD Serotec, 1/300), Sox2 (AB5603, Millipore,1/250), Olig2 (MABN50, Millipore,1/400), NG2 (AB5320, Millipore,1/200), GFAP (20334, DAKO,1/700), NeuN (MAB377, Millipore,1/250), CC1 (OPBO, calbiochem,1/300) and EDG1 (ab23695 Abcam,1/150). To complete immunofluorescence, slides were preserved at 37 ^oC for 15-30 minutes and washed twice in PBST (PBS+Tween-20 [0.1%]) for five minutes each time. Sodium citrate buffer (10Mm, PH=6) and heat-induced antigen retrieval method were utilized for Olig2 and CC1 staining. Nonspecific signaling was blocked using 5% serum (normal goat serum [G9023, Sigma]) and the sections were incubated using antibodies diluted in PBS-Triton-100X 0.1% + 1% goat serum and preserved at 4^oC overnight. Secondary antibodies, anti-rat Alexa Flour 555 (A21434, Invitrogen, 1/1000), anti-rabbit Alexa Flour 555 (A21428, Invitrogen, 1/1000), anti-mouse Alexa Flour 555 (A21424, Invitrogen, 1/1000), anti-mouse Alexa Flour 647 (A32728, Invitrogen, 1/1000) and anti-rabbit Alexa Flour 647 (A27040, Invitrogen, 1/1000) were used for labeling. The slides were then counterstained with DAPI and coverslipped. A Keyence microscope (BZ-X700 series) was used to evaluate staining and take pictures. ImageJ software was applied for cell counting and intensity measurements. Blind count and manual counting performed by ImageJ with higher magnification.

EAE Experiments

EAE was induced in male S1P₁ -GFP signaling mice and GFP reporter mice aged 8-12

weeks. According to methods defined by Tsai et al [30, 31], mice were immunized with an emulsion containing 200 micrograms of Complete Freund's Adjuvant (CFA), 100 micrograms of myelin oligodendrocyte glycoprotein (MOG_35-55) peptide35–55, and 200 nanograms of Bordetella pertussis toxin (lot# 181236A1, List Biological Laboratories) on days zero and two. The spleen tissues were collected after eight days of immunization which marked the onset of the clinical EAE symptoms.

GFP Signaling in the Immune Cells Isolated from Brain and Spleen Using Flow Cytometry

Brain and spleen of cuprizone-fed mice were collected at weeks 0, 2, 4, and 6 to analyze S1P₁ signaling in immune cells. In order to evaluate S1P₁ signaling in the inflammatory state, S1P₁ signaling was also examined in the spleen of EAE mice. Immune cells obtained from brain and spleen were isolated as previously reported [32]. Briefly, mice were anesthetized and then perfused with 25 ml cold PBS. The spleens were removed before perfusion and homogenized through a 70-μm cell strainer. Red blood cells (RBC) were lysed by ACK lysing buffer (0.15 M NH₄Cl, 10 mM KHCO₃, and 0.1 M EDTANa₂.H₂O 3.7) for 30-60 seconds and then washed with PBS; 10⁶ cells were used for labeling with antibody. Brains were collected after PBS perfusion and homogenized through a 70-μm cell strainer in sterile PBS and then centrifuged. The pellet was treated with collagenase II (1mg/ml) for 1 hour at 37 °C. The collagenase reaction was stopped by adding PBS to the cells and centrifugation. Immune cells were harvested from a 30% Percoll gradient by centrifugation, and residual red blood cells were lysed by ACK lysing buffer for 5-10 seconds. The immune cells were washed with PBS and 0.5–1 × 106 cells were labeled with individual antibodies and analyzed using the LSRII Flow Cytometer (BD) at the Stanford core Facility. BD FACS Diva 6.0 software was used to acquire data and FlowJo was employed for data analysis (Tree Star). The monoclonal antibodies used in flow cytometry analysis were purchased from the following sources: anti- CD45 (clone 30-F11), anti-CD3 (clone 145-2c11), anti CD4 (clone GK1.5), anti CD8 (clone 53–6.7), anti CD19 (clone 6D5), anti-CD11b (clone M1/70), anti-CD11c (clone N418), anti-Ly6C (clone HK1.4), and anti-Ly6G (clone 1A8). Single color-stained BD-CompBeads (BD Bioscience) were used to set compensation and gating the stained cells. CNS immune cells were gated by multi-dimensional flow cytometry. First, cells were gated into CD45^lo and CD45^hi from live leukocytes. CD45^lo cells represent microglia and CD45^hi represent infiltrating immune cells (Supplementary Fig. 1S). CD45^hi cells were gated to CNS-infiltrating myeloid cells (CD45^hiCD11b⁺) and lymphocytes (CD45^hiCD3⁺). Infiltrating myeloid cells (CD45^hiCD11b⁺) were further gated to monocyte derived dendritic cells (CD45^hiCD11b⁺Cd11c⁺) and myeloid cells (CD45^hiCD11b⁺CD11c^-). Afterwards CD11b⁺CD11c^- myeloid cells were separated into neutrophils (Ly6C^-Ly6G⁺) and monocytes (Ly6C⁺Ly6G^-). GFP expression was assessed in brain myeloid cells (CD45^hiCD11b⁺),granulocytes (CD11b⁺Ly6C^-Ly6G⁺)andlymphocytes (CD45^hiCD3⁺). Splenic cells were gated as myeloid cells (CD45⁺CD11b⁺) and lymphocytes (CD45⁺CD3⁺), GFP expression was assessed in splenic myeloid cells and lymphocytes. In EAE mice, splenic cells were collected as outline above and were gated as myeloid cells (CD45⁺CD11b⁺), T cells (CD45⁺CD3⁺) and B cells (CD45⁺CD19⁺).

Statistical Analyses

Data analysis was performed in GraphPad Prism 8 and results are expressed as mean standard error of the mean (SEM). Unpaired t-test was applied for the statistical analysis of the two study groups, and statistical significance was determined by calculating the P-value (*P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001).

