The prevalence of Trichinella spiralis in farmed minks (Neovison vison) associated with exposure to wild rats (Rattus norvegicus) in Shandong province, China

doi:10.21203/rs.3.rs-67739/v1

Download PDF

Research Article

The prevalence of Trichinella spiralis in farmed minks (Neovison vison) associated with exposure to wild rats (Rattus norvegicus) in Shandong province, China

https://doi.org/10.21203/rs.3.rs-67739/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Both of American mink (Neovison vison) and wild rat (Rattus norvegicus) is considered reservoir hosts carrying many endoparasites. Trichinella is a successful parasitic nematode including nine species and three genotypes with a worldwide distribution. However, little is known about the prevalence of Trichinella infection in mink (Neovison vison) and rat (Rattus norvegicus) in China.

Methods In total, 289 muscle samples of minks and 102 rat carcasses were collected between April 2017 and December 2019 in Weihai city of Shandong province, China. The food of minks including chicken skeleton and mashed marine products was also collected at 3 batches. All the samples were used to examine for the appearance of Trichinella by the pooled artificial HCl-pepsin digestion method. The isolates from minks and rats were identified as T. spiralis by multiplex PCR. Then, the phylogenetic tree was constructed based on the sequences of 5S rDNA inter-gene spacer regions.

Results Muscle larvae were detected in 20 out of 289 minks (6.92%) and in 2 of 102 wild rats (1.96%), respectively. The intensity of Trichinella in mink samples was ranged from 0.025 to 0.815 lpg, while the larval burden in rats was 0.17 lpg. The isolates from minks and rats were identified as T. spiralis by multiplex PCR. Sequence analysis revealed a 100% identical alignment of the 5S rDNA inter-gene spacer regions from the two isolates. The phylogenetic tree confirmed the two isolates from minks and rats belonging to T. spiralis based on analysis of the 5S rDNA inter-gene spacer sequence.

Conclusions The present study represents the first report of T. spiralis infection in American mink (Neovison vison) and wild rat (Rattus norvegicus) from Shandong province, China. The farmed minks would be vulnerable to Trichinella infection through exposure to the wild rats. The prevalence of T. spiralis in wild rats may raise a public health concern for the potential zoonotic risk for the domestic animals.

Infectious Diseases

Health Economics & Outcomes Research

Health Policy

Trichinella spiralis

mink (Neovison vison)

rat (Rattus norvegicus)

isolate

species identification

The zoonotic trichinellosis is a parasitic disease of public health significance, caused by infection with larvae of the genus Trichinella [1]. The parasite can infect more than 150 animal species including birds, mammals and reptiles [2, 3]. To data, there are nine species and three genotypes consisting of Trichinella genus [4]. In China, trichinellosis is still recognized as a re-emerging disease [5], and more than 600 outbreaks were reported during 1964–2013, affecting nearly 40 thousand people [6]. The high prevalent setting of human trichinellosis in China is mainly related to the consumption of raw or under-cooked pork, and sporadically to vagarious ingestion of meats from dogs and wild animals as delicacies [7].

American mink (Neovison vison) is one of important economic animals for providing better marten, which is very popular in international fur market. Breed of minks is more increasing in China due to the abundant economic benefit [8]. Owning the largest breeding industry of minks in China, more than 70 percent of marten are yielded in Shandong province, especially around the coastal regions including Yantai, Weihai and Qingdao cities. Meanwhile, mink is also considered a crucial reservoir host for endoparasites in view of its wide food niche breadth (fish, birds, amphibians, small mammals and invertebrates) [9, 10]. Several investigations have showed Trichinella infection in the farmed minks in other countries, but data are limited on the prevalence of Trichinella in farmed minks (Neovison vison) in China.

In China, free-ranging pigs are at high risk for Trichinella spp. infections in humans in the place without any mandatory test [11, 12]. Meanwhile, the domestic animals are assailable to Trichinella infection through exposure to wild reservoir hosts. Wild rats (Rattus norvegicus) can act as the primary reservoir host of Trichinella that trigger the onset of the transmission of zoonotic bacteria, viruses or parasites to the domestic cycle derived from the sylvatic environment when the carcasses are scavenged [13–15]. Rats commonly abundant lives wherever humans live, especially in primitive conditions less than desirable hygiene. However, little report could be available about Trichinella prevalence in wild rats (Rattus norvegicus) in China.

