Animals. The study was carried out in control broiler chicken line maintained at the experimental farm of ICAR-Directorate of Poultry Research, Hyderabad, India. A total of 106 hens were inseminated with the pooled processed semen collected from 28 cocks. A total of 150 fertile eggs were collected from the inseminated hens. The detail experimental design and hatching performance has been mentioned in Table 1. The whole study was approved by the Institute Animal Ethics Committee (IAEC) and Institute Biosafety Committee (IBSC) of ICAR-Directorate of Poultry Research, Hyderabad, India. All methods in the study were carried out in accordance with relevant guidelines and regulations of the Institute Animal Ethics Committee (IAEC) and Institute Biosafety Committee (IBSC). The work was also approved by the Review Committee on Genetic Manipulation (RCGM), Dept. of Biotechnology, Govt. of India. All the biosafety guidelines were followed while conducting the experiments. The study was carried out in compliance with the ARRIVE guidelines. The animal welfare measures like ad lib feeding, watering and management of the birds were taken care off during the experiment.
Designing and cloning of shRNA molecules. The shRNA molecules were designed from the coding sequence of chicken ACACA (Accession No. NC_006106) and SREBP1 (Accession No. NC_006101) genes with Block-iT RNAi designer programme (https://rnaidesigner.thermofisher.com /rnaiexpress/) (Invitrogen). Two best shRNA molecules were identified based on our previous study conducted under cell culture system for ACACA14 and SREBP115 genes. Double-stranded oligos encoding shRNA to the target genes were cloned in U6 promoter guided pENTR™/U6 vector (Invitrogen) to prepare RNAi cassette. The entire RNAi cassettes were used as expression clones (Fig. 6a).
Sperm mediated gene transfer (SMGT). A total of 28 cocks of control broiler line were randomly selected for the experiment. The semen collected from all the cocks were pooled and centrifuged at 2000g for 10 min to remove seminal plasma. The sperms were washed with PBS buffer (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4 and 2mM KH2PO4) for 3-4 times. The numbers of sperms were counted in the Neubeur chamber. The live and dead sperms were evaluated after staining with Eosin-Nigrosin stain. The total sperms were divided into 5 groups consisting of 4 shRNAs groups and 1 control group (Only electrical impulse without DNA was provided to the sperm before insemination). All 4 RNAi cassettes were digested with PvuI restriction enzyme (RE) (NEB Inc., Massachusetts, USA) at 37oC for overnight (Fig. 6b). Then, the RE enzyme was inactivated by incubating digested DNA samples at 65oC for 30 min at dry bath. The linearized recombinant DNA was quantified in Nanodrop spectrophotometer. After that, the sperms were transfected with 10 µg of each RNAi cassette of ACACA and SREBP1 genes by electroporation with Gene Pulser (Biorad) at 160 mV for 25 mili second for 1 pulse. The transfected sperms containing 100 Million sperm in 0.25 ml PBS were inseminated to each hen under each treatment group. The same protocol of insemination was repeated on the consecutive days and eggs were collected for 2 days. The eggs were incubated at the incubator for 18 days at 98-100oF with 78-80% relative humidity and turning 6 times a day. Then, eggs were candled on 19th day and the fertile eggs were kept in the hatcher for 3 days at 98-100oF with 78-80% relative humidity. The chicks were hatched and all chicks were wing-banded with metal bands. The chicks were maintained in the brooder house on deep litter system upto 6 weeks of age by providing ad lib feeding, watering, lighting to warm the house and water sprinkling on the roof of the poultry shed during summer season. On 7th week, birds were kept in battery brooder and ad lib feeding and watering were provided. The birds were fed with 21% CP and 2800 ME energy upto 6 weeks of age and afterwards, 18% CP and 2900 ME was provided to the adult birds.
Screening of positive transgenic birds by PCR, sequencing and Southern blotting. Blood samples were collected from all the birds of different treatment groups alongwith the control group. Genomic DNA was isolated from all the samples following standard protocol30. The primers designed on entry vector (Forward: 5'GGACTATCATATGCTTACCG3' and Reverse: 5'-CAGGAAACAGCTATGAC-3') to amplify the 293 bp entry vector fragment for screening of positive transgenic birds. The amplified products were run on 1% agarose gel. The presence of 293 bp band on the gel indicated the positive birds possessing the entry vector (Fig. 1a&b). The amplified products of the positive birds carrying entry vector were sequenced by Sanger’s di-deoxy chain termination method in ABI PRIZM 377 DNA sequencer (Perkin-Elmer, Waltham, MA) to confirm the presence of entry vector in the positive birds.
All the positive birds were also subjected to Southern blotting by digesting with ApaI restriction enzyme for confirmation. Probes were prepared from 293 bp fragment of pENTR™/U6 vector backbone, which were labelled with biotin-streptavidin conjugated to alkaline phosphatase and detected with NBT/BCIP for spot hybridization (Biotin chromogenic detection kit, Thermo scientific, Cat. No. K0661).