Validation of Cuprizone-Induced Demyelination in S1P1-GFP Signaling Mice

Cuprizone causes immediate damage to the oligodendrocytes which consequently leads to demyelination [33]. To validate demyelination in the S1P1-GFP signaling mice following exposure to cuprizone diet, myelin basic protein (MBP) intensity was measured in the medial corpus callosum (MCC) and oligodendrocytes in the MCC were counted. ImageJ was used for cell counting and measuring of MBP intensity. The results indicated a significant decrease in MBP intensity in the medial corpus callosum after 4 weeks of cuprizone diet, ***p<0.001 (Figs. 2a, C). LFB test was carried out, indicating a reduction in myelin after 4 weeks of cuprizone diet (Fig. 2b). In addition, we used a quantitative label-free imaging method, QLIPP, to measure the optical anisotropy (retardance), which arises from ordered molecular structures such as myelin, for visualizing the distribution of myelin in MCC without a label [29]. Label free imaging of myelination indicates a significant difference in retardance (myelination level) in MCC after 4 weeks of cuprizone diet (Fig. 3).

Oligodendrocyte number decreased at 2 weeks of cuprizone diet and returned to normal at 4 weeks, *p<0.05 (Supplementary, Fig. 2S-a, d). Another important pathological feature of cuprizone-induced demyelination was astrocytosis, the peak of which was observed after 4 weeks of cuprizone diet (Supplementary, Fig. 2S-b). Active myeloid cells (CD68+ cells) were observed in the corpus callosum (CC), hippocampus, amygdala, caudoputamen and septofimberial nucleus at 2 weeks of cuprizone diet (Supplementary, Fig. 2S-c). Furthermore, CD68+ cell number increased in the CC, hippocampus, primary somatosensory cortex, caudoputamen and preoptic area at 4 weeks of cuprizone diet. After 6 weeks of cuprizone diet, CD68+ cells were present in the CC, hippocampus, amygdala, and thalamus. At 8 week (remyelination), CD68+ cells were still observed in the CC, deep layer of the cortex, thalamus, and dorsal hippocampal commissure. In total, myelin loss, astrocytosis, reduced oligodendrocyte number, and increased CD68+ cells confirmed the effects of cuprizone on S1P1-GFP signaling mice.

GFP Signaling in the CNS During Cuprizone-induced de- and re-myelination

Based on the Tango design, S1P1 signaling is visualized by GFP expression. S1P1-GFP signaling was analyzed in CNS glia and neurons during demyelination following exposure to cuprizone diet (weeks 0-6) and upon remyelination (normal diet weeks 6-8) (Fig. 1c). The number of GFP+ cells increased during the cuprizone diet in the CC. After 2 weeks, GFP+ cells appeared in the brain and reached a maximum at week 4. The cells in lateral corpus callosum (LCC) and MCC of the S1P1-GFP signaling mice displayed the highest expression of GFP (Supplementary, Fig. 3S-a, c). GFP signaling was also detected in the CC of the GFP reporter mice at various time points of the cuprizone diet (Supplementary, Fig. 3S-b, d). GFP reporter mice showed less GFP+ cells in the CC than GFP-S1P1 signaling mice at 2, 4, and 6 weeks of the cuprizone diet but the difference was not statistically significant (Supplementary, Fig. 3S-e).

GFP Signaling in the CNS cells during demyelination and repair

We then investigated S1P1 signaling in neurons and CNS glia of S1P1-GFP signaling mice during cuprizone-induced de- and -remyelination. GFP expression was assessed in oligodendrocytes, neurons, neuronal stem cells, astrocytes and CNS myeloid lineage cells.

S1P1-GFP Signaling in Oligodendrocytes During Remyelination

S1P1 plays a key role in oligodendrocyte morphology and differentiation [34-37]. We quantified the number of Olig2+ cells in the MCC of cuprizone-fed S1P1-GFP signaling mice by immunohistochemistry. The MCC of S1P1-GFP signaling mice showed a decreased number of oligodendrocytes (n=3, *P<0.05) at two weeks of cuprizone diet (Supplementary, Fig. 2S-a, d). 2.3  0.3% of the GFP+ cells in the MCC of S1P1-GFP signaling mice were positive for Olig2 after 4 weeks of cuprizone diet (Fig. 4a, e). After 6 and 8 weeks of cuprizone diet, 11 0.5% and 9.8  0.8% of the GFP+ cells were Olig2+ respectively (Fig. 4b, c, e). To verify the specificity of GFP signaling, S1P1 staining was performed and most of GFP+Olig2+ cells were positive for S1P1 (Fig. 4d). Compared with S1P1-GFP signaling mice, only 2.3% and 3.3% of GFP+ cells of GFP reporter mice expressed Olig2+ in the corpus callosum at weeks 6 and 8 of the cuprizone diet respectively (Fig. 4e). Olig2+ cells in CC express higher GFP in S1P1-GFP signaling mice compared to GFP reporter mice. Sox2, a critical transcription factor in neural stem cells, is essential for oligodendrocyte progenitor cell (OPC) proliferation and oligodendrocyte regeneration following myelin impairment in the adult brain [38]. Oligodendrocytes express NG2 in early stage of their development. However, NG2+ cells are able to differentiate to gray matter astrocyte and pericytes [39-41]. Sox2 and NG2 staining was performed along with quantification of cells with GFP expression. S1P1 signaling was distinguished in 5% of Sox2+ cells in the SVZ of cuprizone-fed mice during demyelination (4 weeks) (Fig. 5a). The number of the Sox2+ cells decreased in the SVZ at 2-4 weeks of cuprizone diet, but the change was not statistically significant (Fig. 5d). 10.33  2.6% and 9  2% of the GFP+ cells were Sox2+ in 4 and 6 weeks cuprizone fed respectively but Sox2+ cells did not express significant S1P1 signaling during remyelination (Fig. 5e).

