Subjects and sample collection
Demographic and clinical characteristics of JORRP patients and healthy controls are described in Table 1. Overall 46 JORRP patients from Beijing Children’s hospital admitted at the period from January 2018 to December 2019 were enrolled. Ninety three age- and sex- matched healthy controls subjected to the routine physical examination between January 2018 and December 2019 at Beijing Children’s Hospital were recruited. The study was approved by the Medical Ethics Committee of Beijing Children’s Hospital, Capital Medical University (Grant No. 2019-k-43), which acted in compliance with ethical standards defined by the Declaration of Helsinki. Written consents were signed by all the participants or their legal guardians. Peripheral blood samples from healthy controls and JORRP patients were collected in BD Vacutainer™ plastic blood collection tubes with EDTA K2 as anticoagulant. Plasma samples were collected by a centrifugation at 600 g for 5 min at room temperature and the supernatant were aliquoted and stored at -80 ℃.
Table 1
Baseline characteristics of the study participants
|
JORRP group
|
Healthy controls
|
Total number
|
46
|
93
|
Mean age, month
|
48.7 ± 28.9
|
45.8 ± 27.8
|
Gender
|
26 females, 20 males
|
48 females, 45 males
|
Aggressiveness of course
|
Yes = 24 (52.2%), no = 22 (47.8%)
|
−
|
Total number of surgeries
|
Median = 5, range= (1, 16)
|
−
|
Max number of surgeries in one year
|
Median = 2, range= (1, 9)
|
−
|
Recurrence interval (month)
|
Median = 6.1, range= (1.3, 18)
|
−
|
Extra laryngeal Spread
|
2
|
−
|
Required Tracheostomy
|
2
|
−
|
Other Comorbidities
|
1 with stenosis of larynx,
1 with patient foramen ovale
|
−
|
JORRP, Juvenile-onset recurrent respiratory papillomatosis; −, none. |
Assessment of JORRP severity
To provide an overall assessment of disease severity, patients were categorized as having ‘aggressive’ or ‘non-aggressive’ disease according to Doyle et al. criteria as previously reported [15]. This binomial classification has been applied clinically by other researchers [16]. The characteristics of aggressive disease include 10 or more total procedures with three or more procedures within a 1-year period and/or spread of disease distal to the subglottis. By contrast, the characteristics of non-aggressive disease include less than 10 total procedures, less than three procedures within a 1-year period, and the absence of distal spread.
Plasma cytokine concentrations determined by a Luminex 200 system
Plasma concentrations of TNF-α, IFN-γ, IL-10 and IL-4 were determined using a human cytokine panel (MILLIPLEX MAP KIT) and read by a Luminex 200 system (Merck Millipore, Darmstadt, Germany). Luminex was performed as previously described [18]. All samples were measured in duplicate.
PBMCs isolation
Freshly isolated EDTA anticoagulated blood was diluted with PBS solution and layered carefully on Ficoll-Hypaque density gradients. After being centrifuged at 1000 g for 20 min interphase cell layer was carefully transferred into a 15 ml tube. Then the 15 ml tube was filled with 10 ml PBS, and cell pellet was collected after centrifugation at 500 g for 5 min.
Real-time PCR
To confirm the differential expression level of cytokines between patients and healthy controls, total RNA was extracted from PBMCs using the Direct-zol RNA Miniprep (ZYMO research, USA), and the first strand cDNA was synthesized by a RevertAid First Strand cDNA Synthesis Kit (Thermo scientific, USA). SYBR Green real-time PCR was performed with corresponding primers in a QuantStudio 6 flex real-time PCR system (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified as an internal standard for final normalization. The primer sequence is listed in Table 2.