In this survey, we aimed to examine the prevalence of Trichinella infection in farmed American mink (Neovison vison) populations from Weihai city of Shandong province, China, and determined species of the isolates by multiplex PCR and phylogenetic analysis. In order to further investigate the source of infection, we examined Trichinella by artificial digestion of the diets of minks including mixed mash and chicken skeleton, and the rats living closely with minks.

Sample collection

The investigation of Trichinella infection from 289 minks (Neovison vison) was conducted between April 2017 and December 2019 in Weihai city (36°41' ~ 37°35' N, 121°11' ~ 122°42' E) of Shandong province (Fig. 1). Each mink was raised in a cage, farming at a semi-closed house. Samples used for testing mink (Neovison vison) were included tongue, diaphragm, forearm and hind limbs, and muscle tissues of 5 ~ 50 g were taken from one animal [16]. A batch of muscle tissues was stored at 4 °C, keeping no more than 15 days. Due to the minks were fed on chicken skeleton and mixed mash (mainly including little sea-fish, shrimp et al.), we collected 600 g of mixed mash and 800 g of chicken skeleton by 3 batches.

Rats (Rattus norvegicus) (n = 102) around/inside mink farm were trapped between January and December 2019 using mousetraps that placed surrounding the rat holes. The captured rats were kept frozen at -20 °C until examination. The carcass of rats was obtained before laboratory analysis.

If needed, male inbred Kunming mice (6–8 weeks) were purchased from Center of Laboratory Animals, Lanzhou Veterinary Research Institute, Lanzhou, China. All mice were handled in strict accordance with the Good Animal Practice requirements of the Animal Ethics Procedures and Guidelines of the People’s Republic of China.

Parasitological test by artificial digestion

Samples from minks (Neovison vison), mixed marine mash, chicken skeleton or rat carcasses were used to examine for the present of Trichinella by the artificial HCl-pepsin digestion method, following as Gamble et al. (2000) [17]. For preparing sample by blending to digestion, up to 100 g of mixed mash, chicken skeleton, or rat carcass, and 200 g of muscle tissues from minks is minced, and mixed with an equal volume of artificial digestion fluid [1% pepsin (1: 10000, Sigma, USA), 1% HCl and 0.9% NaCl]. The digestion of samples was used the magnetic stirring method, maintaining at 45 °C for 2 h.

The storage and maintenance of Trichinella isolates

Obtained muscle larvae were washed five times in 0.9% NaCl, and then were examined the morphological characteristics under light microscope with 40 × magnification. The loadings of Trichinella were calculated based on the larvae per gram (lpg).

The isolated larvae were stored in 70% ethanol for further species identification by multiplex PCR if the worm is limited. The isolated larvae were recovered through oral infection of Kunming mice using at least 50 larvae for each mouse, and the muscle larvae were obtained by digestion from Kunming mice if needed.

T. spiralis Henan isolate, T. pseudospiralis Russin and T. pseudospiralis strain (ISS141, T4) was maintained in Kunming mice as described by Fu et al. (2009) [18].

Preparation of genomic DNA and PCR assays

Genomic DNA was extracted with the TIANamp Genomic DNA Kit (TIANGEN, China) according to the manufacturer’s instruction. The Trichinella species were identified by multiplex PCR [19], using primers of 5'-GTTCCATGTGAACAGCAGT-3' and 5'-CGAAAACATACGACAACTGC-3'. The PCR amplification was performed using the 2 × Unique™ Taq MasterMix (Novogene, China) according to the manufacturer recommendations, consisting of DNA 1 µL, 2 × Unique™ Taq MasterMix 12.5 µL, 10 µM of each primer, and H₂O up to 25 µL. The PCR cycle condition was performed as following: pre-degeneration at 94 °C for 5 min, 35 cycles of 94 °C for 20 s, 58 °C for 30 s, and 72 °C for 1 min, and 1 extension cycle at 72 °C for 4 min. The PCR products were separated on 1% (w/v) agarose gels, stained with GoldenView™.