Approximately 70% of the NG2+ cells in the SVZ of S1P1-GFP signaling mice were Olig2+ cells during remyelination (Supplementary, Fig. 4S). Oligodendrocyte precursor cells (NG2+Olig2+) express GFP during remyelination (Fig. 5b). NG2+ cells in the SVZ increased significantly at 2 weeks, *p<0.05. An increase of NG2+ cells during remyelination (8 weeks) did not reach statistical significance (Fig. 5f). NG2+ cells were negative for S1P1 signaling at 2 weeks of cuprizone diet, whereas around 2% of GFP+ cells were NG2+ in the SVZ at 8 weeks (Fig. 5g). Sox2+ cells expressed GFP during demyelination but NG2+ cells expressed GFP during remyelination.

In order to analyze GFP expression in mature oligodendrocytes, CC1 (a marker for mature oligodendrocytes) staining was performed, showing that 10.5  2.4% of the GFP+ cells were CC1-positive after 8 weeks of cuprizone diet (Fig. 5c, h). In conclusion, S1P1 signaling is observed in immature progenitor oligodendrocytes (NG2+ cells) in the SVZ and in mature oligodendrocytes (CC1+ cells) in the MCC during remyelination. The Olig2+GFP+ cells may represent S1P1 signaling through β-arrestin in oligodendrocytes.

No Significant S1P1 Expression in Astrocytes During De- and Re-myelination

FTY720 is a S1P1-3-4-5 modulator, which downregulates NF-κB signaling in astrocytes, thereby decreasing the expression of proinflammatory and neurotoxic mediators [42]. Moreover, SEW2871, a selective S1P1 agonist, stimulates astrocyte migration [43]. In order to determine whether GFP expression is correlated with S1P1 signaling in astrocytes, GFAP staining was assessed. GFAP+ cells did not express GFP signaling during de- and re-myelination (weeks 2, 4, 6 and 8) (Fig. 6a).

S1P1 Signaling Is not Detected in Mature Neurons

Previous reports indicated that the S1P1-3-4-5 modulator, FTY720, suppressed neuronal injury and improved cognition after cerebral ischemia [44]. In the present study, the role of neuronal S1P1 signaling was further investigated during demyelination and repair. An immunofluorescence test with NeuN staining was performed but S1P1 signaling was not detected in the neurons of the CC, hippocampus and cortex (Fig. 6b).

Myeloid Cell-S1P1 Signaling in S1P1-GFP Signaling Mice During De- and Re-myelination

Our previous research indicated that myeloid S1P1 signaling plays a key role in CNS autoimmunity and neuroinflammation [31]. Previous reports suggest that S1P1 regulates pro and anti-inflammatory microglia (M1/M2) polarization, and a study by Gaire (2019) demonstrated that the suppression of S1P1 activity attenuates M1 polarization and induces the M2 phenotype [45]. Considering the key role of S1P1 in microglia polarization, we investigated S1P1 signaling in CNS myeloid-lineage cells, infiltrating monocytes and microglia. CD68 immunofluorescence staining was performed on brain sections of cuprizone-fed mice at sequential time points (weeks 0, 2, 4, 6 and 8). At two weeks of cuprizone diet, almost 92% of GFP+ cells in CC were positive for CD68, whereas at weeks 4, 6, and 8 only 80-76-83% of GFP+ cells also expressed CD68+ in CC respectively (Fig. 7a, Supplementary Fig. 5S). Unexpectedly, GFP expression was also observed in CD68+ cells of GFP reporter mice at 4, 6 and 8 weeks of cuprizone diet (Fig. 7b). The colocalization of GFP and CD68 in GFP reporter and S1P1-GFP signaling mice indicates that GFP signaling is not associated with S1P1 signaling. Naïve GFP reporter and S1P1-GFP signaling mice did not express GFP, however, following exposure to cuprizone diet myeloid cells in both groups expressed GFP signaling.

To validate the outcomes of the study, myeloid cells and lymphocytes were examined in the brain and spleen of mice with cuprizone-induced demyelination using flow cytometry.

Gating strategy for CNS immune cells is shown in supplementary Fig. 1S. The number of CNS infiltrating myeloid cells (CD45hiCD11b+), lymphocytes (CD45hiCD3+) and granulocytes (CD45hi CD11b+Ly6G+) increased significantly at 2-week of cuprizone diet (**p<0.01, *p<0.05 and **p<0.01 respectively) in S1P1-GFP signaling mice. However, both GFP reporter and S1P1-GFP signaling mice expressed GFP in myeloid cells and granulocytes. Lymphocytes (CD3+) showed higher but not statistically significant GFP signaling in the brain of S1P1-GFP signaling mice compared to the GFP reporter mice after 2 and 4 weeks of cuprizone diet (Fig. 8c, g and supplementary Fig. 6S-c, g). The expression of GFP in microglia (CD45lo CD11b+) increased significantly in GFP reporter and S1P1-GFP signaling at 4 weeks cuprizone-fed (*p<0.05) (Fig. 8i, j and supplementary Fig. 6S-i, j).

It could not be confirmed whether GFP leakiness was limited to CNS myeloid cells. Therefore, splenic myeloid cells and lymphocytes were assessed in GFP-reporter and S1P1-GFP signaling cuprizone-fed mice. Myeloid cells (CD45+CD11b+) decreased significantly in the spleen after 2 weeks of cuprizone diet (*P<0.05). However, no significant difference was observed in the GFP+CD11b+ cells between GFP reporter and S1P1-GFP signaling mice. The CD3+ cells increased significantly in the spleen after 2 and 4 weeks of cuprizone diet (*p<0.05). Interestingly, GFP+CD3+ cells were significantly more abundant in S1P1-GFP signaling mice compared to the GFP reporter mice after 2 and 6 weeks of cuprizone diet (**p<0.01 and *p<0.05, respectively) (Fig. 9 and supplementary Fig. 7S).