Table 2
Gene
|
Sense primer (5’→3’)
|
Antisense primer (5’→3’)
|
GAPDH
|
CAACGAATTTGGCTACAGCA
|
AGGGGTCTACATGGCAACTG
|
TNF-α
|
CAGCCTCTTCTCCTTCCTGAT
|
GCCAGAGGGCTGATTAGAGA
|
IFN-γ
|
TTTTGAAGAATTGGAAAGAGGA
|
CACTTGGATGAGTTCATGTATTG
|
IL-10
IL-4
|
AGGGAGCCCCTTTGATGAT
TACAGCCACCATGAGAAGGAC
|
GGTTGGGGAATGAGGTTAGG
TGATCGTCTTTAGCCTTTCCA
|
Synthetic HPV6 and 11 antigens
The HPV6 and HPV11 recombinant antigens for in vitro cell culture were synthesized commercially (ProSpec, USA) as described in previous report [19]. Recombinant HPV6 antigen and HPV11 antigen are sequences of immunodominant antigens that are expressed in E. coli. Recombinant HPV6 antigen (Catalogue No. HPV 003) is a 55.6 kDa protein covering the full-length of HPV6 major capsid while recombinant HPV11 antigen (Catalogue No. HPV 004) is a 58.1 kDa protein covering the full-length of HPV11 major capsid (Table S1). Lyophilized antigens were dissolved in phosphate-buffered saline (PBS) at a concentration of 100 mg/ml (stock) and the aliquots were stored at -80°C for use. The titrated dose of 2.5 µg/ml of both antigens were used in culture.
In vitro stimulation of PBMCs and cell culture
For each sample, the PBMCs were isolated, suspended in 10% FBS RPMI-1640 medium (Gibco, Invitrogen, Carlsbad, CA, USA) (5×105 cells/well) in 96-well plates (round-bottomed) at 37°C humidified cell incubator with 5% CO2. Recombinant HPV6 and HPV11 antigens (HPV6/11 antigens) were added to the culture for a 48-hr stimulation. All samples were further processed for cell surface staining with titrated fluorochrome-labelled antibody.
Elispot assay
The HPV-specific response was displayed with a human Elispot assay kits determining the number of responding cells releasing IFN-γ, IL-10, IL-4 or TNF-α after a 24-hr incubation with HPV6/11 recombinant antigens in 96-well round bottom plates (5×105 cells/well). The experiment was implemented according to the manufacturer’s instruction [12]. In each assay, bovine serum albumin (BSA) was added instead of HPV antigen as a negative responder control, and cell mitogen phytohemagglutinin (PHA) was used as a positive responder control (Supplementary 1).
Carboxyfluorescein succinimidyl ester (CFSE) proliferation assay
PBMCs were resuspended in 2 ml RPMI 1640 medium and incubated with 2 µM CFSE (Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 10 min. The reaction was terminated by cold medium with 10 % FBS and placed on ice for 5 min. The stained PBMCs were washed and resuspended with RPMI 1640 medium plus 10 % FBS. Then the washed PBMCs (1×106/ml) were stimulated by HPV6/11 antigens, seeded in 96-well round bottom plates and cultured for 3 days (Supplementary 2). Samples were analyzed by FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA).
Flow cytometry
Freshly isolated PBMCs were resuspended in cell staining buffer (PBS + 3% FBS). For surface marker labeling, 1×106 cells were incubated with different combinations of human antibodies. Human FITC-conjugated anti-CD45RA, PE-conjugated anti-CD4, anti-CD57 and anti-CD8, APC-conjugated anti-CD3, anti-CD25, anti-CD69 and Annexin V (AV) were purchased from Biolegend (San Diego, CA, USA). PerCP-Cy5.5-conjugated anti-CD45RO was purchased from BD Pharmingen (San Diego, CA, USA). Isotype antibodies conjugated with same fluorochrome were used to exclude the non-specific staining. After 20 min incubation at 4°C in dark, samples were washed twice in PBS before final resuspension in 300 µl PBS subjected to flow cytometry analysis. Cell events were acquired with a BD FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA). Data were analyzed with a Flowjo software (Flowjo LLC, Ashland, Oregon).
Statistical analyses
The data were represented as the mean ± SD. Significant differences between JORRP patients and healthy controls were determined by the Student t-test or rank sum test according to the normal distribution test. Statistical analysis was performed with Prism (version 5.04) software. p < 0.05 was considered to be significantly different.