Ethics
This study was carried out in strict conformed to the recommendations in the Guide for the Care and Use of Laboratory Animals according to the Animal Ethics Procedures and Guidelines of the Chinese National Institutes of Health. The experiment was approved by the Institutional Animal Care and Use Committee (IACUC) of Zhejiang Academy of Medical Sciences (Approval ID: 2018 − 102).
Strains and samples
The Toxoplasma gondii tachyzoites (RH strain) preserved by our laboratory were used in this study. T. gondii tachyzoites were cultured in vitro under standard procedures by serial passages in Vero cell and prepared as described previously[32]. The stray dogs and cats blood sample were provided by animal protection base of Zhejiang Small Animal Protection Association. A total of 318 blood samples were collected from Zhoushan, Deqing, Lishui, Yiwu, Wenzhou respectively, Zhejiang province. For nucleic acid extraction, each blood sample was anticoagulated. All the blood samples were collected by experienced staff from animal hospital and stored at 4℃ until been used.
DNA extraction and serum separation
As positive control, genomic DNA was extracted from Toxoplasma gondii RH strains according to the introduction of Animal Genomic DNA Quick Extraction Kit (Beyotime, Shanghai, China). The anticoagulant blood sample was extracted DNA by magnetic beads adsorption using KBM Blood Genomic DNA Extraction Kit (KBM, Hangzhou, China). The concentration of genomic DNA extracted was evaluated on NanoDrop spectrometry (Thermo Fisher Scientific, MA,USA), then stored at -20℃ until use..
Design of primers and probe
According to reported of molecular tests on T. gondii, it’s proved that B1 gene (GenBank AF179871) and 529-bp repeated element (GenBank AF146527) are the potential optimal targets. B1 gene, which is used in the molecular detection extensively of T.gondii previously, has 35 copies in the T.gondii genome[33]. 529-bp repeated element, as the newly discovered target gene, has up to 300 copies therefore been more sensitively and specifically for detection[34]. Therefore, we target tne 529-bp repeated element for T. gondii detection in our study. The success of LAMP amplification depends on ideal primers target the gene. For the LAMP assay targeting the 529-bp repeated element of T.gondii, we design a set of specific oligonucleotide primers on an online LAMP primer designing software Primer Explorer V3 (http://primerexplorer.jp/e/;). The forward inner primer FIP was labeled with biotin in the 5′ end and the probe labeled with fluorescein isothiocyanate (FITC) was designed between primers B1c and B2 for molecular hybridization detecting FITC-biotinylated LAMP product (Figure 1). The primer sequences used in our experiment are listed in Table 1.
Table.1.
The specific primers of PCR and LAMP used in this study.
Primers
|
Sequences(5’→3’)
|
Sizes of amplicons(bp)
|
LAMP
|
|
202
|
F3
|
ACGAGAGTCGGAGAGGGA
|
B3
|
TGGATTCCTCTCCTACCCCT
|
FIP(F1c-F2)
|
GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGC
|
BIP(B1c-B2)
|
GACGACGCTTTCCTCGTGGTCAAGCCTCCGACTCTGTCT
|
|
FITC-Probe
|
FITC-GGCGGAGAGAATTGAAGAGTGGAGAA
|
|
PCR
|
|
|
F
|
ACGAGAGTCGGAGAGGGA
|
202
|
R
|
TGGATTCCTCTCCTACCCCT
|
LAMP
The LAMP was performed according to the method reported previously[20, 31, 32]. The forward inner primer FIP was labeled with biotin in the 5′ end and the probe for detecting biotinylated LAMP product was designed between primers B1c and B2 and labeled with fluorescein isothiocyanate (FITC). A total volume of 25 μL optimized LAMP reaction contains 2-4 μL of the extracted DNA, 12.5 μL of 2× reaction mix buffer(1.6 M betaine, 40mM Tris-HCl (pH 8.8), 20 mM KCl, 20 mM (NH4)2SO4, and 0.2% Tween 20), 5 pmol each of the F3 and B3primers, 40 pmol each of the BIP and biotin-FIP primers, 1 μL of Bst 2.0 WarmStart ® DNA polymerase (New England Biolabs, Beijing, China), 8.4 mM MgSO4 (New England Biolabs, Beijing, China), 1.2 uM dNTPs (New England Biolabs, Beijing, China). According to the procedure optimized by our laboratory, the LAMP amplification carried out at 65 °C for 1 h in a constant temperature water bath. For the identification of LAMP product, 1.5% agarose gel electrophoresis was performed. In a comparative study, 1 uL SYTO13 (Thermofisher, Beijing, China) was used as the fluorescent dye for real-time LAMP, the amplification was performed on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The amplification products were determined by the acquisition of the fluorescent signal.