Confirmation of S1P1 Expression in Immune Cells in the EAE Model

Myeloid S1P1 signaling was investigated in EAE mice, an animal model of MS. Flow cytometry was performed to characterize S1P1 signaling in myeloid cells and lymphocytes during inflammation. While splenic myeloid cells (CD45+CD11b+) expressed high levels of GFP in both the EAE GFP reporter and S1P1-GFP signaling mice (Supplementary Fig. 8S), GFP expression was significantly higher in splenic lymphocytes of S1P1-GFP signaling mice. Splenic B (CD19+) and T cells (CD3+) of EAE mice expressed significantly higher GFP signaling compared to the control group during inflammation (Supplementary Fig. 9).

S1PR_1-5 modulators, such as Fingolimod and Siponimod, reduce neurological injuries and progression of brain atrophy in secondary progressive MS, but mechanisms underlying S1P signaling in the CNS cells entail further studies. The complexity of S1PR_1-5 signaling assessment results from ubiquitous expression in various cell types and the promotion of different signaling pathways through association with different G proteins which employs various cell behaviors. Nevertheless, expression levels, function and mechanism of each receptor subtype in neurons and glial cells during demyelination, neurodegeneration and repair remain elusive. In this study, we used S1P₁-GFP signaling mice to analyze, S1P₁ signaling in the CNS during de- and re-myelination using a cuprizone model. To the best of our knowledge, this is the first study to analyze S1P₁ signaling in vivo via GFP expression in CNS cells during de- and re-myelination.

One of the objectives of the current research was to determine whether oligodendrocytes express S1P₁ signaling during toxic insult and repair. According to the literature, S1P receptors are expressed in the oligodendrocyte lineage. For instance, FTY720 regulates the survival and maturation of OPCs [34, 35]. S1P₁ conditional knockout mice displayed a reduction in myelin thickness in the CC and S1P₁‐deficient oligodendrocytes had slower process extension [37]. However, previous studies indicated that cuprizone feeding does not increase cell death in S1P₁‐deficient oligodendrocytes [46]. S1P₁ signaling is essential for neural stem cell mobilization and migration to sites of CNS injury and also plays a major role in oligodendrocytes differentiation [47-49]. Also, Sox2 is crucial for oligodendrocyte proliferation and differentiation in the adult brain [48]. S1P₁ signaling in neural stem cells (Sox2⁺ cells) during demyelination suggest a role in proliferation and differentiation of neural stem cells to oligodendrocytes and/or migration of neural stem cells to the site of injury. Our results showed S1P₁ signaling in immature and mature oligodendrocytes during remyelination (Figs. 5e, g, h) which implicate S1P₁ signaling in differentiation, maturation, survival and morphology of oligodendrocytes. Heterogeneity in oligodendrocyte lineage cells and dynamics of oligodendrocyte differentiation and maturation [50, 51] may be the reason for β-arrestin dependent S1P₁ signaling in subpopulation of oligodendrocytes. In support of our findings related to MS, other studies have reported a decrease of S1P in the white matter and CNS lesions of MS patients. Further, it is known that fingolimod prevents brain atrophy and halts disability progression, and Siponimod reduces neurological injuries and progression of brain atrophy in secondary progressive MS.

Previous studies reported protective effects of S1P₁ signaling in neurons after ischemic stroke [52] . Furthermore, S1P₁ signaling regulates glutamate secretion and synaptic transmission [53]. However, in the present study, β-arrestin dependent S1P₁ signaling was not detected in neurons during de- and -remyelination. S1P₁ signaling is essential for switching the intermediate/transition astrocytes to reactive astrocytes [54]. Hypertrophic astrocytes in the brain lesions of MS patients express S1P₁[55, 56]. The high arborization and density of astrocytes during demyelination made it difficult to determine the exact number of the GFP⁺GFAP⁺ cells by immunofluorescence. To overcome this difficulty in our analyses, we only counted GFP⁺GFAP⁺ cells when GFP was located in the cell body of the astrocytes rather than around the arborization. Nevertheless, S1P₁ signaling was not distinguished significantly in astrocytes of S1P₁-GFP signaling mice. The absence of S1P₁ signaling in neurons and astrocytes can be interpreted by low levels of S1P₁ expression and/or reduced turnover of these cells. Also, β-arrestin independent signaling and involvement of other S1P receptor subtypes (such as S1P₃) may account for the lack of S1P₁ signaling in neurons and astrocytes reported here [57].

S1P₁ is the major S1P receptor expressed in immune cells and plays a pivotal role in immune cell function, development and trafficking. Lymphocyte exit from secondary lymphatic organs into the systemic circulation is regulated by S1P₁ signaling [8, 58]. Moreover, S1P₁ is essential for the transfer of immature B cells from the bone marrow to the circulation[59].

In the current research, lymphocytes and myeloid cells were examined in the brain and spleen of mice with cuprizone-induced demyelination by flow cytometry. Remarkably, splenic lymphocytes (CD3⁺) expressed significantly higher levels of GFP in S1P₁-GFP signaling mice compared to the GFP reporter mice. Another objective of the present study was to determine whether GFP expression was specific in lymphocytes during inflammation. To this end, EAE mice were used as an animal model of MS, and specific GFP signaling was observed in splenic T cells and B cells (CD3⁺ and CD19⁺) during inflammation in the EAE GFP-S1P₁signaling mice compared to GFP reporter mice. The subpopulations of T cells, CD8⁺ and CD4⁺ cells, expressed significantly higher S1P₁ signaling in EAE GFP-S1P₁signaling mice compared to GFP reporter mice. These results demonstrated that increased S1P₁ signaling in splenic lymphocytes during demyelination and inflammation occurs in a β-arrestin dependent manner. Previous studies have shown increased S1P concentration in the CSF of MS subjects. Higher levels of S1P in the CSF may provoke immune cells trafficking in the CNS and inhibit T(reg) function via β-arrestin dependent S1P₁ signaling [60, 61].

