Strain and culture conditio
A. rolfsii (Teleomorph: Athelia rolfsii) deposited in the Chinese Academy of Agricultural Sciences (CAAS) was used as the WT and cultured in PDA medium (composed of peeled potato 200 g, dextrose 20 g, agar 15 g, distilled water 1 L, pH = 7.5) and in a fermentation medium (composed of glucose 130 g, NaNO3 3 g, yeast extract 1 g, KCl 0.5 g, KH2PO4 1 g, MgSO4·7H2O 0.5 g, distilled water 1 L, pH = 7.5) at 30°C. Batch fermentations were performed in a 5-L fermenter containing 3-L of the fermentation medium. All the components were autoclaved for 20 min at 115°C for sterilization. Hygromycin-BPDA medium was mainly composed of PDA and hygromycin (35 µg ml-1) with bromophenol blue (60 µg ml-1), which is an indicator that changes color from yellow to blue at the pH of 3-4.6. The strain was identified with ITS primers. All primers used in this study are listed in the Supplementary Table S1.
AAT1 identification
To identify AAT1, we first downloaded the assembled genome of Athelia rolfsii (GCA_000961905.2) from NCBI and annotated its protein-coding genes using the GeneMark-ES [26] with opinions ‘--ES –fungus --sequence’. We also assembled a transcriptome data available from the NCBI SRA database for A. rolfsii (accession ID: SRS025455) using SPAdes [27] with opinions ‘--sc -s --careful -k 75’, as well as annotated the protein-coding genes. All protein-coding genes were combined and renamed, starting with A0000000.
We manually selected AAT1 from 6 well-annotated fungal genomes including Scheffersomyces stipitis, Emiliania huxleyi, Kluyveromyces marxianus, Saccharomyces cerevisiae, Pseudogymnoascus destructans, and Candida albicans and BLASTed their protein sequences against the identified protein-coding genes of A. rolfsii (Supplementary Figure S4a). We identified the gene “A0001768” from the transcriptome data as the best hit. We then confirmed that “A0001768” could cover the full-length of AAT1 by building a multiple sequence alignment using the protein sequences of “A0001768” and the 6 fungal AAT1 proteins using an online version of the Clustal Omega [28-29]. The result could be visualized using an online version of Mview [30] later.
Finally, we obtained the gene structure (i.e., the delineation of its exons) of “A0001768” (Supplementary Figure S4b) by mapping its coding sequences to its assembled genome using the BLAT [31].
Preparation of Cas9 protein, sgRNA, and plasmids
Cas9 protein was purchased from New England BioLabs Inc. The protospacer sequences (CAGACCGGGACGACAAACCGTGG) of sgRNA named “CR1-AAT1” were designed and screened against the target by using the Geneious software and confirmed with the online tool CHOPCHOP [32-33]. TrancrRNA and crRNA were purchased from GenePharma (Suzhou China). The assembling of guide-RNA complexes was performed as described here: 4.5 μL of crRNA (50 μM), 4.5 μL of trancrRNA (50 μM), and 10 μL of duplex buffer were mixed in a well, and the well was incubated at 95°C for 5 min and then cooled down to the room temperature for 20 min. All plasmids used in this study and their purposes are listed in the Supplementary Table S2, and they were all purchased from Addgene.
Preparation of protoplast
The protoplast formation was performed as described elsewhere [34], with some slight modifications. Briefly, after 90 min of the incubation for depriving the cell wall, we used sterile 100 μm of the Cell Strainer to filter out the impurities of the reaction mixture.
Transformation for S. rolfsii
PEG-mediated fungal transformation was conducted according to the previously described method [35], with some modifications. Briefly, the RNPs and Htb2-GFP plasmid were prepared during the generation of the protoplasts, where the Cas9 RNPs were prepared as follows: 10 μL of assembled guide-RNA complexes (as described above) and 5 μL of Cas9 protein (50 μM) were added to a total volume of 50 μL with 5 μL of 10× Cas9 Nuclease Reaction Buffer and diethylpyrocarbonate (DEPC)-treated water. This mixture was incubated in a 37°C water bath for 25 min, and 100 µL of the fungal protoplasts were mixed with 20 μL of Cas9 RNPs and Htb2-GFP plasmid at the room temperature for 20 min. Then, 40% of PEG was added to the above system, followed by incubation at the room temperature for 20 min. After STC buffer (composed of 1.2 M Sorbitol, 10 mM Tris–HCl, 10 mM CaCl2; pH 7.5) was mixed well by gently inverting the tubes several times, the total system was directly transferred into the MGY regeneration medium (composed of 1% malt extract, 1% glucose, 0.1% yeast extract, 2% agar; pH 5.5) with 0.5 M sucrose osmotic stabilizer. After 4 days of incubation, the protoplasts developed into incipient colonies that could be observed with the naked eye, and the bottom agar was covered with 20-mL of top-selective hygromycin-BPDA agar.