ELISA to detect ACACA and SREBP1 proteins in serum. The levels of ACACA and SREBP1 proteins in serum samples of knock down and control birds were measured by sandwich ELISA (enzyme-linked immuno-sorbent assay). Antibodies specific to ACACA and SREBP1 were pre-coated onto a 96-well plate (12 x 8 Well Strips) and blocked. Standards or test samples were added to the wells and were incubated at room temperature for 30 min. The primary antibodies specific to ACACA or SREBP1 were added, incubated at room temperature for 30 min followed by washing. Then, HRP-Peroxidase conjugate was added, incubated at room temperature for 30 min and unbound conjugate was removed by washing. The TMB substrate was added for enzymatic reaction at room temperature for 15 min at dark place where HRP generating a blue color product was changed to yellow after adding acidic stop solution (1M HCl). The density of yellow coloration read by absorbance at 450nm in ELISA reader was quantitatively proportional to the amount of sample ACACA or SREBP1 captured in the well. The absorbance values for ACACA or SREBP1 protein contents in the serum of transgenic and control group of birds estimated through ELISA were compared between transgenic and control groups, and between titres within each group following LSD statistical test (SPSS 20.0 software).
Growth traits. Body weights of all the experimental birds at 1st generation including control were recorded at day1, 5th, 6th, 8th, 10th 20th, 32nd, 40th and 52nd week of age. During 2nd generation, body weights of birds were measured on day1, 2nd, 4th, 6th, 8th, 10th and 20th week of age.
Blood cell profiles. Blood samples were collected from the transgenic and control birds. All the blood cells were counted in hemocytometer for all the samples following protocol (Bhattacharya et al., 2019). Other haematological parameters viz. Haemoglobin% (Hb%), PCV, MCV, MCH and MCHC were measured in Automatic UBM FX 19T hematology analyzer (Unitron Biomedicals, Bengaluru, India). The ESR of whole blood was measured following disposable ESR pipette-Westergren method (Recombigen Laboratories Pvt. Ltd., Delhi, India).
Biochemical parameters. The blood samples without anti-coagulant were collected in 1.5ml Eppendorf tube and kept at room temperature at 45o slanting position for 6h. Serum was collected from upper phase and kept in fresh Eppendorf tube. The serum samples were used to estimate triglyceride (identi triglyceride test kit) by Glycerol phosphate oxidase (GPO) method, total cholesterol (identi cholesterol test kit) by CHOD-POD method (Cholesterol oxidase peroxidise), LDL (identi identi Directr LDL cholesterol test kit) by Polymer detergent method and HDL content (identi Direct HDL cholesterol test kit) by Polymer detergent method in Turbochem 100 Manager Blood analyzer (CPC Diagnostics, Chennai, India) following Manufacturer’s instructions.
Blood urea content in serum was measured following GLDH-Urease method using ERBA urea (BUN) kit (Transasia Bio-Medicals Ltd., Solan, HP, India) in Robonik Prietest Touch Plus Biochemistry analyzer (Robonik Pvt. Ltd., Mumbai, India). Serum creatinine was measured following Jaffe’s method using ERBA Liquixx creatinine kit (Transasia Bio-Medicals Ltd., Solan, HP, India) in Robonik Prietest Touch Plus Biochemistry analyzer (Robonik Pvt. Ltd., Mumbai, India). Serum albumin was measured following BCG dye method using ERBA Liquixx albumin kit (Transasia Bio-Medicals Ltd., Solan, HP, India) in Robonik Prietest Touch Plus Biochemistry analyzer (Robonik Pvt. Ltd., Mumbai, India). Serum uric acid was measured following Uricase-Trinder End point method using ERBA Liquixx-M uric acid kit (Transasia Bio-Medicals Ltd., Solan, HP, India) in Robonik Prietest Touch Plus Biochemistry analyzer (Robonik Pvt. Ltd., Mumbai, India).
Progesterone and estrogen estimation. The progesterone and estrogen in serum samples of both transgenic and control birds of first generation at the age of 40 weeks and the birds of 2nd generation at the age of 25 weeks was estimated following Chemiluminescence Immunoassay (CLIA) using progesterone and estrogen kit (Siemens, Munich, Germany) in Advia Centaur ® XP apparatus (Seimens, Munich, Germany).
Egg cholesterol and LDL estimation. The eggs were weighed, broken and both albumen and yolk were taken in stainless steel bowl. The bowl was kept in a hot air oven at 60oC temperature for 4 days for drying. After drying, the whole content was triturated in a pastel and mortar. The total egg powder was also weighed. An amount of 0.1g of egg powder was taken in 1.5ml eppendorf tube. A volume of nine times of anhydrous ethanol was added to the tube and the mixture was mechanically homogenized for 30s using vortex31. Then, the mixture was centrifuged at 2500 g for 10 min at 4oC. The supernatant was transferred to a fresh 1.5ml centrifuge tube. A volume of 100 µl of supernatant was kept in the analysis vial and cholesterol content in egg was quantified in Turbochem 100 Manager Blood analyzer (CPC diagnostics, Chennai, India) using cholesterol estimation kit (identi cholesterol test kit; CPC diagnostics, Chennai, India). We also analyzed LDL content of egg in Turbochem 100 Manager Blood analyzer (CPC diagnostics, Chennai, India) with LDL estimation kit (identi Direct LDL cholesterol test kit; CPC diagnostics, Chennai, India) following Manufacturer’s instruction.