Several preclinical studies have demonstrated the effects of S1P signaling on microglia. For example, FTY720 upregulates the brain-derived neurotrophic factor and downregulates production of pro-inflammatory cytokines in microglia [14] . In myeloid cells S1P₁ signaling is critical in the polarization of M1/M2 macrophages [62]. Our previous research demonstrated that continuous S1P₁ signaling in myeloid cells mediates T_H17 polarization [31]. GFP expression in GFP reporter mice should be silent in the absence of tTA. However, our immunohistochemistry and flow cytometry tests indicated aberrant expression of the transgene in activated myeloid cells in the GFP reporter mice after EAE and cuprizone induced demyelination. Previous studies have identified GFP leakage in hematopoietic stem cells in H2B-GFP reporter mice [63, 64]. Putative GFP leakage prevents us from drawing any conclusions regarding S1P₁-GFP signaling in CNS resident and peripheral myeloid cells. Several studies have reported accuracy and reliability of the S1P₁-GFP signaling murine model [27, 65]. However, none of these studies investigated CNS inflammations and activated myeloid cells. The causes of the aberrant GFP expression in the absence of the tTA protein remain unclear. It is possible that the H2B-GFP transgene was integrated into a region of DNA in the myeloid cells, switching the transcriptional activity by the cuprizone diet or EAE induction. H2B-GFP protein in the nucleosome may affect the chromatin structure and gene expression in the activated myeloid cells, as well as our findings regarding the potential leakiness of GFP. Non-specific binding to the synthetic promoter in activated microglia may be another cause of the GFP leakiness. S1P could also act as an intracellular messenger and bind to nuclear S1P₁, which inhibits the activity of histone deacetylase 1 and 2 (HDAC1/2), thereby resulting in epigenetic regulation of gene expression [66, 67]. Modulation of HDAC1/2 by nuclear S1P₁ may also account for the GFP leakiness in myeloid cells.

β-arrestins act as multifunctional adaptors for activated GPCRs including S1P₁. β-arrestin-dependent signaling is extremely diverse and incites distinct cellular responses. The binding of β-arrestin to the intracellular domain can halt G protein-mediated signaling and desensitize S1P₁signaling. The association of β-arrestin with S1P₁ can initiate endocytic machinery and internalize the S1P₁. Activated β-arrestin supports multiple components of a kinase cascade and propagating specific signaling pathway [68, 69]. Consequently, S1P₁- β-arrestin signaling can create different cell behaviors in CNS glial cells and immune cells.

In summary, our results indicate that the S1P₁ signaling in the oligodendrocyte lineage during remyelination may have a protective effect by regulating myelination in response to injury. Elucidating regulatory mechanisms downstream of S1P₁- β-arrestin signaling in oligodendrocytes will provide important evidence to design effective therapies for demyelinating diseases like MS. S1P₁ was not significantly expressed in neurons and astrocytes, possibly because S1P₁ signaling in CNS neurons and astrocytes is not dependent on β-arrestin.

S1P₁ signaling was identified in lymphocytes during demyelination and inflammation. In this regards, S1P₁-GFP signaling mice could be used to analyze the anti-inflammatory role of CD3⁺cells, as well as the role of B cells in neurodegeneration and repair in EAE and cuprizone models.

Flow cytometry and immunofluorescence detected GFP leakage upon EAE induction and cuprizone exposure in GFP reporter mice, complicating interpretation. It is essential to generate new lines of H2B-GFP reporter mice to demonstrate appropriate reporter for analysis of myeloid cells.

CC: Corpus Callosum

CNS: Central Nervous System

CP: Caudo-Putamen

CTX: Cortex

EAE: Experimental Autoimmune Encephalomyelitis

GFAP: Glial Fibrillary Acidic Protein

GFP: Green Fluorescence Protein

GPCR: G protein-coupled receptor

HDAC1/2: Histone Deacetylase 1 and 2

IRES: Internal Ribosome Entry Site

LCC: Lateral Corpus Callosum,

LFB: Luxol Fast Blue

MBP: Myelin Basic Protein

MCC: Medial Corpus Callosum

MS: Multiple sclerosis

NG2: Neural/Glial Antigen

OPCs: Oligodendrocyte Progenitor Cells

QLIPP: quantitative label-free imaging with phase and polarization

S1P: Sphingosine-1-phosphate

S1pr1: S1P receptor 1 gene

S1P₁: S1P receptor 1

S1PR_1-5:Sphingosine-1-phosphate receptors 1-5

SVZ: Subventricular Zone

TEV: Tobacco Etch Virus

Data Availability

Please contact the authors for data requests.

Funding

This study was supported by Fondation Leducq and a training grant from National Institutes of Health on infection, Immunity, and Inflammation (T32 AI 7290-32).

Contributions

Ezzat Hashemi (E.H.): designed and performed the experiments, analyzed and interpreted the data, made figures and wrote the manuscript. Hsing-Chuan Tsai (T.S.) performed EAE experiments and helped in flowcytometry tests and analysis. Ezra Yoseph (E.Y.) performed IHC tests and cell counting. Monica Moreno (M.M.) collaborated in tissue collection and data acquisition. Li-Hao Yah (L.Y.) and Shalin B Mehta (S.M.) analyzed myelin by label-free imaging. Mari Kono (M.K.) and Richard Proia (R.P.) provided S1P₁-GFP signaling mice and contributed to the final manuscript. May H Han (M.H.) designed the experiments, analyzed, and interpreted the data and supervised the study. All authors read and approved the final manuscript.

Acknowledgements

We thank our collogues Nora Sandrine Wetzel and Anna Tomczak for manuscript critical review.

Competing Interests

The authors declare that they have no conflicts of interest.

Ethic Approval and Consent to Participant

All methods and animal procedures were performed in accordance with The Guide for the Care and Use of Laboratory Animals and were reviewed and approved by the Institutional Animal Care and Use Committee at Stanford University.

Consent to Participant

Not applicable

Consent for Publication

Not applicable

Code availability

Not applicable

1. Collaborators GBDMS: Global, regional, and national burden of multiple sclerosis 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Neurol 2019, 18(3):269-285.