Sequencing and phylogenetic analysis of the 5S rDNA inter-gene spacer region

For phylogenetic analysis, the 5S rDNA inter-gene spacer region of Trichinella was amplified according to our previous description [18], using primers as following: PF: 5'- TTGGATCGGAGACGGCCTG − 3' and PR: 5'- CGAGATGTCGTGCTTTCAACG − 3'. All the primers were synthesized by Invitrogen Company, China. The PCR reaction system was performed in a volume of 25 µL, consisting of DNA 2 µL, 2 × Unique™ Taq MasterMix 12.5 µL (Novogene, China), 10 µM of each primer, and H2O up to 25 µL. The thermal cycling condition was performed as following: pre-amplification cycle at 94.8 °C for 5 min, followed by 35 cycles of 94.8 °C for 1 min, 55.8 °C for 1 min, 72.8 °C for 1 min, and followed by the last cycle at 72.8 °C for 10 min.

The PCR products derived from 5S rDNA inter-gene spacer region were directly sequenced by the Shanghai Songon Biological Engineering Biotechnology Company, China. The obtained sequences were aligned with the corresponding sequences from T. spiralis Henan isolate, T. pseudospiralis Russin and T. pseudospiralis strain (ISS141, T4) amplified in this study, as well as from T. spiralis ISS623 (accession no.: GU339129), T. spiralis ISS154 (accession no.: GU339131.1), T. spiralis ISS31 (accession no.: GU386314.1), T. spiralis ISS1222 (accession no.: GU339135.1), T. spiralis ISS03 (accession no.: KM357422), T. nelsoni ISS37 (accession no.: KM357416.1), T. patagoniensis ISS2311 (accession no.: MF668227.1), T. nativa (accession no.: AP017702.1), T. britovi ISS120 (accession no.: KM357413.1), T. murrelli ISS417 (accession no.: KM357414.1), T. papuae ISS1980 (accession no.: KM357417.1), T. pseudospiralis ISS176 (accession no.: KM357410.1), Trichinella sp. T6 (accession no.: JQ511989.1), Trichinella sp. T8 (accession no.: EF517128.1) and Trichinella sp. T9 (accession no.: KM357420.1) getting from GenBank. The alignment was performed by ClustalX 1.83 [20]. Phylogenetic tree was reconstructed using maximum parsimony (MP) method based on the sequences derived from 5S rDNA intergene spacer region of different Trichinella isolates. The MP method was performed using MEGA 5.05.

Isolates from minks ( Neovison vison ), mixed mash, chicken skeleton and rats ( Rattus norvegicus )

After artificial digestion, Trichinella were obtained from minks and rats, but were not detected in mixed marine mash and chicken skeleton. The overall rates of Trichinella infection in minks (Neovison vison) and rats (Rattus norvegicus) were 6.92% (20/289) and 1.96% (2/102), respectively. Thereinto, about 150 larvae were isolated from a blending muscle tissue of minks, and then were reserved in Kunming mice by oral. The lpg of infected mink samples was ranged from 0.025 to 0.815. The larval burden in collected rats was 0.17 lpg.

Identification of Trichinella species by multiplex PCR

The obtained larvae were identified species by multiplex PCR. As shown in Fig. 2, the size of PCR production of larvae from mink and rat samples was identical to that of T. spiralis Henan isolate with approximate 200 bp in length, which was coincided with the expected size (173 bp) for T. spiralis as reported. The fragments from T. pseudospiralis Russin and T. pseudospiralis ISS141 were longer than 300 bp, respectively. The result indicated that the larvae isolated from American minks (Neovison vison) and wild rats (Rattus norvegicus) should be identified as T. spiralis.

Sequencing and phylogenetic analysis of 5S rDNA inter-gene spacer region

The sequencing result of 5S rDNA inter-gene spacer region from minks was showed 100% identical with that from rats. The length of amplified 5S rDNA inter-gene spacer region from minks (accession no. in GenBank: MT734668) and rats (accession no. in GenBank: MT734669) was 568 bp after fragment assembly. The 5S rDNA inter-gene spacer region from minks revealed 1 transition (522 T to C) in alignment with the corresponding sequence from Henan isolate.