LAMP-Lateral-Flow-Dipstick (LAMP-LFD)
To detect the products of LAMP, a universal rapid detection equipment LAMP- Lateral-Flow-Dipstick (LAMP-LFD) was designed by combining the LAMP reaction and lateral flow dipstick (Figure 2.A). The integrated equipment has connected micro-amplify reaction tube for LAMP reaction and another tube containing nucleic acid dilution buffer with the lateral-flow-dipstick module for LAMP product capture, and the LFD detection module consists of a plastic grooved pedestal and a hermetic plastic cover that contains a visualization window and two connectors. The lateral-flow-dipstick, which set on the plastic grooved pedestal, is composed of a sample pad, application pad, test line, control line, and water-absorbing pad, that the application pad, test line, and control line covered with gold-streptavidin(SA) conjugates, immobilized anti-FITC mouse monoclonal antibody and biotin respectively. Before starting the assay, the user only needs to connect the micro-amplify reaction tube with the reserved connector after the LAMP reaction mixture adding the sample to be detected (Figure 2.B). Put the LAMP-LFD equipment in a constant temperature water bath at 65 °C for 1 h to accomplish the LAMP reaction, then biotinylated FIP primer and FITC-labeled probe in the LAMP reaction mixture made the biotin and FITC conjunct to the ends of amplifying products stem-loop structure, respectively. For the desired product detection after LAMP reaction accomplished, turn over the equipment, and FITC-biotinylated nucleic acid products mix with the nucleic acid dilution buffer, the mixture flow toward the lateral-flow-dipstick, combine with Gold-streptavidin (SA) conjugates forming a triple-labeled complex when flow through the application band, and then it moves up the strip and is captured by the immobilized anti-FITC antibody (test line). The biotinylated FIP primer binds to the Gold-SA conjugates to form a double complex without FITC and is trapped at the immobilized biotin (control line) (Figure 2.C). Read-out the positive result via both test line and control line are visible through the read-window on the cover. Conversely, only control line visible means negative result.
The specificity of LAMP‑LFD
Same LAMP protocol and procedure mentioned above are executed to verifying the specificity of LAMP. The template was replaced by the genomic DNA extracted from Leishmania donovani, Plasmodium vivax, Cryptosporidium parvum, Entamoeba histolytica, Trypanosoma evansi. The amplified product was identified by 1.5% gel electrophoresis. LAMP-LFD was performed as a contrast.
Evaluation of sensitivity of LAMP‑LFD
The sensitivity of LAMP-LFD was evaluated against 10-fold serial dilutions of positive control template(genomic DNA of T .gondii) ranging from 1 ng to 0.01 fg, nuclease-free water were used as negative controls. Meanwhile, as comparative study, PCR was carried out under the protocol described before. Outer forward primer (F3), outer backward primer (B3) of LAMP were used as a pair of upstream and downstream primers in PCR assay. The 25 ul PCR reaction mixture was composed of 12.5 uL 2 × Master Mix (Tsingke, Beijing, China), 5 pmol each of Forward and reverse primers, 2 uL template. Amplification was performed at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 45 s, primer annealing at 53 °C for 30 s, extension at 72 °C for 30 s, and a final extension step at 72 C for 10 min. The PCR products were visualized by 1.5% agarose gel electrophoresis stained with Gel-Red (Beyotime, Beijing, China).
Clinical application for detection of T. gondii
After the establishment of the universal rapid detection LAMP-LFD device for T. gondii, it was applied to the test of blood samples of stray animals (dogs, cats). One of 318 blood samples of dogs and cats collected from Zhejiang Province, China were extracted the genomic DNA. LAMP-LFD and PCR target 529 gene to detect T. gondii nucleic acids in blood samples.