Fluorescence microscopy
The subcellular localization of eGFP was followed using the Leica DMi8 Fluorescence microscope. The transformants containing pDHt/sk-PE were cultured in the MGY agar plate in a dark incubator at 30°C for 7 days.
Analytical method
Mycelium was obtained by germination of water-preserved sclerotia on PDA agar plate and incubated at 30°C, as previously described [36]. Then, two 250-mL of Erlenmeyer flasks containing 50-mL of the liquid MGY medium were inoculated with 5 mycelium-covered agar discs (approximately 5-mm diameter) removed from the 2-day-old PDA culture of WT and AAT1-MT, respectively, at 30°C on an orbital shaker at 250 rev min-1 for 45 h, followed by HPLC-MS analysis. The mycelia were frozen in the refrigerator at -80°C. After thawing, the mycelia were grinded in a mortar until they were completely broken and mushy in texture. Then, equal volume of ethyl acetate was added to extract and collect the ethyl acetate phase under the ultrasonic condition at 100 kHz for 1 h. Rotatory evaporation was performed to dry the collected phase at 55℃, after which 6–mL of methanol was added into a volumetric flask, followed by testing of the metabolites from the mycelium, such as AKG. The HPLC system (Agilent Technologies Inc., California, United States of America) was coupled with an MS detector (AB SCIEX, Foster City, CA, USA) equipped with electrospray ionization (ESI) source with positive and negative modes (ESI+ and ESI−). Reverse-phase chromatographic analysis was performed using a C-18 reverse-phase HPLC column (200 mm × 4.6 mm internal diameter, 5-μm particle size) at 25°C under isocratic conditions, where the concentration of the mobile phase was kept constant throughout the run. The running conditions included a 10-μL injection volume of the mobile phase methanol-0.02% acid ([NH4]2HPO4) (5:95, v/v), at the flow rate of 0.8 mL min-1, and detected at 197 nm. The samples were filtered through a membrane filter (0.22-μm pore size; ANPEL) prior to injection in a sample loop. The standard curve and the equation of linear regression are depicted in Supplementary Figure S5. The peak areas of all oxalic acid relative standards and samples are listed in Supplementary Table S3.
We also comparatively measured the scleroglucan production in the fermentation broth between the WT and AAT1-MT. The fermentation broth was diluted 5-times with distilled water, heated at 70°C for 40 min, and then centrifuged at 13400 ×g for 25 min. The precipitate obtained was washed with distilled water and dried at 105°C. An equal volume of absolute ethanol was added to the supernatant in order to precipitate scleroglucan. The mixture was then maintained on an ice bath for 12 h to precipitate completely. Finally, the scleroglucan produced was recovered by vacuum drying [37].
Bioassays of acid metabolites
In order to identify whether AAT1-MT could produce more acid metabolites than WT, bioassays were performed using detached peanut leaflets inoculated with an agar plug of S. rolfsii mycelia. The S. rolfsii cultures were grown on PDA plates and 5-mm plugs were taken from the actively growing edge. Leaflets were wounded with a knife over an area of 5 mm on the adaxial surface, near the midvein, and the removed plugs were placed on the open wounds. Five leaflets were inoculated for each plant line tested using a minimal quantity of agar in each plug. The plates were then incubated for 36 h at 30°C, after which the lesion area could be detected by the development of bright brown color caused by reaction with oxalic acid.
Statistical analysis
All experiments with the WT and AAT1-MT mycelium samples were performed in three biological replicates. The data obtained from repeated HPLC analyses were pooled and subjected to analysis of variance (ANOVA) for statistical significance by the least significance difference (LSD) test at P = 0.01. An independent sample t-test was performed for statistical evaluations between the WT and AAT1-MT strains (P ≤ 0.05) by using the SPSS 21.0 software (IBM, Chicago, IL, USA).