Egg minerals estimation. The whole eggs without egg shells were dried and powdered. A quantity of 1g whole egg powder was taken in a volumetric flask. A volume of 20 ml HNO3 was added to the flask and a funnel was placed in the flask. The flasks were kept on a hot plate at 150-180oC till the particles were dissolved in the acid. The sample was filtered using Whatman filter paper No. 42 and the volume of the content in the flask was made up to 50 ml with distilled water. Then, the samples were placed in iCAP7200 ICP OES Duo (Thermo Scientific, Massachusetts, USA) for estimation of egg minerals such as Cu, Fe, Zn, Mn, Mg, Cr, Ni, Ca, B and Se.
Semen quality analysis. Semen was collected with a sterile glass funnel from a transgenic and a control cocks following cloacal-abdominal massage method. The semen was evaluated for volume of semen, concentration of sperm, sperm mobility, live and dead sperm%, abnormal sperm%, acrosomal integrity and MTT dye reduction test for sperm fertilization ability. The volume of the semen ejaculate was measured by drawing the sample into a 1 ml syringe. The concentration of sperm was estimated by the method using a colorimeter (CL 157; Elico Ltd, Hyderabad, India) at wave length at 540 nm32. Sperm motility was subjectively assessed as percentage of progressively motile sperm by placing a drop of diluted semen on a clean, grease-free glass slide, overlaid with a coverslip, and examined at 20 x magnifications. Percentage of live and dead sperm was estimated by differential staining technique using eosin–nigrosin stain33. For counting abnormal sperm, glass slide smear was prepared from each sample and 200 sperm were counted in each slide for calculating abnormal sperm percentage. The intact acrosome (Acrosomal integerty) in sperm was assessed as described in the literature34. Briefly, 10 μl of diluted semen was mixed with 10 μl of stain solution [1% (W/V) rose Bengal stain, 1% (W/V) fast green FCF and 40% ethanol in citric acid (0.1 M) disodium phosphate (0.2 M) buffer (McIlvaine's, pH 7.2–7.3)] and kept for 70 s. A smear from the mixture was made on glass slide, dried and examined under microscope with high magnification (100X). The acrosomal caps were stained blue in acrosome-intact sperm, and absence of staining in the acrosome region of acrosome reacted sperm. A minimum of 200 sperm were counted in each smear sample for calculating the per cent acrosome-intact sperm. Tetrazolium dye 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reduction test was carried out in duplicate tubes and absorbance was recorded using a colorimeter (CL 157; Elico Ltd, Hyderabad, India) at 570 nm35. The MTT-dye reduction test was performed to determine the fertilizing ability of the sperms.
Realtime PCR. Blood sample of transgenic as well as control birds were collected in vacutainer tube. Total RNA was isolated from whole blood using Trizol following manufacturer’s instruction (Sigma). The total RNA was reverse transcribed with oligo dT primer to synthesize single stranded cDNA. To analyse the cellular stress in knock down and control birds, we employed two heat shock protein genes viz. hsp10 and hsp70.
The mRNA expression of target (Hsp70, Hsp10, IFN-alpha, IFN-beta and IFN-gamma) and reference gene (GAPDH) (Glyceraldehyde 3-phosphate dehydrogenase) in triplicate were quantified in thermal cycler Applied Biosystems® Step One Real Time PCR (Life Technologies) with Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific). The primers designed and used for Hsp70, Hsp10, IFN-alpha, IFN-beta, IFN-gamma and GAPDH genes have been mentioned in Table 14. The threshold cycle (Ct) value of the target and the reference genes were determined from qPCR reactions. The mRNA expression of target gene was analyzed by comparative Ct method of relative quantification. The gene quantification was expressed as “n-fold up/down regulation of transcription” in relation to an internal control. The expression of the target gene was calibrated by that of the reference gene (GAPDH), at each time point and converted to the relative expression (fold of expression), as follows36:
Fold of expression = 2-∆∆Ct
Where, ∆Ct = Average Ct of target gene (Hsp70/Hsp10/IFN-alpha/IFN-beta/IFN-gamma) - Average Ct of reference gene (GAPDH)
∆∆Ct = Average ∆Ct of target sample - Average ∆Ct of calibrator sample
Statistical analysis. The effect of knock-down of ACACA and SREBP1 genes on growth traits, blood profiles, serum biochemical parameters, egg production and quality traits, serum and egg cholesterol, serum progesterone and estrogen concentration were analysed by GLM procedure with SPSS20.0 software. The shRNA groups and sex of the birds were used as fixed effects for all the traits. The model used for analyzing effects was Y= µ+Ri+Eijk
Where, Y=Trait; µ= Overall mean; Ri= Fixed effect of ith shRNA molecule; Eijk= kth residual effect
The Duncan’s multiple range test (DMRT) was performed to determine the effect of each group.