2. Baecher-Allan C, Kaskow BJ, Weiner HL: Multiple Sclerosis: Mechanisms and Immunotherapy. Neuron 2018, 97(4):742-768.

3. Rotshenker S: Wallerian degeneration: the innate-immune response to traumatic nerve injury. J Neuroinflammation 2011, 8:109.

4. Conforti L, Gilley J, Coleman MP: Wallerian degeneration: an emerging axon death pathway linking injury and disease. Nat Rev Neurosci 2014, 15(6):394-409.

5. Andravizou A, Dardiotis E, Artemiadis A, Sokratous M, Siokas V, Tsouris Z, Aloizou AM, Nikolaidis I, Bakirtzis C, Tsivgoulis G et al: Brain atrophy in multiple sclerosis: mechanisms, clinical relevance and treatment options. Auto Immun Highlights 2019, 10(1):7.

6. Popescu V, Agosta F, Hulst HE, Sluimer IC, Knol DL, Sormani MP, Enzinger C, Ropele S, Alonso J, Sastre-Garriga J et al: Brain atrophy and lesion load predict long term disability in multiple sclerosis. J Neurol Neurosurg Psychiatry 2013, 84(10):1082-1091.

7. Blaho VA, Hla T: An update on the biology of sphingosine 1-phosphate receptors. J Lipid Res 2014, 55(8):1596-1608.

8. Cyster JG, Schwab SR: Sphingosine-1-phosphate and lymphocyte egress from lymphoid organs. Annu Rev Immunol 2012, 30:69-94.

9. Nishimura H, Akiyama T, Irei I, Hamazaki S, Sadahira Y: Cellular localization of sphingosine-1-phosphate receptor 1 expression in the human central nervous system. J Histochem Cytochem 2010, 58(9):847-856.

10. Groves A, Kihara Y, Chun J: Fingolimod: direct CNS effects of sphingosine 1-phosphate (S1P) receptor modulation and implications in multiple sclerosis therapy. J Neurol Sci 2013, 328(1-2):9-18.

11. Soliven B, Miron V, Chun J: The neurobiology of sphingosine 1-phosphate signaling and sphingosine 1-phosphate receptor modulators. Neurology 2011, 76(8 Suppl 3):S9-14.

12. O'Sullivan S, Dev KK: Sphingosine-1-phosphate receptor therapies: Advances in clinical trials for CNS-related diseases. Neuropharmacology 2017, 113(Pt B):597-607.

13. Khatri BO: Fingolimod in the treatment of relapsing-remitting multiple sclerosis: long-term experience and an update on the clinical evidence. Ther Adv Neurol Disord 2016, 9(2):130-147.

14. Noda H, Takeuchi H, Mizuno T, Suzumura A: Fingolimod phosphate promotes the neuroprotective effects of microglia. J Neuroimmunol 2013, 256(1-2):13-18.

15. Gentile A, Musella A, Bullitta S, Fresegna D, De Vito F, Fantozzi R, Piras E, Gargano F, Borsellino G, Battistini L et al: Siponimod (BAF312) prevents synaptic neurodegeneration in experimental multiple sclerosis. J Neuroinflammation 2016, 13(1):207.

16. Anastasiadou S, Knoll B: The multiple sclerosis drug fingolimod (FTY720) stimulates neuronal gene expression, axonal growth and regeneration. Exp Neurol 2016, 279:243-260.

17. Szepanowski F, Derksen A, Steiner I, Meyer Zu Horste G, Daldrup T, Hartung HP, Kieseier BC: Fingolimod promotes peripheral nerve regeneration via modulation of lysophospholipid signaling. J Neuroinflammation 2016, 13(1):143.

18. Fukumoto K, Mizoguchi H, Takeuchi H, Horiuchi H, Kawanokuchi J, Jin S, Mizuno T, Suzumura A: Fingolimod increases brain-derived neurotrophic factor levels and ameliorates amyloid beta-induced memory impairment. Behav Brain Res 2014, 268:88-93.

19. Doi Y, Takeuchi H, Horiuchi H, Hanyu T, Kawanokuchi J, Jin S, Parajuli B, Sonobe Y, Mizuno T, Suzumura A: Fingolimod phosphate attenuates oligomeric amyloid beta-induced neurotoxicity via increased brain-derived neurotrophic factor expression in neurons. PLoS One 2013, 8(4):e61988.

20. Zhang J, Xiao B, Li CX, Wang Y: Fingolimod (FTY720) improves postoperative cognitive dysfunction in mice subjected to D-galactose-induced aging. Neural Regen Res 2020, 15(7):1308-1315.

21. Smith PA, Schmid C, Zurbruegg S, Jivkov M, Doelemeyer A, Theil D, Dubost V, Beckmann N: Fingolimod inhibits brain atrophy and promotes brain-derived neurotrophic factor in an animal model of multiple sclerosis. J Neuroimmunol 2018, 318:103-113.

22. De Stefano N, Silva DG, Barnett MH: Effect of Fingolimod on Brain Volume Loss in Patients with Multiple Sclerosis. CNS Drugs 2017, 31(4):289-305.

23. Benedict RHB, Tomic D, Cree BA, Fox R, Giovannoni G, Bar-Or A, Gold R, Vermersch P, Pohlmann H, Wright I et al: Siponimod and Cognition in Secondary Progressive Multiple Sclerosis: EXPAND Secondary Analyses. Neurology 2021, 96(3):e376-e386.

24. Leavitt VM, Rocca M: Siponimod for Cognition in Secondary Progressive Multiple Sclerosis: Thinking Through the Evidence. Neurology 2021, 96(3):91-92.

25. Kulakowska A, Zendzian-Piotrowska M, Baranowski M, Kononczuk T, Drozdowski W, Gorski J, Bucki R: Intrathecal increase of sphingosine 1-phosphate at early stage multiple sclerosis. Neurosci Lett 2010, 477(3):149-152.