Phylogenetic analysis using MP based on the 5S rDNA inter-gene spacer region showed that Trichinella isolates from minks and rats were all grouped with T. spiralis strains, which further indicated they were belonged to T. spiralis (Fig. 3).

The prevalence of Trichinella in minks has been reported in many countries [21–23]. In the present study, we reported the first data on Trichinella infection in farmed American minks (Neovison vison) in China. The overall Trichinella prevalence in minks here was 6.92%, which was lower than that in minks from Estonia (23%) [9] and Canada (8.3%) [24], but higher than that in minks from Poland (3.3%) [10] and Belarus (4%) [25]. The difference in Trichinella prevalence in minks among studies would be resulted from the simple size, geographic region, living environment, climatic conditions, as well as animal husbandry practices, socioeconomic and ecological conditions.

The species of Trichinella isolates from minks and rats were all identified as T. spiralis in the present study, which was different from another previous investigation, isolated T. britovi and T. pseudospiralis two more strains in minks [10]. T. spiralis is considered a preponderant species in China, and as many as 13 isolates are identified as T. spiralis obtained from mainland China until now [7]. After isolated T. spiralis from caged minks, we raise a question as to how the minks acquired Trichinella, the unique parasite that transmit to other animals solely by ingestion of muscles infected with encysted larvae [15]. The food of minks was then conducted to examine the presence of Trichinella, but no worms were detected.

Each investigated mink raises in one cage. The cages are setting under a semi-closed house, which one side of the house orientate to the open, facilitating the keepers add mink diets to the food box. In the mink farm, there are many rat holes around the feeding house. According to the keepers, rats often grab the diets of minks from the food box. The fact that the stealing rats could be suddenly preyed by minks sometimes provides the other possible route of minks acquired Trichinella. After artificial digestion, T. spiralis was obtained from rat carcass, and was identified 100% identity of the partial 5S rDNA inter-gene spacer region to the mink isolate. We thus deduced that, for minks, T. spiralis could be transmitted from wild rats, although it should not be the only route.

Minks have been showed to carry Hepatitis E virus [26], SARS-CoV-2 [27], Cryptosporidium spp. [28] and several other zoonotic pathogens [29–32]. In the present study, we identified the presence of foodborne Trichinella in farmed caged minks. Even though the zoonotic T. spiralis infection does not influence the furry quality, the carcasses of minks would increase the biomass of T. spiralis in the surrounding environment, if they are not adequately destroyed.

The overall prevalence of Trichinella infection in rats from Weihai city of Shandong province was 1.96%, which is lower than that in rats from Northwest Vietnam (2.8%) [33] and Poland (23.33%) [34]. T. spiralis infection in wild rats is also well investigated in Europe [35, 36] and America [37]. However, the prevalence of Trichinella species circulating is usually overlooked in rats in China. The rats could extensively live from the sylvatic to the domestic environment, so as to play as a vector of Trichinella transferred the parasite between domestic animals and wildlife [15, 35]. Although the low larval intensity is detected in the investigated rats (0.17 lpg), presence of T. spiralis in rats indicated that attention needs to raise for the pig and chicken farms in view of the public health concerns.

The present study firstly demonstrated T. spiralis prevalence in minks and rats from Weihai city of Shandong province, China. The wild rats would be responsible for the caged minks acquired T. spiralis in the ecological and genetic viewpoint. Supervisions and inspections of destroying mink carcasses should be urgent for veterinarians, farmers and governmental authorities, and also the prevalence of T. spiralis in rats should be further assessed its risk for the domestic animals.

Acknowledgements

Not applicable.

Authors’ Contributions

N-ZZ conceived the study. NZZ, BQF, WHL, HJY designed the study protocol. NZZ, HJY, DYN, WGC, YJL, HTQ, LL performed the experiments. NZZ, WZJ, HBY analyzed the data. NZZ drafted the manuscript. BQF and WHL contributed to revise the manuscript. All authors read and approved the final manuscript.

Funding

This study was funded by the National Key Research and Development Program of China (2017YFD0501300) and Jiaxing Science and Technology Project (2017AY33084).

Availability of data and materials

The 5S rDNA inter-gene spacer sequences of Tichinella spiralis from American minks and wild rats have been deposited in the GenBank under the accession numbers MT734668 and MT734669.

Ethics approval and consent to participate

All procedures involving animals in the present study were approved and this study was approved by the Ethics Committee of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Approval No. LVRIAEC2019-028).

Consent for publication

Not applicable.

Competing interests

All authors declare no potential conflicts of interest and no sources of support.

Author details

¹ State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Public Health of the Ministry of Agriculture, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China. ² School of Advanced Agricultural Sciences, Jiaxing Vocational & Technical College, Jiaxing 314036, China. ³ Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Disease, Yangzhou 225009, China.

Gottstein B, Pozio E, Nöckler K. Epidemiology, diagnosis, treatment, and control of trichinellosis. Clin Microbiol Rev. 2009;22:127-45.
Murrell KD, Pozio E. Worldwide occurrence and impact of human trichinellosis, 1986-2009. Emerg Infect Dis. 2011;17:2194-202.
Mancianti F, Terracciano G, Sorichetti C, Vecchio G, Scarselli D, Perrucci S. Epidemiologic survey on Toxoplasma gondii and Trichinella pseudospiralis infection in Corvids from Central Italy. Pathogens. 2020;9:336.
Pozio, E. Scientific achievements of the last 60 years: From a single to a multispecies concept of the genus Trichinella. Vet Parasitol. 2020;(online).
Cui J, Wang ZQ, Kennedy MW. The re-emergence of trichinellosis in China? Trends Parasitol. 2006;22:54-5.
Liu M, Boireau P. Trichinellosis in China: epidemiology and control. Trends Parasitol. 2002;18:553-6.
Bai X, Hu X, Liu X, Tang B, Liu M. Current research of trichinellosis in China. Front Microbiol. 2017;8:1472.
Zheng WB, Zhang XX, Ma JG, Li FC, Zhao Q, Huang SY, et al. Molecular detection and genetic characterization of Toxoplasma gondii in farmed minks (Neovison vison) in Northern China by PCR-RFLP. Plos One. 2016;11:e0165308.
Miller I, Järvis T, Pozio E. Epidemiological investigations on Trichinella infections in farmed fur animals of Estonia. Vet Parasitol. 2006;139:140-4.
Hurníková Z, Kołodziej-Sobocińska M, Dvorožňáková E, Niemczynowicz A, Zalewski A. An invasive species as an additional parasite reservoir: Trichinella in introduced American mink (Neovison vison). Vet Parasitol. 2016;231:106-9.
Li T, He S, Zhao H, Zhao G, Zhu XQ. Major trends in human parasitic diseases in China. Trends Parasitol. 2010;26:264-70.
Zhang N, Li W, Fu B. Vaccines against Trichinella spiralis: Progress, challenges and future prospects. Transbound Emerg Dis. 2018;65:1447-58.
Meerburg BG, Singleton GR, Kijlstra A. Rodent-borne diseases and their risks for public health. Crit Rev Microbiol. 2009;35:221-70.
Pozio E. Searching for Trichinella: not all pigs are created equal. Trends Parasitol. 2014;30:4-11.
Pozio E. Adaptation of Trichinella spp. for survival in cold climates. Food Waterborne Parasitol. 2016;4:4-12.
Gajadhar AA, Noeckler K, Boireau P, Rossi P, Scandrett B, Gamble HR. International commission on trichinellosis: Recommendations for quality assurance in digestion testing programs for Trichinella. Food Waterborne Parasitol. 2019;16:e00059.
Gamble HR, Bessonov AS, Cuperlovic K, Gajadhar AA, Knapen F, Noeckler K, et al. International commission on trichinellosis: Recommendations on methods for the control of Trichinella in domestic and wild animals intended for human consumption. Vet Parasitol. 2000;93:393-408.
Fu BQ, Liu MY, Yao CY, Li WH, Li YG, Wang YH, et al. Species identification of Trichinella isolates from China. Vet Parasitol. 2009;159:214-7.