26. Qin J, Berdyshev E, Goya J, Natarajan V, Dawson G: Neurons and oligodendrocytes recycle sphingosine 1-phosphate to ceramide: significance for apoptosis and multiple sclerosis. J Biol Chem 2010, 285(19):14134-14143.

27. Kono M, Tucker AE, Tran J, Bergner JB, Turner EM, Proia RL: Sphingosine-1-phosphate receptor 1 reporter mice reveal receptor activation sites in vivo. J Clin Invest 2014, 124(5):2076-2086.

28. Kono M, Proia RL: Imaging S1P1 activation in vivo. Exp Cell Res 2015, 333(2):178-182.

29. Guo SM, Yeh LH, Folkesson J, Ivanov IE, Krishnan AP, Keefe MG, Hashemi E, Shin D, Chhun BB, Cho NH et al: Revealing architectural order with quantitative label-free imaging and deep learning. Elife 2020, 9.

30. Tsai HC, Huang Y, Garris CS, Moreno MA, Griffin CW, Han MH: Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY720 during neuroinflammation. JCI Insight 2016, 1(9):e86462.

31. Tsai HC, Nguyen K, Hashemi E, Engleman E, Hla T, Han MH: Myeloid sphingosine-1-phosphate receptor 1 is important for CNS autoimmunity and neuroinflammation. J Autoimmun 2019, 105:102290.

32. Arac A, Brownell SE, Rothbard JB, Chen C, Ko RM, Pereira MP, Albers GW, Steinman L, Steinberg GK: Systemic augmentation of alphaB-crystallin provides therapeutic benefit twelve hours post-stroke onset via immune modulation. Proc Natl Acad Sci U S A 2011, 108(32):13287-13292.

33. Benardais K, Kotsiari A, Skuljec J, Koutsoudaki PN, Gudi V, Singh V, Vulinovic F, Skripuletz T, Stangel M: Cuprizone [bis(cyclohexylidenehydrazide)] is selectively toxic for mature oligodendrocytes. Neurotox Res 2013, 24(2):244-250.

34. Miron VE, Jung CG, Kim HJ, Kennedy TE, Soliven B, Antel JP: FTY720 modulates human oligodendrocyte progenitor process extension and survival. Ann Neurol 2008, 63(1):61-71.

35. Coelho RP, Payne SG, Bittman R, Spiegel S, Sato-Bigbee C: The immunomodulator FTY720 has a direct cytoprotective effect in oligodendrocyte progenitors. J Pharmacol Exp Ther 2007, 323(2):626-635.

36. Jung CG, Kim HJ, Miron VE, Cook S, Kennedy TE, Foster CA, Antel JP, Soliven B: Functional consequences of S1P receptor modulation in rat oligodendroglial lineage cells. Glia 2007, 55(16):1656-1667.

37. Dukala DE, Soliven B: S1P1 deletion in oligodendroglial lineage cells: Effect on differentiation and myelination. Glia 2016, 64(4):570-582.

38. Zhang S, Zhu X, Gui X, Croteau C, Song L, Xu J, Wang A, Bannerman P, Guo F: Sox2 Is Essential for Oligodendroglial Proliferation and Differentiation during Postnatal Brain Myelination and CNS Remyelination. J Neurosci 2018, 38(7):1802-1820.

39. Zhu X, Bergles DE, Nishiyama A: NG2 cells generate both oligodendrocytes and gray matter astrocytes. Development 2008, 135(1):145-157.

40. Ozerdem U, Grako KA, Dahlin-Huppe K, Monosov E, Stallcup WB: NG2 proteoglycan is expressed exclusively by mural cells during vascular morphogenesis. Dev Dyn 2001, 222(2):218-227.

41. Polito A, Reynolds R: NG2-expressing cells as oligodendrocyte progenitors in the normal and demyelinated adult central nervous system. J Anat 2005, 207(6):707-716.

42. Rothhammer V, Kenison JE, Tjon E, Takenaka MC, de Lima KA, Borucki DM, Chao CC, Wilz A, Blain M, Healy L et al: Sphingosine 1-phosphate receptor modulation suppresses pathogenic astrocyte activation and chronic progressive CNS inflammation. Proc Natl Acad Sci U S A 2017, 114(8):2012-2017.

43. Mullershausen F, Craveiro LM, Shin Y, Cortes-Cros M, Bassilana F, Osinde M, Wishart WL, Guerini D, Thallmair M, Schwab ME et al: Phosphorylated FTY720 promotes astrocyte migration through sphingosine-1-phosphate receptors. J Neurochem 2007, 102(4):1151-1161.

44. Czech B, Pfeilschifter W, Mazaheri-Omrani N, Strobel MA, Kahles T, Neumann-Haefelin T, Rami A, Huwiler A, Pfeilschifter J: The immunomodulatory sphingosine 1-phosphate analog FTY720 reduces lesion size and improves neurological outcome in a mouse model of cerebral ischemia. Biochem Biophys Res Commun 2009, 389(2):251-256.

45. Gaire BP, Bae YJ, Choi JW: S1P1 Regulates M1/M2 Polarization toward Brain Injury after Transient Focal Cerebral Ischemia. Biomol Ther (Seoul) 2019:522-529.

46. Kim HJ, Miron VE, Dukala D, Proia RL, Ludwin SK, Traka M, Antel JP, Soliven B: Neurobiological effects of sphingosine 1-phosphate receptor modulation in the cuprizone model. FASEB J 2011, 25(5):1509-1518.

47. Kimura A, Ohmori T, Ohkawa R, Madoiwa S, Mimuro J, Murakami T, Kobayashi E, Hoshino Y, Yatomi Y, Sakata Y: Essential roles of sphingosine 1-phosphate/S1P1 receptor axis in the migration of neural stem cells toward a site of spinal cord injury. Stem Cells 2007, 25(1):115-124.

48. Yazdi A, Mokhtarzadeh Khanghahi A, Baharvand H, Javan M: Fingolimod Enhances Oligodendrocyte Differentiation of Transplanted Human Induced Pluripotent Stem Cell-Derived Neural Progenitors. Iran J Pharm Res 2018, 17(4):1444-1457.