Pozio E, La Rosa G. PCR-derived methods for the identification of Trichinella parasites from animal and human samples. Methods Mol Biol. 2003;216:299-309.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL-X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876-82.
Schad GA, Leiby DA, Murrell KD. Distribution, prevalence and intensity of Trichinella spiralis infection in furbearing mammals of Pennsylvania. J Parasitol. 1984;70:372-7.
Hirvelä-Koski V, Aho M, Asplund K, Hatakka M, Hirn J. Trichinella spiralis in wild animals, cats, mice, rats and farmed fur animals in Finland. Nord Vet Med. 1985;37:234-42.
Yamaguchi T. Present status of trichinellosis in Japan. Southeast Asian J Trop Med Public Health. 1991;22:S295-S301.
Dick TA, Kingscote B, Strickland MA, Douglas CW. Sylvatic trichinosis in Ontario, Canada J Wildl Dis. 1986;22:42-7.
Shimalov V, Shimalov V. Helminth fauna of the American mink (Mustela vison Schreber, 1777) in Belorussian Polesie. Parasitol Res. 2001;87:886-7.
Wang L, Gong W, Fu H, Li M, Zhang Y, Luo Z, et al. Hepatitis E virus detected from Chinese laboratory ferrets and farmed mink. Transbound Emerg Dis. 2018;65:e219-23.
Oreshkova N, Molenaar RJ, Vreman S, Harders F, Oude Munnink BB, Hakze-van der Honing RW, et al. SARS-CoV-2 infection in farmed minks, the Netherlands, April and May 2020. Euro Surveill. 2020;25:2001005.
Yang Z, Zhao W, Wang J, Ren G, Zhang W, Liu A. Molecular detection and genetic characterizations of Cryptosporidium spp. in farmed foxes, minks, and raccoon dogs in northeastern China. Parasitol Res. 2018;117:169-75.
Zheng WB, Cong W, Meng QF, Ma JG, Wang CF, Zhu XQ, et al. Seroprevalence and risk factors of Toxoplasma gondii infection in farmed minks (Neovison vison) in Northeastern and Eastern China. Vector Borne Zoonotic Dis. 2016;16:485-8.
Li X, Li J, Zhang X, Yang Z, Yang J, Gong P. Prevalence of Pentatrichomonas hominis infections in six farmed wildlife species in Jilin, China. Vet Parasitol. 2017;244:160-3.
Cong W, Qin SY, Meng QF. Molecular characterization and new genotypes of Enterocytozoon bieneusi in minks (Neovison vison) in China. Parasite. 2018;25:34.
Ramírez-Pizarro F, Silva-de la Fuente C, Hernández-Orellana C, López J, Madrid V, Fernández I, et al Zoonotic pathogens in the American mink in its southernmost distribution. Vector Borne Zoonotic Dis. 2019;19:908-14.
Thi NV, Nguyen VD, Praet N, Claes L, Gabriël S, Huyen NT, et al. Trichinella infection in wild boars and synanthropic rats in northwest Vietnam. Vet Parasitol. 2014;200:207-11.
Bilska-Zając E, Różycki M, Antolak E, Bełcik A, Grądziel-Krukowska K, Karamon J, et al. Occurrence of Trichinella spp. in rats on pig farms. Ann Agric Environ Med. 2018;25:698-700.
Stojcevic D, Zivicnjak T, Marinculic A, Marucci G, Andelko G, Brstilo M, et al. The epidemiological investigation of Trichinella infection in brown rats (Rattus norvegicus) and domestic pigs in Croatia suggests that rats are not a reservoir at the farm level. J Parasitol. 2004;90:666-70.
Pozio E, Rinaldi L, Marucci G, Musella V, Galati F, Cringoli G, et al. Hosts and habitats of Trichinella spiralis and Trichinella britovi in Europe. Int J Parasitol. 2009;39:71-9.
Leiby DA, Duffy CH, Murrell KD, Schad GA. Trichinella spiralis in an agricultural ecosystem: transmission in the rat population. J Parasitol. 1990;76:360-4.

Download PDF

Version 1

posted

You are reading this latest preprint version

The prevalence of Trichinella spiralis in farmed minks (Neovison vison) associated with exposure to wild rats (Rattus norvegicus) in Shandong province, China

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusions

Declarations

References

Status:

Version 1