49. Alfonso J, Penkert H, Duman C, Zuccotti A, Monyer H: Downregulation of Sphingosine 1-Phosphate Receptor 1 Promotes the Switch from Tangential to Radial Migration in the OB. J Neurosci 2015, 35(40):13659-13672.

50. Marques S, Zeisel A, Codeluppi S, van Bruggen D, Mendanha Falcao A, Xiao L, Li H, Haring M, Hochgerner H, Romanov RA et al: Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system. Science 2016, 352(6291):1326-1329.

51. Yeung MS, Zdunek S, Bergmann O, Bernard S, Salehpour M, Alkass K, Perl S, Tisdale J, Possnert G, Brundin L et al: Dynamics of oligodendrocyte generation and myelination in the human brain. Cell 2014, 159(4):766-774.

52. Hasegawa Y, Suzuki H, Sozen T, Rolland W, Zhang JH: Activation of sphingosine 1-phosphate receptor-1 by FTY720 is neuroprotective after ischemic stroke in rats. Stroke 2010, 41(2):368-374.

53. Kajimoto T, Okada T, Yu H, Goparaju SK, Jahangeer S, Nakamura S: Involvement of sphingosine-1-phosphate in glutamate secretion in hippocampal neurons. Mol Cell Biol 2007, 27(9):3429-3440.

54. Groves A, Kihara Y, Jonnalagadda D, Rivera R, Kennedy G, Mayford M, Chun J: A Functionally Defined In Vivo Astrocyte Population Identified by c-Fos Activation in a Mouse Model of Multiple Sclerosis Modulated by S1P Signaling: Immediate-Early Astrocytes (ieAstrocytes). eNeuro 2018, 5(5).

55. Choi JW, Gardell SE, Herr DR, Rivera R, Lee CW, Noguchi K, Teo ST, Yung YC, Lu M, Kennedy G et al: FTY720 (fingolimod) efficacy in an animal model of multiple sclerosis requires astrocyte sphingosine 1-phosphate receptor 1 (S1P1) modulation. Proc Natl Acad Sci U S A 2011, 108(2):751-756.

56. Van Doorn R, Van Horssen J, Verzijl D, Witte M, Ronken E, Van Het Hof B, Lakeman K, Dijkstra CD, Van Der Valk P, Reijerkerk A et al: Sphingosine 1-phosphate receptor 1 and 3 are upregulated in multiple sclerosis lesions. Glia 2010, 58(12):1465-1476.

57. Zamanian JL, Xu L, Foo LC, Nouri N, Zhou L, Giffard RG, Barres BA: Genomic analysis of reactive astrogliosis. J Neurosci 2012, 32(18):6391-6410.

58. Rivera J, Proia RL, Olivera A: The alliance of sphingosine-1-phosphate and its receptors in immunity. Nat Rev Immunol 2008, 8(10):753-763.

59. Allende ML, Tuymetova G, Lee BG, Bonifacino E, Wu YP, Proia RL: S1P1 receptor directs the release of immature B cells from bone marrow into blood. J Exp Med 2010, 207(5):1113-1124.

60. Liu G, Burns S, Huang G, Boyd K, Proia RL, Flavell RA, Chi H: The receptor S1P1 overrides regulatory T cell-mediated immune suppression through Akt-mTOR. Nat Immunol 2009, 10(7):769-777.

61. Maeda Y, Seki N, Kataoka H, Takemoto K, Utsumi H, Fukunari A, Sugahara K, Chiba K: IL-17-Producing Vgamma4+ gammadelta T Cells Require Sphingosine 1-Phosphate Receptor 1 for Their Egress from the Lymph Nodes under Homeostatic and Inflammatory Conditions. J Immunol 2015, 195(4):1408-1416.

62. Muller J, von Bernstorff W, Heidecke CD, Schulze T: Differential S1P Receptor Profiles on M1- and M2-Polarized Macrophages Affect Macrophage Cytokine Production and Migration. Biomed Res Int 2017, 2017:7584621.

63. Challen GA, Goodell MA: Promiscuous expression of H2B-GFP transgene in hematopoietic stem cells. PLoS One 2008, 3(6):e2357.

64. Morcos MNF, Zerjatke T, Glauche I, Munz CM, Ge Y, Petzold A, Reinhardt S, Dahl A, Anstee NS, Bogeska R et al: Continuous mitotic activity of primitive hematopoietic stem cells in adult mice. J Exp Med 2020, 217(6).

65. Cartier A, Leigh T, Liu CH, Hla T: Endothelial sphingosine 1-phosphate receptors promote vascular normalization and antitumor therapy. Proc Natl Acad Sci U S A 2020, 117(6):3157-3166.

66. Ebenezer DL, Fu P, Suryadevara V, Zhao Y, Natarajan V: Epigenetic regulation of pro-inflammatory cytokine secretion by sphingosine 1-phosphate (S1P) in acute lung injury: Role of S1P lyase. Adv Biol Regul 2017, 63:156-166.

67. Fu P, Ebenezer DL, Ha AW, Suryadevara V, Harijith A, Natarajan V: Nuclear lipid mediators: Role of nuclear sphingolipids and sphingosine-1-phosphate signaling in epigenetic regulation of inflammation and gene expression. J Cell Biochem 2018, 119(8):6337-6353.

68. Jean-Charles PY, Kaur S, Shenoy SK: G Protein-Coupled Receptor Signaling Through beta-Arrestin-Dependent Mechanisms. J Cardiovasc Pharmacol 2017, 70(3):142-158.

69. Pyne NJ, Pyne S: Sphingosine 1-Phosphate Receptor 1 Signaling in Mammalian Cells. Molecules 2017, 22(3).

Download PDF

Version 1

posted

You are reading this latest preprint version

Visualizing Sphingosine-1-Phosphate Receptor 1(S1P₁) SignalingDuringCentral Nervous System De- and Re-Myelination

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1